16624 results for "sec+and+unspecified+malignant+neoplasm"

in 42.46 milliseconds.

• BLUEPRINT DNA methylation profiles of human hematopoietic progenitors

  DNA methylation was analyzed for stem/progenitor cell types and terminally differentiated cell types of the human blood lineage (HSC, MPP, CMP, MEP, GMP, CLP, MLP0, MLP1, MLP2, MLP3, MK, CD4+ Tcell, CD8+ Tcell, Bcell, NK, Neut, Mono).

  Dataset EGAD00001002732

• Exome sequencing of 7-member healthy family (father, mother, their three biological daughters and monozygotic twin sons)

  The dataset contains exome sequencing data of seven healthy family members, all in FASTQ format. The samples were taken from peripheral blood mononuclear cells. Furthermore, corresponding proteomics data are available as well.

  Dataset EGAD00001004949

• EGAS00001003405 combined RNA, WES, WGS data of 16 gastrointestinal tumor patients

  50 samples of 16 individuals with Gastrointestinal Tumor. Patients were sequenced in various combinations of WGS, Exome and RNA sequencing.

  Dataset EGAD00001005113

• Targeted deep sequencing

  T200 caner panel sequencing on primary and metastatic sites from highly clinically annotated HGSC samples. Samples were obtained pre-treatment based on a laparoscopic triage algorithm from patients who underwent R0 tumor debulking, or received neoadjuvant chemotherapy (NACT) with excellent (ER) or poor response (PR).

  Dataset EGAD00001005239

• GRAIL Metadata

  Metadata summarizes participants (n=198), samples (n=396), basic clinical information, and analysis. analysis1: raw sequencing reference alignment files (bam/bai) analysis2: error-corrected sequencing reference alignment files (bam/bai) analysis3: variant calling using error-corrected sequencing reference alignment (vcf)

  Dataset EGAD00001005302

• Prognostic markers of DNA methylation and NGS sequencing in progressive glioblastoma from the EORTC-26101 trial

  These dataset contains NGS data from 380 samples from the EORTC-26101 clinical trial for patients with progressive glioblastoma.

  Study EGAS00001007421

• WES FASTqs

  Whole exome sequencing FASTq files from 469 pre-treatment tumors from IMvigor210, POPLAR and IMmotion150, with matched PBMC samples.

  Dataset EGAD00001006632

• Hyperpolarized carbon-13 MRI for very early response assessment of neoadjuvant chemotherapy in breast cancer patients

  Transcriptomic data for five patients with breast cancer undergoing neoadjuvant chemotherapy and hyperpolarised 13C-MRI for early response assessment

  Dataset EGAD00001008141

• TCRab sequencing of T-LGLL patients

  TCRab sequencing was performed on viably frozen cells from 11 T-LGLL samples from 9 T-LGLL patients and 6 age-matched healthy samples. The raw data is available as fastq files.

  Dataset EGAD00001008691

• RNA Dataset

  The RNA dataset includes 5 samples analyzed with the Oncomine Comprehensive Assay (OCA) panel. After library preparation, sequencing was performed on the Ion Torrent S5 System, generating FASTQ files. The analysis captures gene fusions and splice variants relevant to oncogenic processes. (idem)

  Dataset EGAD50000002502

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• mFAST-SeqS

  mFAST‑SeqS, or modified Fast Aneuploidy Screening Test‑Sequencing System, is a streamlined and cost-effective approach to estimate the fraction of ctDNA in blood samples by detecting genome-wide aneuploidy in cfDNA

  Dataset EGAD50000001670

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• This dataset contains the cram files from the whole Exome sequencing

  Exome Sequencing of Healthy and M. Heamophilum Infected Participants

  Dataset EGAD50000001565

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• TRACERx NSCLC - whole genome sequencing for ctDNA study

  Data used in "An ultra-sensitive and specific ctDNA assay provides novel pre-operative disease stratification in early stage lung adenocarcinoma"

  Dataset EGAD50000000452

• WES data for genomic determinants of response and resistance to inotuzumab in B-ALL

  Whole exome sequencing data for 69 samples with B-cell acute lymphoblastic leukemia

  Dataset EGAD50000000097

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• CAfGEN2 Phenotype dataset

  CAfGEN2 phenotype data from 97 samples Uganda, Botswana and Eswatini.

  Dataset EGAD00001015820

• hereditary BrEAst Case CONtrol study (BEACCON)

  The BEACCON study aimed to address the lack of power of previous studies to identify novel BC predisposition genes by performing extensive sequencing in 12,000 women (11,511 analysed following exclusions) and further enhancing power by using an ‘extreme phenotype’ design with enrichment of familial non-BRCA1 and BRCA2 cases, compared with a control population of older women with ongoing confirmation of cancer-free status at June 2019. Three-quarters of the 1303 candidate genes screened were selected based on empiric evidence from local (69 multi-case BC families) or international whole exome sequencing studies, and the remainder were included to provide detailed coverage of functional pathways with established associations with BC.

  Dataset EGAD00001007025

• Tracking the evolution of esophageal squamous cell carcinoma under dynamic immune selection by multi-omics sequencing

  Intratumoral heterogeneity (ITH) has been linked to decreased efficacy of clinical treatments. However, although genomic ITH has been characterized in genetic, transcriptomic and epigenetic alterations are hallmarks of esophageal squamous cell carcinoma (ESCC), the extent to which these are heterogeneous in ESCC has not been explored in a unified framework. Further, the extent to which tumor-infiltrated T lymphocytes (TILs) are directed against cancer cells, but how the immune infiltration acts as a selective force to shape the clonal evolution of ESCC is unclear. In this study, we perform multi-omic sequencing on 186 samples from 36 primary ESCC patients. Through multi-omics analyses, it is discovered that genomic, epigenomic, and transcriptomic ITH are underpinned by ongoing chromosomal instability. Based on the RNA-seq data, we observe diverse levels of immune infiltrate across different tumor sites from the same tumor. We reveal genetic mechanisms of neoantigen evasion under distinct selection pressure from the diverse immune microenvironment. Overall, our work offers an avenue of dissecting the complex contribution of the multi-omics level to the ITH in ESCC and thereby enhances the development of clinical therapy.

  Dataset EGAD00001009482

• Molecular risk stratification in patients with T1 colorectal cancer_WES

  The introduction of bowel cancer screening has led to a significant increase in the proportion of patients being diagnosed with asymptomatic, early-stage colorectal cancer (CRC). Although the majority of these patients are successfully treated with surgery alone, a small proportion of patients have 'born-to-be-bad' aggressive lesions with early dissemination leading to distant metastases. Current standard of care histological assessment is unable to distinguish between these aggressive versus non-aggressive early lesions which is essential to provide appropriate clinical management decisions. This study aims to carry out molecular and histological profiling of approximately 300 T1 CRCs in order to develop a molecular stratifier based on the risk of relapse in early-invasive CRC. This novel T1 cohort will represent the world's largest molecularly characterised T1 cohort of samples, with digital pathology assessment alongside whole exome sequencing, copy number variation analysis and 3' RNA-seq. This data will be used to generate a robust panel of molecular and/or histological markers applicable to formalin-fixed paraffin embedded (FFPE) archival tissue which discriminates between T1 lesions based on risk of relapse, which will ultimately be used to inform clinical management of CRC at the earliest stages of the disease.

  Dataset EGAD00001010890

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. It seems plausible that rates of implantation would improve if we had a better understanding of molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to identify candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Dataset EGAD00001005044

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• Effects of busulfan, fludarabine and clofarabine treatment on human small intestinal organoids generated from healthy donors

  The intestine is vulnerable to chemotherapy-induced toxicity due to its high epithelial proliferative rate, making gut toxicity an off-target effect in several cancer treatments, including conditioning regimens for allogeneic hematopoietic cell transplantation (HSCT). In HSCT, intestinal damage is an important factor in the development of Graft-versus-Host Disease (GVHD), an immune complication in which donor immune cells attack the recipient's tissues. Here, we developed a novel human intestinal organoid-based 3D model system to study the effects of chemotherapy-induced intestinal epithelial damage at the RNA level. We show that chemotherapy conditioning specifically reprograms the intestinal epithelial transcriptome after treatment with either busulfan (3.5μM), fludarabine (15μM) or clofarabine (0.5μM) for 24h. This knowledge can potentially enable us to understand which changes undergo in healthy tissues upon conditioning and how those are related with immune activation typical in GVHD.

  Study EGAS00001007550

• ChIIP-seq and RNA-seq

  epigenome profiling in tumor tissues and paired normal tissues of LUAD patients and transcriptome profiling in tumor tissues of LUAD patients.

  Dataset EGAD00001007066

• Analysis of mutational and proteomic heterogeneity of gastric cancer to monitor post-treatment tumor burden using circulating tumor DNA

  It remains unclear whether complete spectrum of tumor heterogeneity is reflected in circulating tumor DNA (ctDNA). Here, we performed multi-regional target sequencing of primary tumors from 10 patients who underwent surgical resection for gastric cancer. A total of 126 non-synonymous mutations were identified from 30 samples from 10 tumors. Of these, 16 (12.7%) were likely mutations that occurred early in tumor development (i.e., present in all three regions) and were designated founder mutations. Among those validated with highly sensitive digital PCR (dPCR), 93% of non-founder mutations were found in all three regions. Variant allele frequencies (VAFs) of founder mutations were significantly higher than those of non-founder mutations. Phylogenetic analysis demonstrated that five of eight tumors (62.5%, excluding two hypermutator) had at least one identifiable truncal/founder mutation. These findings led us to prioritize founder mutations for ctDNA detection with individually-designed primer/probe sets for dPCR. Marked proteomic diversity was present across the tumor regions both within and between patients independent of mutational status. In preoperative plasma, the average ctDNA VAF of founder mutations was significantly higher than that of non-founder mutations (p = 0.039). Our present data demonstrated that high VAF mutations in the tumor likely represent founder or truncal mutations. However, mutation patterns alone appear insufficient to predict protein heterogeneity. These results suggest that, in practice, mutations having high VAF identified without multi-regional sequencing may be useful for ctDNA monitoring but are inadequate to fully predict proteomic heterogeneity of the tumor.

  Study JGAS000231

• Data Use Ontology (DUO)

  Data Use Ontology Data Use Ontology at EGA The EGA is committed to its involvement in the work of GA4GH. In an effort to enhance data discoverability and streamline data access, EGA have implemented the use of the Data Use Ontology (DUO), based on consent codes as described in Dyke et al. 2017. The Data Use Ontology codes will be displayed on the live dataset page of your submission to advise any would be requestor on how the data can be used and also to enhance data discoverability as users will be able to search on these codes to find applicable datasets. DUO can be browsed online via the Ontology Lookup Service Learn more reading the Data Use Ontology publication and the GA4GH Machine-Readable Consent Guidance! Check our DAC Portal Take The Tour and learn how to add DUO codes to your policy! Term Shorthand Label Description DUO:0000004 NRES no restriction This data use permission indicates there is no restriction on use. DUO:0000042 GRU general research use This data use permission indicates that use is allowed for general research use for any research purpose. DUO:0000006 HMB health or medical or biomedical research This data use permission indicates that use is allowed for health/medical/biomedical purposes; does not include the study of population origins or ancestry. DUO:0000007 DS disease specific research This data use permission indicates that use is allowed provided it is related to the specified disease. DUO:0000011 POA population origins or ancestry research only This data use permission indicates that use of the data is limited to the study of population origins or ancestry. DUO:0000012 RS research specific restrictions This data use modifier indicates that use is limited to studies of a certain research type. DUO:0000015 NMDS no general methods research This data use modifier indicates that use does not allow methods development research (e.g., development of software or algorithms). DUO:0000016 GSO genetic studies only This data use modifier indicates that use is limited to genetic studies only (i.e., studies that include genotype research alone or both genotype and phenotype research, but not phenotype research exclusively) DUO:0000018 NPUNCU not for profit, non commercial use only This data use modifier indicates that use of the data is limited to not-for-profit organizations and not-for-profit use, non-commercial use. DUO:0000019 PUB publication required This data use modifier indicates that requestor agrees to make results of studies using the data available to the larger scientific community. DUO:0000020 COL collaboration required This data use modifier indicates that the requestor must agree to collaboration with the primary study investigator(s). DUO:0000021 IRB ethics approval required This data use modifier indicates that the requestor must provide documentation of local IRB/ERB approval. DUO:0000022 GS geographical restriction This data use modifier indicates that use is limited to within a specific geographic region. DUO:0000024 MOR publication moratorium This data use modifier indicates that requestor agrees not to publish results of studies until a specific date. DUO:0000025 TS time limit on use This data use modifier indicates that use is approved for a specific number of months. DUO:0000026 US user specific restriction This data use modifier indicates that use is limited to use by approved users. DUO:0000027 PS project specific restriction This data use modifier indicates that use is limited to use within an approved project. DUO:0000028 IS institution specific restriction This data use modifier indicates that use is limited to use within an approved institution. DUO:0000029 RTN return to database or resource This data use modifier indicates that the requestor must return derived/enriched data to the database/resource. DUO:0000043 CC clinical care use This data use modifier indicates that use is allowed for clinical use and care. DUO:0000044 NPOA population origins or ancestry research prohibited This data use modifier indicates use for purposes of population, origin, or ancestry research is prohibited. DUO:0000045 NPU not for profit organisation use only This data use modifier indicates that use of the data is limited to not-for-profit organisations. DUO:0000046 NCU non-commercial use only This data use modifier indicates that use of the data is limited to not-for-profit use. Point to Notice: For the consent code DUO:0000007 where data is restricted to use on a specific disease, please accompany it with an appropriate ontology from MONDO e.g., If the data is restricted to the use of research into juvenile idiopathic arthritis the code should be displayed as DUO:0000007; MONDO:0011429.

  Documentation access/data-access-committee/data-use-ontology

• Netherlands Cancer Institute (NKI-AVL) general DAC

  Data is available under reasonable request. All data requests will be reviewed by the NKI IRB and must be supported by the Principal Investigator of the study. The researcher will need to sign a data access agreement with the NKI after approval. Go to https://ega.nki.nl to fill out the form to request access.

  Dac EGAC50000000055

• The Transcriptomic Landscape of Oncogenic PI3K Reveals Key Functions in Splicing and Gene Expression Regulation

  This study includes RNA-seq of paired tumor biopsies from PIK3CA-mutated breast cancer patients that underwent treatment with PI3Kα inhibitors.

  Study phs002840

• Non-invasive bladder cancer cfDNA dataset

  The dataset contains 30 primary bladder cancer patients, 28 recurrent bladder cancer patients and 31 hematuria controls. Shallow WGS of cell-free DNA enzymatic methyl sequencing libraries was performed on an Illumina Novaseq S4 PE150bp. Samples are provided as raw reads without any prior processing.

  Dataset EGAD50000001935

• Whole genome sequencing of single cells identifies stochastic aneuploidies, genome replication, states, and clonal repertoires for library A90560A

  Transposase-based amplification-free single-cell genome direct library preparation in nanowell chips; 585 samples; filetype=bam

  Dataset EGAD00001004733

• Whole genome sequencing of single cells identifies stochastic aneuploidies, genome replication, states, and clonal repertoires for library A95660A

  Transposase-based amplification-free single-cell genome direct library preparation in nanowell chips; 1522 samples; filetype=bam

  Dataset EGAD00001004750