3743 results for "RNA AND sequencing OR transcriptome"

in 15.74 milliseconds.

• RNA sequencing of primary B-cells infected with Epstein-Barr virus (EBV), treated with heat-inactivated EBV, CpG or BCR-crosslinking in presence or absence of Linrodostat

  B cells were isolated from buffy coat preparations of healthy donors using CD19 magnetic beads. B cells were then infected with EBV using spinoculation or activated with heat-inactivated EBV, respectively. Additionally cells were treated with 5ng/ml CpG or a BCR-crosslinking mixture in presence or absence of 10 µM Linrodostat (IDO1 inhibitor). RNA samples were isolated at 2 days post-infection / post-activation and one day 0 control with non-infected B cells was included.

  Dataset EGAD50000000306

• Hypothalamic transcriptome in Prader-Willi syndrome

  Transcriptional analysis of brain tissue from people with molecularly defined causes of obesity may highlight novel disease mechanisms and therapeutic targets. Prader-Willi syndrome (PWS) is a genetic obesity syndrome characterised by severe hyperphagia. We performed RNA sequencing of the hypothalamus from 4 individuals with PWS and 4 age-matched controls.

  Study EGAS00001002901

• Facioscapulohumeral dystrophy transcriptome signatures correlate with different stages of disease and are marked by different MRI biomarkers

  This project includes RNA-sequencing data from human FSHD and control skeletal muscle biopsies. This project includes data from 28 FSHD patients (total 37 samples, including vastus lateralis and tibialis anterior muscles) and 12 control individuals (total 24 samples, including vastus lateralis and tibialis anterior muscles).

  Study EGAS00001005782

• RNA-seq Revision

  The dataset comprises bulk RNA‑seq libraries generated on the Illumina NextSeq 500 platform, including primary human hepatocytes (four donors), colon tissue (four masked replicates), and a comprehensive set of iPSC‑derived samples from the JHU106, ChiPSC18, ChiPSC22, and H9 lines. The collection covers multiple differentiation stages from iPSC to DE to HLC and cultivation protocols (CEL, HAY, SPH) with at least three replicates per condition. All sequencing data are provided as raw FASTQ files, with colon samples delivered as masked FASTQ in accordance with patient consent requirements.

  Dataset EGAD00001008951

• RNA sequencing of CD8 T cells from melanoma patients prior to and during checkpoint immunotherapy and untreated healthy controls

  We are interested in inter-individual variation in transcriptional response to immune checkpoint blockade. We have analysed poly A purified RNA expression from CD8 T cells (297 transcriptomes in total) isolated from metastatic melanoma patients (n=106) prior to and during treatment with either single agent (Pembrolizumab) or combination (Ipilimumab/ Nivolumab) immune checkpoint blockade. We compare expression at different stages of treatment and additionally contrast this with that from healthy controls (n=68).

  Dataset EGAD00001005973

• RNA-seq study of human long-term and short-term hematopoietic stem cells from umblical cord blood with lentiviral overexpression of S1PR3

  To investigate the molecular and biological pathways altered by S1PR3OE in human hematopoietic stem cells (HSC), we performed RNA-sequencing (RNA-seq) of LT- and ST-HSC 3 days after transduction with control or S1PR3 overexpression (OE) lentiviral vectors. LT-HSC and ST-HSC from 3 pool of CB lin- were FACS-purified, cells were prestimulated for 4 hours and transduced with lentiviral vectors. At day 3, 2000-5300 BFP+ cells were FACS-purified for RNA isolation with a PicoPure kit. We were able to isolate only 1600-1800 BFP+ cells from LT-HSC control samples as opposed to 4000-5400 BFP+ cells from S1PR3OE samples. Thus, we pooled all control BFP+ LT-HSC cells into one sample for RNA-seq analysis. BFP- LT-HSC from control vector transduction were purified from CB1 as an additional LT-HSC control. Nextera libraries generated from 10 ng RNA from 5 LT-HSC samples (2 controls, 3 S1PR3OE) and 6 ST-HSC samples (3 controls, 3 S1PR3OE) were subjected to 125 bp, paired-end RNA-sequencing on the Illumina HiSeq 2500 with an average of 50 million reads/sample at the Center for Applied Genomics, Sick Kids Hospital.

  Dataset EGAD00001006582

• Single-Cell DNA and RNA Sequencing over A 29-Year Period of A CLL Patient Demonstrating Evolution of Multiple Cell Clones

  Chronic lymphocytic leukemia (CLL) is a frequent B-cell malignancy characterized by recurrent somatic chromosome alterations and a low level of point mutations. Here we present single nucleotide polymorphism (SNP) microarray analyses of a single CLL patient over 29-years of observation and treatment, and transcriptome and whole genome sequencing at selected timepoints. We identified chromosome alterations of 13q14-, 6q- and 12q+ in early cell clones, elimination of clonal populations following therapy, and subsequent appearance of a clone containing trisomy 12 and a chromosome 10 copy neutral loss of heterogeneity (LOH) that marks a major population dominant at death. Serial single cell RNA sequencing revealed elevated mRNA expression of the FOS, JUN and KLF4 genes just before the appearance of acute disease requiring therapy. This gene expression pattern became undetectable following therapy, but reoccurred following relapse. Transcriptome evolution indicates that complex expression changes occur over time. In conclusion, CLL can evolve gradually during indolent phases, and undergo rapid changes following therapy.

  Study phs001181

• WES and RNA-seq of triple-negative breast cancers from the MyBrCa cohort

  The dataset contains a genomics characterization of 35 triple-negative Asian breast tumours from the Malaysian Breast Cancer cohort. This includes whole-exome sequencing of tumour tissue at 80X, whole-exome sequencing of matched normal (blood) tissue at 40X, and RNA-seq of tumour tissue at 40X coverage (>15 million reads). Whole-exome libraries were prepared using the Nextera Rapid Capture Exome Kit; exome capture was performed in pools of 3 and subjected to paired end 75 sequencing on a NovaSeq 6000 platform. RNA libraries were prepared using the TruSeq Stranded Total RNA HT kit with Ribo-Zero Gold as per manufacturer’s instructions and also subjected to paired end 75 sequencing on a NovaSeq 6000 platform. Uploaded bam files have been mapped to the hs37d5 human genome and processed using the standard GATK pipelines. Paired clinical, demographic, genotyping, and overall survival data for these patients are available from the associated publications or by request.

  Dataset EGAD00001009311

• Molecular Characterization of Prostate Cancer Specimens by Bulk and Single Cell Analysis

  Version 1: We performed single-cell RNA-sequencing (scRNA-seq) of fresh biopsies from metastatic castration resistant prostate cancer. Additionally, where available, we performed matched bulk whole exome sequencing (WXS; tumor and normal paired) and whole transcriptome sequencing for the same individuals. We also performed bulk whole exome (WXS) and RNA-sequencing (RNA-Seq) from FFPE pre-treatment biopsies from patients with clinically localized high-risk prostate cancer.Version 2: We added data from a randomized phase 2 trial of radium-223 with or without pembrolizumab in patients with Metastatic Castration-Resistant Prostate Cancer (mCRPC) to bone. After enrollment, study participants underwent bone biopsy and were randomized 2:1 to receive radium-223 at 55 kBq/kg every 4 weeks + pembrolizumab at 200 mg every 3 weeks (Arm A, R223+P) or radium-223 at 55 kBq/kg every 4 weeks alone (Arm B, R223). Stratification factors were alkaline phosphatase ≥220 vs. Data generated includes bulk whole exome sequencing (WXS), ultra-low pass whole genome sequencing (WGS) at 0.1X coverage, and targeted-capture sequencing. The ultra-low pass sequencing was used as part of the selection criteria for the target capture sequencing. Note: Two subjects in this study are linked to phs001577 and phs000915 respectively.

  Study phs001988

• Single-cell RNA sequencing of sorted regulatory T cells

  Single-cell RNA sequencing of flow cytometry enriched CD4+ CD127- CD25+ regulatory T cells from 8 systemic lupus erythematosus patients (SLE_001 to SLE_007, and SLE_009) collected at baseline (day 0, before interleukin-2 immunotherpay) and day 5 (after 1 treatment cycle of interleukin-2 immunotherapy). Sorted immune cells were hash tagged and then stained with TotalSeq Human Universal Cocktail (Biolegend) before further processing for single-cell RNA sequencing using the 10X-Genomics platform (incl. generation of TCR libraries). Samples from patients SLE_001, SLE_002, SLE_004, SLE_006 were collected and processed on the first day of experiment (Day 1), and samples from patients SLE_003, SLE_005, SLE_007, SLE_009 on the second day of experiment (Day 2). On each day, samples were pooled and distributed to four lanes on the chromium controller. Run ID 245269 and ID 245270 identify samples sequenced on separate flow cells. Provided are raw sequencing files.

  Dataset EGAD50000000663

• Genomic analysis of pancreatic neuroendocrine tumour with MEN1, ATRX, or DAXX mutations

  This dataset includes 52 samples from 19 individuals with pancreatic neuroendocrine tumours. These samples were analyzed using RNA-sequencing, whole-exome sequencing, shallow (~0.3x) whole-genome sequencing, and a 21-gene panel targeted capture sequencing. Everything was sequenced using the Illumina HiSeq and is provided in BAM or FASTQ format.

  Dataset EGAD00001006001

• MuTHER_adipose_tissue_small_RNA_expression

  We investigate the naturally occurring variation of small RNA expression in conjunction with genetic and gene expression variation. We shall assess the variation in subabdominal fat tissue small RNA levels in 168 unrelated MuTHER individuals. Using gene expression data from the same samples, we can survey how much the small RNA expression contributes to the variance in gene expression profiles. We can also take advantage of the high density genotyping data on these samples to identify genetic associations of small RNA expression levels, and the downstream effect of the genetic variants in small RNA sequence. Previous small RNA sequencing efforts have also extended the repertoire of small RNAs, and we hope to potentially find additional small RNAs active in adipose tissue biology. Altogether, the project should provide an exciting view into small RNA biology in humans, and lead to development of new methodology for analysis of molecular phenotype data.

  Study EGAS00001000212

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  The dataset contains bulk RNA sequencing data from 12 pediatric thymus samples collected during cardiac surgeries. These samples represent immunologically healthy donors with a mean age of 6 months. The sequencing was performed using Illumina HiSeq4000, and the processed files are available in standard formats such as FASTQ.

  Dataset EGAD50000001120

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• Epigenomics and Single-cell Sequencing Define Cellular Heterogeneity in Langerhans Cell Histiocytosis

  Epigenomic and transcriptomic analysis of Langerhans cell histiocytosis (LCH) biopsies. Single-cell RNA-seq (10x Genomics) of seven LCH biopsies. ATAC-seq data from four sorted cell populations (in duplicate) from one LCH biopsy.

  Dataset EGAD00001005280

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Postmortem Single Nuclei and Bulk RNA-seq data of the Motor Cortex and Spinal Cord for Healthy, C9ALS and sALS Patients

  This dataset contains both snRNA-seq and bulk RNA-seq data from 19 different patients, comprising of 9 healthy controls (4 Spinal Cord, 5 Motor Cortex) as well as 5 C9ALS patients and 5 sporadic ALS patients, each with paired data from the spinal cord and motor cortex. For the snRNA-seq data, fastq files containing the raw reads are provided, many of these samples were pooled for sequencing and subsequently require demultiplexing using SNPs using a tool such as freemuxlet. The paired bulk RNA-seq data (raw fastq files) can be used to acquire the ground truth per patient - a list of pooled samples can be found in map.txt. snRNA-seq data was produced using the 10X Genomics 3' v3 kit and bulk RNA-seq was produced using the Illumina TruSeq v2 kit.

  Dataset EGAD00001009686

• Custom long non-coding RNA capture enhances detection sensitivity in different human sample types.

  Long non-coding RNAs (lncRNAs) are a heterogeneous group of transcripts that lack protein coding potential and display regulatory functions in various cellular processes. As a result of their cell- and cancer-specific expression patterns, lncRNAs have emerged as potential diagnostic and therapeutic targets. The accurate characterization of lncRNAs in bulk transcriptome data remains challenging due to their low abundance compared to protein coding genes. To tackle this issue, we describe a unique short-read custom lncRNA capture sequencing approach that relies on a comprehensive set of 565,878 capture probes for 49,372 human lncRNA genes. This custom lncRNA capture approach was evaluated on various sample types ranging from artificial high-quality RNA mixtures to more challenging formalin-fixed paraffin-embedded tissue and biofluid material. The custom enrichment approach allows the detection of a more diverse repertoire of lncRNAs, with better reproducibility and higher coverage compared to classic total RNA-sequencing.

  Study EGAS00001005418

• Single cell transcriptome sequencing of the developing human embryonic meninges

  There are no effective medical therapies for meningiomas, partly due to our limited understanding of their cellular origin and composition For this purpose, we generated data to make a comprehensive reference single cell and spatial transcriptomic atlas of human fetal meninges. Samples of meninges from human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development, Furthermore, this dataset should help discover cells of origin for meningiomas.

  Study EGAS50000000980

• Juvenile Sjogren's Syndrome (JSS) Transcriptome Study

  Sjögren's disease (SjD) is a systemic autoimmune disorder with major clinical manifestations of dryness in the eyes and mouth, fatigue, and joint pain. Our interdisciplinary experts in SjD at the University of Florida newly discovered and established a cohort of SjD in children. Many of these patients with childhood SjD (cSjD) demonstrated a prominent feature of recurrent parotitis (RP). To understand the immunopathogenesis of childhood SjD (cSjD) for the first time in the field, we profiled the transcriptome of five groups of four PBMC samples by unbiased, high-throughput single-cell RNA sequencing (scRNA-seq): cSjD (n=4), non-cSjD (n=4), biopsy-positive non-cSjD (BP, n=4), biopsy-positive non-cSjD with RP (BPRP, n=4), and healthy controls (HC, n=4). In this study, RNA sequencing data, as well as all barcodes.tsv.gz, features.tsv.gz, and matrix.mtx.gz that may be used to create a Seurat object in R, will be availableTo protect the confidentiality of subjects, certain data were not assessed or collected in the subject phenotype dataset, such as race, age, height, weight, and education.

  Study phs003048

• FLT3 is genetically essential for ITD-mutated leukemic stem cells but dispensable for human HSCs

  bulk RNA sequencing of AML patients It contains 18 samples from primary AML patients. Half of the samples are control samples and half of the samples are FLT3-ITD knock-out (edited for the FLT3-ITD mutation). It is using Illumina high-throughput technology

  Dataset EGAD50000000636

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10592i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003109

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10679iA

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003110

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10360i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003108

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10360i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003111

• DIPG MEK inhibition RNASeq

  RNA sequencing of Diffuse intrinsic pontine gliomas, primary patient derived DIPG cell cultures and isogenic trametinib resistant clones

  Dataset EGAD00001008212

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10345i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003107

• RNA-sequencing data from vitamin C experiment

  Fasq-files from 3 unaffected TET2 mutation carriers, 2 mutation carriers diagnosed with lymphoma and 3 family members without TET2 mutation. Time series data collected from 0, 6 and 12 months after daily dose of 1g vitamin C.

  Dataset EGAD00001010009

• Single-cell short-read transcriptomes from CH, MDS and AML patients with splicing factor mutations

  Single-cell RNA sequencing from CH (n = 2), MDS (n = 6, MDS02 in 2 replicates) and AML (n = 1, in 2 replicates) samples with mutations in splicing factors (SF3B1 - n = 8, U2AF1 n = 1). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011283

• MPRA-SCZ

  RNA-Seq and ATAC-Seq of iPSC derived neurons under baseline and KCl stimulation conditions from 10 distinct donors, including 5 healthy controls and 5 schizophrenic individuals. scATAC of human post mortem prefrontal cortex from 4 adult individuals including 2 neurotypical individuals and 2 schizophrenic individuals.

  Dataset EGAD00001011335

• Endometrial RNASeq of Patients with MRKH Syndrome and Healthy Controls

  Raw FastQ Files of 69 samples of endometrial tissue from uterus (rudiments) of patients diagnosed with MRKH Type 1/2 or healthy controls. Each sample consists of 2 lanes paired-end RNA sequencing data.

  Dataset EGAD00001006345

• Patient-tailored design for selective co-inhibition of leukemic cell subpopulations

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells of 2 acute myeloid leukemia patients at refractory stage. The profiling was performed using 10x Genomics Chromium Single Cell 3ʹ Gene Expression platform. The raw data are available as fastq files.

  Dataset EGAD00001006360

• Identification of molecule relationship between intravenous leiomyomatosis and uterus myoma

  Up to now, there are two hypothesis about the pathogenesis of the relationship of intravenous leiomyomatosis and uterine myoma. One theory suggests that the IVL comes from the smooth muscle cell in the vessel wall.The other theory indicates that the IVL derives from the uterine myometrium. However, limited to the technology, few studies have been deeply explore the underlying relation. In this study, we employ the RNA sequencing to explore the molecule relationship between IVL and uterus myoma. In order to identify the molecule relationship between IVl and uterine myoma we conducted transcriptome sequencing and bioinformaitc analysis

  Dataset EGAD00001003356

• Single-cell transcriptome landscape of developing fetal gonads defines somatic cell lineage specification in humans

  Single-cell RNA-seq dataset recovering the gene expression programs of around 128,000 single cells derived from 17 fetal testes and 16 fetal ovaries from 5 to 12 postconceptional weeks.

  Dataset EGAD00001009811

• Transcriptome data of WS patients and controls

  Fibroblasts of 4 WS patients and 4 sex matched controls were transformed into iPSCs, which were then differentiated to Neuroepithelial Stem Cells (NESCs), and further differentiated into neurons. RNA sequencing was performed at the NESC stage and after 4 and 8 weeks of neural development for 3 replicates per individual using the Illumina TruSeq stranded library polyA method on the NovaSeq6000 platform at NGI Stockholm. The data was preprocessed using the nf-core/rnaseq (https://nf-co.re/rnaseq) that includes quality control, data cleaning, and read alignment to GRCh38 (STAR, v2.6.1d)

  Dataset EGAD50000001728

• 79 Human Hearts snRNAseq

  Using single-nucleus RNA sequencing, we characterized the transcriptome of 880,000 nuclei from 18 control and 61 failing, nonischemic human hearts with pathogenic variants in DCM and ACM genes or idiopathic disease.

  Dataset EGAD00001009292

• Transcriptome sequencing of hepatocellular carcinoma biopsies (TACE study)

  Illumina-based RNA-Seq analysis of 93 liver samples. Biopsies of tumors and non-tumor tissues are included. Samples are stratified by response and non-response to TACE treatment.

  Dataset EGAD00001008158

• Tumor gene expression profiles for the study "TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells"

  RNA was extracted from formalin-fixed and paraffin embedded tumors of a large cohort of bladder cancer patients before treatment with anti-PD-L1. RNA was sequenced using a capture based approach (exome capture, RNA access).

  Dataset EGAD00001003977

• Single-Cell Analysis of Human Adipogenesis

  The data in this study consists of RNA sequencing reads and read counts from single-cell and single-nuclei RNA sequencing experiments performed on two cell lines to investigate the transcriptional landscape of human adipogenesis in both the brown and white adipose tissue lineage. The two cell lines are human preadipocytes collected and isolated from a defined anatomical location in the neck of a single individual. This depot is known to harbor white adipose tissue (WAT) and brown adipose tissue (BAT). These white and brown preadipocytes were immortalized for the purposes of studying human adipogenesis in vitro. In this study we induced differentiation of these two preadipocyte lines and performed RNA sequencing on over 135,000 single cells spanning a 20-day time course from unperturbed preadipocytes to mature adipocytes from both brown and white lineages. Additionally, we performed both single-cell and single-nuclei RNA sequencing to comprehensively compare the advantages and disadvantages of either technique.

  Study phs002461

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. One possibility for this inefficiency is an incomplete understanding of the molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to develop a foundational dataset for identifying candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Study EGAS00001003667

• Genomics of enteropathy-associated T cell lymphoma (EATL)

  Whole exome sequencing of enteropathy-associated T cell lymphoma (EATL) tumors and paired normals, as well as RNA-sequencing of EATL tumors: including (1) 69 exome capture, paired-end Illumina Hiseq sequencing, BAM files from EATL tumor samples, (2) 36 exome capture, paired-end Illumina Hiseq sequencing, BAM files from EATL paired normal samples, and (3) 32 RNAseq, paired-end Illumina Hiseq sequencing, BAM files from EATL tumor samples.

  Dataset EGAD00001003284