16758 results for "sec+and+unspecified+malignant+neoplasm"

in 34.15 milliseconds.

• Geographic and age-related variations in mutational processes in colorectal cancer - patient metadata files (Mutographs)

  Geographic and age-related variations in mutational processes in colorectal cancer - patient metadata files (Mutographs)

  Dataset EGAD00001015437

• Geographic and age-related variations in mutational processes in colorectal cancer - sequence data (Mutographs)

  Geographic and age-related variations in mutational processes in colorectal cancer - sequence data (Mutographs)

  Dataset EGAD00001015485

• Geographic and age-related variations in mutational processes in colorectal cancer - filtered vcf files (Mutographs)

  Geographic and age-related variations in mutational processes in colorectal cancer - filtered vcf files (Mutographs)

  Dataset EGAD00001015486

• Geographic and age-related variations in mutational processes in colorectal cancer - copy number variants (Mutographs)

  Geographic and age-related variations in mutational processes in colorectal cancer - copy number variants (Mutographs)

  Dataset EGAD00001015487

• There are 116 liver cancer cases in this study and belong to LICA-CN project.The NGS test was performed with whole exome sequencing with HiSeq 2000 platform.

  There are 116 liver cancer cases in this study and belong to LICA-CN project

  Dataset EGAD00001003174

• Cancer Genomics of the Kidney

  The aim of CAGEKID is to carry out comprehensive detection of DNA markers for conventional (clear cell) renal carcinoma. The project includes complete analysis of somatic and constitutional DNA variation, methylation patterns and expression in a large number of constitutional/tumor pairs. CAGEKID is a part of the International Cancer Genome Consortium, ICGC.

  Dataset EGAD00001004018

• WGS and RNA-Seq data from a GBM patient PT-AB6372

  WGS and RNA-Seq data from a GBM patient PT-AB6372

  Dataset EGAD00001004222

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-CA2271

  WGS and RNA-Seq data from a GBM patient PT-CA2271

  Dataset EGAD00001004230

• WGS and RNA-Seq data from a GBM patient PT-CM1209

  WGS and RNA-Seq data from a GBM patient PT-CM1209

  Dataset EGAD00001004231

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• WGS and RNA-Seq data from a GBM patient PT-DS9789

  WGS and RNA-Seq data from a GBM patient PT-DS9789

  Dataset EGAD00001004233

• WGS and RNA-Seq data from a GBM patient PT-EV3071

  WGS and RNA-Seq data from a GBM patient PT-EV3071

  Dataset EGAD00001004234

• SPECTA: NGS Screening Program for Efficient Clinical Trial Access

  SPECTA comprises a network of participating European clinical sites and NGS screening platforms that can screen individual patients for multiple molecular targets and potentially allow the design of trials that will match the specific biology of the diseases affecting specific patients with cancer.

  Dataset EGAD00001000894

• NIHR BioResource Rare Diseases WGS project - Bleeding, Thrombotic and Platelet Disorders (BPD) Rare Disease domain

  Short read whole genome sequencing (WGS) CRAM files for the NIHR BioResource Rare Diseases WGS project – Participants from the Bleeding, Thrombotic and Platelet Disorders (BPD) Rare Disease domain

  Dataset EGAD00001004519

• NIHR BioResource Rare Diseases WGS project - Neurological and Developmental Disorders (NDD) Rare Disease domain

  Short read whole genome sequencing (WGS) CRAM files for the NIHR BioResource Rare Diseases WGS project – Participants from the Neurological and Developmental Disorders (NDD) Rare Disease domain

  Dataset EGAD00001004522

• Genetic mechanisms of resistance to chemotherapy in breast cancer

  Resistance towards chemotherapy is one of the main causes of treatment failure and deathamong breast cancer patients.The main objective of this project is toidentify genetic mechanisms causing some breast cancer patients not torespond to a particluar type of chemotherapy (epirubicin) while otherpatients respond very well to the same treatment. In the project wewill perform genome / exome sequencing of a selection of breast cancerpatients (n=30). These patients are drawn from a cohort where allpatients have recieved treatment with epirubicin monotherapy before surgical removal of alocally advanced breast tumour, and where all patients have beensubjected to objective evaluation of the response to thetherapy. Subsequent to sequencing, we will analyse the data andcompare with the clinical data for each patient (object response totherapy). The main aim being to identify mutations that are associatedwith resistance to epirubicin. Identification of mutations with strongpredictive value, may have a direct impact on cancer treatment sinceit opens the possibility for genetic testing of a tumour, and desicionon which drug is likely to work best, prior to treatment start.

  Dataset EGAD00001000264

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. It seems plausible that rates of implantation would improve if we had a better understanding of molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to identify candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Dataset EGAD00001005044

• hereditary BrEAst Case CONtrol study (BEACCON)

  The BEACCON study aimed to address the lack of power of previous studies to identify novel BC predisposition genes by performing extensive sequencing in 12,000 women (11,511 analysed following exclusions) and further enhancing power by using an ‘extreme phenotype’ design with enrichment of familial non-BRCA1 and BRCA2 cases, compared with a control population of older women with ongoing confirmation of cancer-free status at June 2019. Three-quarters of the 1303 candidate genes screened were selected based on empiric evidence from local (69 multi-case BC families) or international whole exome sequencing studies, and the remainder were included to provide detailed coverage of functional pathways with established associations with BC.

  Dataset EGAD00001007025

• ChIIP-seq and RNA-seq

  epigenome profiling in tumor tissues and paired normal tissues of LUAD patients and transcriptome profiling in tumor tissues of LUAD patients.

  Dataset EGAD00001007066

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• Effects of busulfan, fludarabine and clofarabine treatment on human small intestinal organoids generated from healthy donors

  The intestine is vulnerable to chemotherapy-induced toxicity due to its high epithelial proliferative rate, making gut toxicity an off-target effect in several cancer treatments, including conditioning regimens for allogeneic hematopoietic cell transplantation (HSCT). In HSCT, intestinal damage is an important factor in the development of Graft-versus-Host Disease (GVHD), an immune complication in which donor immune cells attack the recipient's tissues. Here, we developed a novel human intestinal organoid-based 3D model system to study the effects of chemotherapy-induced intestinal epithelial damage at the RNA level. We show that chemotherapy conditioning specifically reprograms the intestinal epithelial transcriptome after treatment with either busulfan (3.5μM), fludarabine (15μM) or clofarabine (0.5μM) for 24h. This knowledge can potentially enable us to understand which changes undergo in healthy tissues upon conditioning and how those are related with immune activation typical in GVHD.

  Study EGAS00001007550

• Tracking the evolution of esophageal squamous cell carcinoma under dynamic immune selection by multi-omics sequencing

  Intratumoral heterogeneity (ITH) has been linked to decreased efficacy of clinical treatments. However, although genomic ITH has been characterized in genetic, transcriptomic and epigenetic alterations are hallmarks of esophageal squamous cell carcinoma (ESCC), the extent to which these are heterogeneous in ESCC has not been explored in a unified framework. Further, the extent to which tumor-infiltrated T lymphocytes (TILs) are directed against cancer cells, but how the immune infiltration acts as a selective force to shape the clonal evolution of ESCC is unclear. In this study, we perform multi-omic sequencing on 186 samples from 36 primary ESCC patients. Through multi-omics analyses, it is discovered that genomic, epigenomic, and transcriptomic ITH are underpinned by ongoing chromosomal instability. Based on the RNA-seq data, we observe diverse levels of immune infiltrate across different tumor sites from the same tumor. We reveal genetic mechanisms of neoantigen evasion under distinct selection pressure from the diverse immune microenvironment. Overall, our work offers an avenue of dissecting the complex contribution of the multi-omics level to the ITH in ESCC and thereby enhances the development of clinical therapy.

  Dataset EGAD00001009482

• Analysis of mutational and proteomic heterogeneity of gastric cancer to monitor post-treatment tumor burden using circulating tumor DNA

  It remains unclear whether complete spectrum of tumor heterogeneity is reflected in circulating tumor DNA (ctDNA). Here, we performed multi-regional target sequencing of primary tumors from 10 patients who underwent surgical resection for gastric cancer. A total of 126 non-synonymous mutations were identified from 30 samples from 10 tumors. Of these, 16 (12.7%) were likely mutations that occurred early in tumor development (i.e., present in all three regions) and were designated founder mutations. Among those validated with highly sensitive digital PCR (dPCR), 93% of non-founder mutations were found in all three regions. Variant allele frequencies (VAFs) of founder mutations were significantly higher than those of non-founder mutations. Phylogenetic analysis demonstrated that five of eight tumors (62.5%, excluding two hypermutator) had at least one identifiable truncal/founder mutation. These findings led us to prioritize founder mutations for ctDNA detection with individually-designed primer/probe sets for dPCR. Marked proteomic diversity was present across the tumor regions both within and between patients independent of mutational status. In preoperative plasma, the average ctDNA VAF of founder mutations was significantly higher than that of non-founder mutations (p = 0.039). Our present data demonstrated that high VAF mutations in the tumor likely represent founder or truncal mutations. However, mutation patterns alone appear insufficient to predict protein heterogeneity. These results suggest that, in practice, mutations having high VAF identified without multi-regional sequencing may be useful for ctDNA monitoring but are inadequate to fully predict proteomic heterogeneity of the tumor.

  Study JGAS000231

• Data Use Ontology (DUO)

  Data Use Ontology Data Use Ontology at EGA The EGA is committed to its involvement in the work of GA4GH. In an effort to enhance data discoverability and streamline data access, EGA have implemented the use of the Data Use Ontology (DUO), based on consent codes as described in Dyke et al. 2017. The Data Use Ontology codes will be displayed on the live dataset page of your submission to advise any would be requestor on how the data can be used and also to enhance data discoverability as users will be able to search on these codes to find applicable datasets. DUO can be browsed online via the Ontology Lookup Service Learn more reading the Data Use Ontology publication and the GA4GH Machine-Readable Consent Guidance! Check our DAC Portal Take The Tour and learn how to add DUO codes to your policy! Term Shorthand Label Description DUO:0000004 NRES no restriction This data use permission indicates there is no restriction on use. DUO:0000042 GRU general research use This data use permission indicates that use is allowed for general research use for any research purpose. DUO:0000006 HMB health or medical or biomedical research This data use permission indicates that use is allowed for health/medical/biomedical purposes; does not include the study of population origins or ancestry. DUO:0000007 DS disease specific research This data use permission indicates that use is allowed provided it is related to the specified disease. DUO:0000011 POA population origins or ancestry research only This data use permission indicates that use of the data is limited to the study of population origins or ancestry. DUO:0000012 RS research specific restrictions This data use modifier indicates that use is limited to studies of a certain research type. DUO:0000015 NMDS no general methods research This data use modifier indicates that use does not allow methods development research (e.g., development of software or algorithms). DUO:0000016 GSO genetic studies only This data use modifier indicates that use is limited to genetic studies only (i.e., studies that include genotype research alone or both genotype and phenotype research, but not phenotype research exclusively) DUO:0000018 NPUNCU not for profit, non commercial use only This data use modifier indicates that use of the data is limited to not-for-profit organizations and not-for-profit use, non-commercial use. DUO:0000019 PUB publication required This data use modifier indicates that requestor agrees to make results of studies using the data available to the larger scientific community. DUO:0000020 COL collaboration required This data use modifier indicates that the requestor must agree to collaboration with the primary study investigator(s). DUO:0000021 IRB ethics approval required This data use modifier indicates that the requestor must provide documentation of local IRB/ERB approval. DUO:0000022 GS geographical restriction This data use modifier indicates that use is limited to within a specific geographic region. DUO:0000024 MOR publication moratorium This data use modifier indicates that requestor agrees not to publish results of studies until a specific date. DUO:0000025 TS time limit on use This data use modifier indicates that use is approved for a specific number of months. DUO:0000026 US user specific restriction This data use modifier indicates that use is limited to use by approved users. DUO:0000027 PS project specific restriction This data use modifier indicates that use is limited to use within an approved project. DUO:0000028 IS institution specific restriction This data use modifier indicates that use is limited to use within an approved institution. DUO:0000029 RTN return to database or resource This data use modifier indicates that the requestor must return derived/enriched data to the database/resource. DUO:0000043 CC clinical care use This data use modifier indicates that use is allowed for clinical use and care. DUO:0000044 NPOA population origins or ancestry research prohibited This data use modifier indicates use for purposes of population, origin, or ancestry research is prohibited. DUO:0000045 NPU not for profit organisation use only This data use modifier indicates that use of the data is limited to not-for-profit organisations. DUO:0000046 NCU non-commercial use only This data use modifier indicates that use of the data is limited to not-for-profit use. Point to Notice: For the consent code DUO:0000007 where data is restricted to use on a specific disease, please accompany it with an appropriate ontology from MONDO e.g., If the data is restricted to the use of research into juvenile idiopathic arthritis the code should be displayed as DUO:0000007; MONDO:0011429.

  Documentation access/data-access-committee/data-use-ontology

• AmsterdamUMC Data Access Committee for the study "Multi-omic analysis of thyroid dysfunction in Down Syndrome"

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired as part of the "Multi-omic analysis of thyroid dysfunction in Down Syndrome" study as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000186

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• RNA Dataset

  The RNA dataset includes 5 samples analyzed with the Oncomine Comprehensive Assay (OCA) panel. After library preparation, sequencing was performed on the Ion Torrent S5 System, generating FASTQ files. The analysis captures gene fusions and splice variants relevant to oncogenic processes. (idem)

  Dataset EGAD50000002502

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• mFAST-SeqS

  mFAST‑SeqS, or modified Fast Aneuploidy Screening Test‑Sequencing System, is a streamlined and cost-effective approach to estimate the fraction of ctDNA in blood samples by detecting genome-wide aneuploidy in cfDNA

  Dataset EGAD50000001670

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• This dataset contains the cram files from the whole Exome sequencing

  Exome Sequencing of Healthy and M. Heamophilum Infected Participants

  Dataset EGAD50000001565

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818