11951 results for "division 2 coins fc 26 Visit Buyfc26coins.com Kupiłem(a) duży pakiet monet FC 26 i dostałem(a) dodatkowy rabat. Świetnie!.fXzt"

in 29.08 milliseconds.

• The landscape of somatic mutation in normal colorectal epithelial cells

  The colorectal adenoma-carcinoma sequence has provided a paradigmatic framework for understanding the successive somatic genetic events and consequent clonal expansions leading to cancer. As for most cancer types, however, understanding of the earliest phases of colorectal neoplastic change, which may occur in morphologically normal tissue, is comparatively limited because of the difficulty of detecting somatic mutations in normal cells. Each colorectal crypt is a small clone of cells derived from a single recently-existing stem cell. Here, we sequenced hundreds of normal crypts from 42 individuals. Signatures of multiple mutational processes were revealed, some ubiquitous and continuous, others only found in some individuals, in some crypts or during some phases of the cell lineage from zygote to adult cell. Likely driver mutations were present in ~1% of normal colorectal crypts in middle-aged individuals, indicating that adenomas and carcinomas are rare outcomes of a pervasive process of neoplastic change across morphologically normal colorectal epithelium.

  Dataset EGAD00001004193

• Next Generation Sequencing in an IBD Pedigree Whole Genome Data

  In 2009 we identified a four-generation family with over 700 members and 41 affected with Crohn's disease (CD). At the time we sequenced the exome of 6 affected individuals but did not identify any coding variants which appear to explain the high prevalence of disease. Since then we have collected DNA from a large number of additional family members, genotyped linkage arrays on the entire family to refine genomic regions shared by identity by descent and genotyped affected and unaffected members at known CD risk loci identified by Genome Wide Association Studies (GWAS). These analyses have confirmed that a significant unexplained excess of disease remains after accounting for all known genetic factors, and that several regions of the genome are shared by a large fraction of affected individuals. We therefore perform whole genomes sequencing from 8 individuals which will allow us to impute the complete sequence of nearly all the members of the two largest and most severely affected branches of the family.

  Dataset EGAD00001000399

• Human dorsal root ganglia after plexus injury - RNA-fragment sequencing from histological slices

  Human dorsal root ganglia from patients with brachial plexus injury and from subjects from forensic autopsy were extracted and fixed with paraformaldehyde. The cellular composition of these DRG was analysed in histopathological slices. From some of the slices, total RNA was extracted and total RNAseq was performed. The RNA sequencing data represent DRG with neuronal preservation (n=6) or neuronal loss (n=2) versus control (n=6). Details can be found in the corresponding publication and supplement to this publication.

  Study EGAS50000000682

• Single-cell and spatial atlas of steatotic liver disease-related hepatocellular carcinoma

  This study consists of the spatial transcriptomics data generated by : 1. Visium CytAssist Spatial Gene Expression for FFPE (10x) for steatotic liver disease-associated hepatocellular carcinoma (SLD-HCC) (n=7) and non-SLD-HCC (n=5) 2. CosMxTM Human Universal Cell Characterization RNA Panel (1000-plex); NanoString, USA for n=4 SLD-HCC and n=4 non-SLD-HCC. The goal of this data is to compare SLD-HCC vs non-SLD-HCC as well as response to immunotherapy

  Study EGAS50000001034

• ATAC-seq iPSC cells or smNPC cells for allelic imbalance

  In order to confirm the predicted impact of the PD-associated allele of rs144814361 on BAG3 promoter, we proceeded with genome editing of the TH-REP1 cell line by using prime editing to insert the “T” allele at the position chr10:119651405 in the BAG3 promoter. 3 replicates for each condition: 1) iPSC Wild Type 2) SNP-BAG3 variant in iPSC 3) SNP-BAG3 variant in smNPC. Allelic imbalance is further assessed using read counting at this specific position.

  Study EGAS50000001579

• Small cell carcinoma of the ovary, hypercalcemic type, displays frequent inactivating germline and somatic mutations in SMARCA4

  Small cell carcinoma of the ovary of hypercalcemic type (SCCOHT) is an extremely rare, aggressive cancer affecting children and young women. We identified germline and somatic inactivating mutations in the SWI/SNF chromatin-remodeling gene SMARCA4 in 75% (9/12) of SCCOHT patients in addition to SMARCA4 protein loss in 82% (14/17) of SCCOHT tumors, but in only 0.4% (2/485) of other primary ovarian tumors. These data implicate SMARCA4 in SCCOHT oncogenesis.

  Study EGAS00001000714

• Gut microbiota analysis after 3months probiotic-like bacteria or placebo treatment in subjects with metabolic syndrome

  Background: Probiotic-like bacteria treatment has been described to be associated with gut microbiota modifications. Goal: To decipher if the effects of the tested probiotic-like bacteria are due to the bacteria itself or due to the effects of the bacteria on the gut microbiota. Methodology: In this study, gut microbiota has been analyzed from feces samples of subjects with metabolic syndrome and treated with one of the 2 tested probiotic-like bacteria or with the placebo during 3months.

  Study EGAS00001003585

• Single-cell analysis reveals transcriptomic and epigenomic impacts on the maternal-fetal interface upon SARS-CoV-2 infection

  We assessed the transcriptome and chromatin states of patient and control samples at both bulk and single-cell resolutions with RNA-seq and ATAC-seq. Maternal-fetal interface samples were collected from 7 patients infected with SARS-CoV-2 during late pregnancy, and from 7 gestational age-matched control donors. Raw and processed files are provided in this dataset.

  Dataset EGAD00001008770

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• WGS and RNA-Seq data from a GBM patient PT-PV2594

  WGS and RNA-Seq data from a GBM patient PT-PV2594

  Dataset EGAD00001008526

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• HV31 - De novo assembly of eight immune system regions

  De novo assembly of eight immune system regions for individual HV31, generated using a multi-platform pipeline. A full description of the generation of these assemblies can be found at https://doi.org/10.1101/2021.02.03.429586.

  Dataset EGAD00001007050

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• CIDR, NCI, NIDA Sequencing of Targeted Genomic Regions Associated with Smoking

  This study includes samples from two projects: Collaborative Genetic Study of Nicotine Dependence (COGEND; PI: Laura Bierut) and Genetic Study of Nicotine Dependence in African Americans (AAND; PI: Laura Bierut and Eric Johnson). The majority of the COGEND subjects included in the current study overlap with the two datasets already available on dbGaP. GWAS data are available for COGEND subjects through the Study of Addiction: Genetics and Environment (SAGE), dbGaP study accession phs000092. It should be noted that the case definition in the SAGE study is DSM-IV alcohol dependence. GWAS data are available for additional COGEND subjects through The Genetic Architecture of Smoking and Smoking Cessation, dbGaP study accession phs000404. The overall goal of this project is to apply deep sequencing to key genomic regions associated with nicotine dependence in order to accelerate the discovery of variation in molecular pathways that govern the development of nicotine dependence. The sample includes unrelated cases and controls of European American and African American descent. Cases are defined by a commonly used definition of nicotine dependence, a current score of 4 or more (maximum score of 10) on the Fagerstrom Test for Nicotine Dependence (FTND). Control status is defined as an individual who smoked at least 100 cigarettes during their lifetime, yet never became dependent (lifetime FTND<2). By selecting controls who smoked cigarettes, we focus on those genetic effects that are specific to the development of nicotine dependence. COGEND: COGEND was initiated in 2001 as a three-part program project grant funded through the National Cancer Institute (NCI; PI: Laura Bierut). The three projects included a study of the familial transmission of nicotine dependence, a genetic study of nicotine dependence, and a study of the relationship of nicotine dependence with nicotine metabolism. The primary goal was to detect, localize, and characterize genes that predispose or protect an individual with respect to heavy tobacco consumption, nicotine dependence, and related phenotypes and to integrate these findings with the family transmission and nicotine metabolism findings. The primary design was a community based case-control study. Nicotine dependent cases and non-dependent, smoking controls were identified and recruited from Detroit and St. Louis. More than 54,000 subjects aged 25-44 years were screened by telephone; more than 3,100 subjects were personally interviewed; and more than 2,900 subjects donated blood samples for genetic studies. AAND: AAND was initiated in 2009 to identify and characterize genetic determinants of nicotine dependence in a large African American population. Community-based recruitment of approximately 100,000 people was conducted to ascertain 1,000 African American nicotine dependent cases and 1,000 African American non-dependent, smoking controls. All subjects were between the ages of 25-44. Subjects were screened by telephone; if they qualified as a case or control, they completed the same interview that was used in COGEND and donated a blood sample. Both studies (COGEND and AAND) included measures of basic socio-demographic variables, including age, sex, race/ethnicity, family income, and educational attainment using the Semi-Structured Assessment for the Genetics of Nicotine Dependence. Information on nicotine dependence, as assessed by the Fagerstrom Test for Nicotine Dependence (FTND) is available for all subjects. In addition, participants also completed the Nicotine Dependence Syndrome Scale (NDSS; Shiffman et al., 2004) and the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68; Piper et al, 2004). All subjects were assessed in person by trained research assistants.

  Study phs000813

• National Cancer Institute (NCI) Adding Hispanics to Ongoing GWAS in Colorectal Cancer

  Genome-wide association studies (GWAS) of colorectal cancer (CRC) have been instrumental in identifying a number of common susceptibility loci in Non Hispanic (NH)-White populations, and a NCI priority is to extend GWAS findings to other populations to address racial/ethnic disparities in cancer susceptibility. Currently, GWA studies of CRC in NH-Whites, Japanese and African-Americans are ongoing. We propose a complementary study to address this critical research area in Hispanics. Hispanics represent the fastest growing ethnic population in the U.S. and have been largely understudied in terms of genetic susceptibility to cancer. There are noted differences in incidence, survival and mortality in CRC by ethnic/racial groups. Hispanics often present with CRC at a younger age and have a significantly greater incidence of stage IV tumors or metastatic disease compared to NH-Whites. We propose to conduct a large, cost-efficient, population-based GWAS in Hispanics by building upon existing NIH-funded resources, the Colon Cancer Family Registry (Colon CFR) and the Multiethnic Cohort Study (MEC). We plan to recruit 2,500 Hispanic men and women diagnosed with CRC between 01/2008 to present using cancer registries in California, physican referrals and familial referrals. Risk factor/diet questionnaires, pathology reports, Oragene saliva samples (for genotyping), optional blood samples (for genotyping and biometric analysis) and tumor blocks (for MSI testing) will be collected using methodologies developed in the Colon CFR/MEC. Cases of CRC in the MEC (currently 473; anticipated 600 at end) will also be included. Population-based Hispanic individuals without a diagnosis of CRC participating in other GWA studies in the MEC (n=3,900, U01HG004726, Haiman) will be used as controls. We will genotype all 3,100 cases using the Illumina 1M array and use available genotype and epidemiologic data collected on 3,900 controls. Our statistical analyses will include: single-SNP and haplotype effects, gene-environment interactions and heterogeneity by MSI, tumor subtype and family history of CRC. We will replicate findings in a second-stage using CRC cases and controls from Mexico (1,000 cases and 1,000 controls, EU FP7 funding, CHIBCHA, Carvajal-Carmona/Tomlinson). We will also examine heterogeneity of the risk estimates by ethnicity/race by leveraging GWA data on NH-Whites (2,142 cases, 1,909 controls, U01 CA122839, Casey), (4,000 cases, 6,000 NH-White controls, UK-CHIBCHA, Tomlinson), Colombians (2,000 cases and 2,000 controls, CHIBCHA), Japanese (1,000 cases and 1,000 controls) and African-Americans (1,500 cases and 1,500 controls, R01CA126895, Le Marchand). We will genotype replicated significant SNPs in our main and combined analysis in several Hispanic populations (note: studies funded by EU or NIH for data collection but not GWAS), including 800 Puerto Ricans, 2,000 Brazilians, 2,000 Argentineans and 3,000 Spanish/Portuguese, to assess generalizability of findings. We will examine the differences in inflammatory gene transcription dynamics in leukocytes (from blood sample collection) by fatigue level (as assessed from study questionnaire data). This study will have a high impact by addressing the key question of racial/ethnic disparities related to genetic susceptibility to CRC, will provide translational guidelines on biological mechanisms during the cancer survivorship period to increase quality of life among cancer survivors, and will enable further growth and investment into research among Hispanics by providing a resource of genetic data and biospecimens, which is lacking.

  Study phs001193

• Combined PDCD1, BRAF and MAP2K7 Inhibition in BRAFV600E Colorectal Cancer: A Phase 2 Trial

  In this study, we evaluated the clinical efficacy of combined PDCD1, BRAF, and MAP2K7 inhibition in metastatic BRAFV600E Colorectal Cancer (CRC) patients (NCT03668431). We performed bulk whole exome sequencing (WXS) and bulk RNA sequencing (RNA-Seq) in 35 pre-treatment tumor biopsies and matching germline for tumor mutational burden (TMB), BM1/BM2 transcriptional subtypes, and consensus molecular subtypes (CMS) analysis, which were previously reported to affect prognosis and response to therapy (PMIDs: 32047001, 27354468, and 26457756). Analysis of bulk data showed that TMB, BM1/BM2 subtypes, and CMS did not correlate with clinical response in this study. Analysis of single cell RNA sequencing (scRNA-Seq) data of tumor epithelial cells from 23 paired day 0 and day 15 tumor biopsies revealed greater induction of tumor cell-intrinsic immune programs and more complete MAPK inhibition in patients with better clinical outcome.

  Study phs003178

• Determining genome-wide binding of ETS2 by CUT&RUN in primary human macrophages

  This dataset consists of sequencing data from an ETS2 CUT&RUN experiment in primary inflammatory (TPP) macrophages (n = 2). Pre-cultured TPP macrophages were harvested and processed immediately using the CUT&RUN Assay kit (Cell Signaling) according to the manufacturer’s instructions with the following modifications (essentially, avoiding the use of ConA-coated beads). Anti-ETS2 (ThermoFisher) or IgG control (Cell Signaling) antibodies were used for targeted digestion of chromatin. For each donor, 5x10^5 cells were pelleted, washed in Wash Buffer, and resuspended in Antibody Binding buffer. Cells were incubated with antibodies (1:100 dilution for anti-ETS2) for 2h at 4°C. After washing in Digitonin Buffer, cells were incubated with pA/G-MNase for 1h at 4°C. Cells were washed twice in Digitonin Buffer, resuspended in the same buffer and cooled for 5 minutes on ice. Calcium chloride was added to activate pA/G-MNase digestion and cells were incubated for 30 minutes at 4°C before Stop Buffer was added, and cells were incubated for 10 min at 37°C to release cleaved chromatin fragments. Supernatants were collected by centrifugation and DNA extracted using DNA Purification Buffers and Spin Columns (Cell Signaling). Library preparation was performed according to a protocols.IO protocol (dx.doi.org/10.17504/protocols.io.bagaibse) using the NEBNext Ultra II DNA Library Prep Kit. Size selection was performed using AMPure XP beads (Beckman Coulter) and fragment sizes were determined using an Agilent 2100 Bioanalyzer (High Sensitivity DNA kit). Equimolar pools of indexed libraries were sequenced on an Illumina NovaSeq 6000 (100bp PE reads). Raw data are provided as 100 bp paired-end Illumina reads.

  Dataset EGAD00001011349

• Burden of DNMs in children born conceived using ART

  The dataset is composed by processed whole genome sequencing data generated from 53 children and their respective parents, forming 49 trios (mother, father and child) and 2 quartets (mother, father and two siblings). A total of 18 children were born after spontaneous conception (n = 18); 17 children were born after in vitro fertilization (IVF) and another 18 children were born after intracytoplasmic sperm injection combined with testicular sperm extraction (ICSI-TESE)

  Dataset EGAD00001008208

• Reference Epigenomes and Regulatory Landscape of CLL

  Analysis of the reference epigenomes and regulatory landscape of CLL as a whole and its major clinico-biological subtypes (with mutated and unmutated IGHV) in the light of the normal B-cell differentiation. We have extensively characterized the reference epigenomes of seven primary chronic lymphocytic leukemia samples (CLLs) with mutated (n=5) and unmutated IGHV (n=2) as well as several mature B-cell subpopulations (naive B cells from blood and tonsil, germinal center B cells, memory B cells and plasma cells from tonsil) using genome-wide maps of six histone marks (H3K4me3, H3K4me1, H3K27ac, H3K36me3, H3K9me3 and H3K27me3), DNA accessibility (ATAC-seq), DNA methylation (whole-genome bisulfite sequencing) and gene expression (RNA-seq). Furthermore, we have mapped the regulatory chromatin landscape of 100 additional CLL cases using chIP-seq of H3K27ac and ATAC-seq and linked these data to additional layers of information (whole-genome and/or whole-exome sequencing (WGS/WES), RNA-seq and DNA methylation microarrays) studied in the context of the International Cancer Genome Consortium (ICGC).

  Dataset EGAD00001004046