12405 results for ""non-traditional+communal+storytelling+approach"+novel+segment+noted+in+critical+commentary"

in 26.08 milliseconds.

• RNA-seq profiling of NKX6.1 reporter iPSC lines for isolation and analysis of functionally relevant neuronal and pancreas populations

  We generated human induced pluripotent stem cell (iPSC) lines with a GFP reporter inserted in the endogenous NKX6.1 locus. Characterisation of the reporter lines demonstrated faithful GFP labelling of NKX6.1 expression during pancreas and motor neuron differentiation. We performed three independent in vitro differentiations towards the pancreatic endocrine lineage. We FACS-purified GFP positive and negative cells from stage 7 cultures, and generated Smart-Seq2 RNA-sequencing libraries for the pre-sorted cells, as well as the two GFP-sorted cell populations. Gene expression profiling by RNA-sequencing reveals that the NKX6.1-positive population closely resembles mature human beta cells and the functional evaluation of purified populations shows that the glucose-responsive beta-like cells are enriched within the NKX6.1-positive population. These reporter lines provide a valuable resource to the scientific community for the derivation of functional relevant pancreas and neuronal cell subtypes.

  Dataset EGAD00001003911

• Genetics of gene expression in human macrophage response to Salmonella

  Understanding how cells sense and respond to their environment, and how these responses are modulated by genetic variation, are fundamental biological problems, particularly for understanding how pathogenic organisms invade and manipulate the cells of the human immune system. Macrophages recognize and respond to many important human pathogens including HIV-1, Mycobacteria tuberculosis and Salmonella. This study will focus on the cellular response of human macrophages to Salmonella infection and how this response is modulated by the genetic bacground of the individual as well as additional pro-inflammatory stimulus (interferon-gamma priming). We will acquire 100 human induced pluripotent stem cell lines from the HipSci project, differentiate the cells in vitro into macrophages and expose them to four environmental conditions: (i) no stimulation, (ii) interferon-gamma (18h), (iii) Salmonella typhimurium SL1344 (5h), (iv) interferon-gamma (18h) + Salmonella (5h).Subsequently, we will isolate RNA from the samples for sequencing.

  Dataset EGAD00001003204

• Subclonal diversification of primary breast cancer

  Cancers are ecosystems of genetically related clones, competing across space and time for limited resources. To understand the clonal structure of primary breast cancer, we applied genome and targeted sequencing to 295 samples from 49 patients’ tumors. The extent of subclonal diversification varied considerably among patients and encompassed many spatial patterns, including local growth, intraductal dissemination and clonal intermixture. Landmarks of disease progression, such as acquiring invasive or metastatic potential, arose within detectable subclones of antecedent lesions, suggesting that subclonal mutations could be relevant if actionable. No defined temporal order of mutation was evident, with the commonest genes, including PIK3CA, TP53, BRCA2, PTEN and MYC, mutated early in some, late in others, often exhibiting parallel evolution across subclones. Signatures of homologous recombination deficiency correlated with response to neoadjuvant chemotherapy. Thus, the interplay of mutation, growth and competition drives clonal structures of breast cancer that are complex, variable across patients and clinically relevant.

  Dataset EGAD00001000965

• Next Generation Sequencing in an IBD Pedigree Whole Genome Data

  In 2009 we identified a four-generation family with over 700 members and 41 affected with Crohn's disease (CD). At the time we sequenced the exome of 6 affected individuals but did not identify any coding variants which appear to explain the high prevalence of disease. Since then we have collected DNA from a large number of additional family members, genotyped linkage arrays on the entire family to refine genomic regions shared by identity by descent and genotyped affected and unaffected members at known CD risk loci identified by Genome Wide Association Studies (GWAS). These analyses have confirmed that a significant unexplained excess of disease remains after accounting for all known genetic factors, and that several regions of the genome are shared by a large fraction of affected individuals. We therefore perform whole genomes sequencing from 8 individuals which will allow us to impute the complete sequence of nearly all the members of the two largest and most severely affected branches of the family.

  Dataset EGAD00001000399

• Functional genomics approaches to understand osteoarthritis (2019-08-01)

  The aim of this work is to apply an integrated systems approach to understand the biological underpinnings of large joint (hip and knee) osteoarthritis which culminates in the need for total joint replacement (TJR). We will obtain diseased and non-diseased cartilage as well as other disease-relevant tissue following TJR, coupled with a blood sample. We will generate genotype data and will characterise the pairs of diseased and non-diseased tissue samples in terms of methylation, transcription (RNASeq) and expression (quantitative proteomics). We will apply integrative approaches to combine information across the omics levels to characterise genes, pathways, and networks that underlie osteoarthritis progression. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ . This dataset contains all the data available for this study on 2019-08-01.

  Dataset EGAD00001005215

• INSPIRE multi-timepoint cfMeDIP dataset

  This dataset contains raw sequencing data from multi-timepoint cell-free methylated DNA immunoprecipitation and sequencing (cfMeDIP-seq) of plasma samples from the INSPIRE study (NCT02644369). Details about the study, including inclusion/exclusion criteria and interventions are available at https://clinicaltrials.gov/study/NCT02644369. Briefly, five cohorts were included, INS-A (head & neck squamous cell carcinoma), INS-B (triple-negative breast cancer), INS-C (high-grade serous ovarian cancer), INS-D (melanoma), and INS-E (mixed solid tumors). All patients in the study were diagnosed with advanced cancer and received treatment with pembrolizumab. Plasma samples were collected at baseline and every 3 cycles until disease progression, death, loss of follow-up, or completion of the study. Plasma samples were first processed for cell-free DNA mutations and remaining samples were then processed by cfMeDIP-seq, prioritizing baseline and post-cycle 3 samples. In total, data from 204 timepoints from 87 distinct patients are deposited.

  Dataset EGAD00001011312

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Tetralogy of Fallot Exome Trios

  Exome sequencing of 30 parent-offspring trios to >50X mean depth, where the offspring has sporadic TOF, to identify potential causal de novo mutations. We will use the exome plus design for pulldown that incorporates ~6.8Mb of additional regulatory sequences in addition to the ~50Mb GENCODE exome.

  Dataset EGAD00001000344

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• Genotype data for 4607 Greenlandic samples (MEGA array)

  This file fileset has 4607 Greenlanders scored on the Illumina MEGA array (1,622,813 sites), and has been put on the plus strand. The data is in PLINK bed/bim/fam format. The Greenlandic individuals originate from two population surveys, B99 and IHIT.

  Dataset EGAD00010002057

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• Transcriptome-wide gene expression analysis of cocaine use disorder in postmortem human brain tissue

  Dataset contains raw fastq-files from RNA-sequencing analysis of total RNA extracted from Brodmann Area 9 human postmortem brain tissue samples.

  Dataset EGAD50000000212

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• Tumor Profiler Project - OV cell-free DNA data

  The dataset contains amplicon sequencing data from 48 samples from 35 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format.

  Dataset EGAD50000001410

• Long-read whole genome sequencing as a tool for variant detection in inherited retinal dystrophies

  WGS sequencing using nanopore long reads sequencing. These data is used for the diagnosis of patients with inherited retinal dystrophies.

  Study EGAS50000000846

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• Cancer Discovery Hub (CDH), National Cancer Center Singapore

  This is a DAC for data deposited into EGA generated by Cancer Discover Hub, NCCS. The use of datasets in this portal is solely for research and academic use only, uses other than the have to be approved by the relevant DAC members.

  Dac EGAC50000000039

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494

• cfDNA sWGS BAM — Metastatic colorectal cancer

  Plasma cirDNA sWGS for metastatic colorectal adenocarcinoma at diagnosis prior to systemic therapy. Libraries DSP/SSP (per sample). Sequencing by IntegraGen (2022–2024). Alignment: GRCh38 with BWA-MEM; BAMs sorted/indexed; delivered as primary mapped reads only (filters/MAPQ in analysis metadata). Controlled access

  Dataset EGAD50000001879

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• Ultra-long whole-genome and Cas9-targeted nanopore sequencing of fibroblasts: FSHD, BAMS, healthy controls

  Data from the D4Z4End2End study (Xiao et al. 2025), for genetic and epigenetic analysis of the D4Z4 macrosatellite in health and disease.

  Dataset EGAD50000001551

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• DAC for study CMMRD–associated high-grade glioma

  This Data Access Committee (DAC) is responsible for de-identified, summarized somatic variant call data derived from paired tumor–blood Whole-exome sequencing of human samples in a glioma research study. Access requests are approved without additional restrictions and are granted solely for health-related research purposes.

  Dac EGAC50000000855

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• WGS for 21 samples

  This dataset contains whole-genome sequencing (WGS) data from 14 acute leukemia cases of the newly identified FOXF1/FENDRR ALL subtype, including diagnosis or relapse samples, as well as 7 matched germline samples. All the 21 samples are in bam file type.

  Dataset EGAD50000001790

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Prognostic markers of DNA methylation and NGS sequencing in progressive glioblastoma from the EORTC-26101 trial

  These dataset contains NGS data from 380 samples from the EORTC-26101 clinical trial for patients with progressive glioblastoma.

  Study EGAS00001007421

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105

• Chromatin Profiling in Twins (2019-08-21)

  50 lymphoblastoid cell lines of adult female Twins which are part of the MuTHER study, subjected to Chromatin Immunoprecipitation using an antibody for H3K4me1. H3K4me1 peaks mark distal regulatory elements. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005274

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• Primary tumor/metastatic/germline DNA trios equences files

  Exome sequences of primary tumor/metastatic/germline DNA trios. Tumoral and germline samples were sequenced to an expected depth of respectively 150M and 50M reads in order to obtain differential depth (>100X versus >30X). Submitted data are paired-end fastq files.

  Dataset EGAD00001006324

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661