22951 results for "ega"

in 25.86 milliseconds.

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• Whole genome sequencing of childhood acute lymphoblastic leukaemia patients

  Whole genome sequencing of childhood acute lymphoblastic leukaemia patients. Matched diagnostic and germline samples were obtained from bone marrow aspirates and sequenced on the Illumina platform to characterise the underlying genetic features (DOI: 10.1038/s41375-022-01806-8).

  Dataset EGAD50000000975

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  'Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Dataset EGAD50000001135

• Single-cell sequencing of PBMC & CSF in neuroinflammatory disorders

  Single-cell sequencing and genotyping for Cambridge samples analyzed as part of a project evaluating single-cell gene expression & lymphocyte receptor sequences in CSF and PBMC of MS and other neuroinflammatory disorders.

  Dataset EGAD50000001023

• scRNA-seq from lung cancer organoids and immune cells

  15 scRNA-seq samples were multiplexed, and 5' 10X Chromium scRNA-seq was performed. This dataset provides the FASTQ files for the multiplexed data, as well as the BAM files for the demultiplexed samples.

  Dataset EGAD50000000845

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• fibroblast transcriptome of pediatric patients with epilepsy

  RNA sequencing of fibroblasts from pediatric patients with childhood epilepsy. Fibroblast RNA was extracted at passage 3-6 using MN nucleospin, >90M 150bp paired-end reads per sample were obtained with illumina sequencing. Reads were aligned to hg38.

  Dataset EGAD50000001166

• Dataset for early breast cancer samples

  This dataset contains WGS data for 27 tumor, control and patient derived culture samples of patients with breast cancer. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X using TruSeq Nano DNA Kit. The sequencing was always paired

  Dataset EGAD50000000860

• Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions

  Study EGAS50000000773

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• ATAC-seq in KMS11 vs TKO cells

  ATAC-seq to determine chromatin accessibility in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of the translocated NSD2 allele.

  Study EGAS50000000076

• MicroC in KMS11 and TKO cells

  MicroC to show high resolution chromatin interactions in t(4;14) Myeloma cell line KMS11 and KMS11 cells with knock-out of translocated NSD2 allele (KMS11 TKO).

  Study EGAS50000000078

• WES dataset of salivary gland tumor samples and control blood samples

  This dataset contains paired-end WES data of salivary gland tumor samples and control blood samples from 53 patients. Sequencing was performed on Illumina HiSeq 2500, HiSeq 4000 or NovaSeq 6000.

  Dataset EGAD50000001190

• Cohort B germline exome sequencing

  Cohort B includes IDH-wild type, EGFR amplified, surgically derived glioblastoma tissue samples from male and female individuals. Germline DNA was isolated from whole blood.

  Study EGAS50000000951

• RNA-Seq dataset for malignant pleural and peritoneal mesothelioma

  This dataset contains RNA sequencing data of pleural and peritoneal mesothelioma. The number of samples is 18. Sequencing was performed on Illumina NovaSeq 6000 and Illumina NovaSeqXPlus. The sequencing was always paired.

  Dataset EGAD50000001342

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Mitochondrial DNA sequencing of single muscle fibers in Parkinson's disease patients

  Mitochondrial DNA sequencing of n=157 single muscle fibers in Parkinson's disease patients and controls, n=27 bulk tissue samples and n=2 synthetic controls

  Dataset EGAD50000000946

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• WGS data of Japanese including COVID-19 patients and healthy subjects

  This dataset contains WGS data of 234 Japanese, including 88 COVID-19 patients and 146 healthy subjects. Libraries were sequenced on the HiSeqX or NovaSeq 6000 system. Sequenced reads were aligned against the Genome Reference Consortium human genome build 38 using BWA-MEM.

  Dataset EGAD00010002742