4982 results for "*oma"

in 33.74 milliseconds.

• Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant

  Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant. The Panel was designed using Agilent SureDesign on SureSelect XTHS Hybrid Capture Panel. Sequencing was done on Illumina NovaSeq 6000

  Dataset EGAD50000001548

• WGS Sequencing of Urothelial Carcinoma from Taiwan

  Normal and Tumor paired WGS sequencing of UC Tissues

  Dataset EGAD50000001547

• Datasets of RNA-seq of tumor samples from clear cell renal cell carcinoma patients included in the Translational Program of the NIVOREN GETUG-AFU-26 trial

  RNA-seq analyses were performed on tumor tissue samples of 115 advanced clear cell renal cell carcinoma patients who participated in the NIVOREN GETUG-AFU-26 trial. The samples were obtained prior to treatment initiation. RNA-seq was performed to evaluate previously published gene expression signatures. These included: the IMmotion T effector (CD8A, EOMES, PRF1, IFNG and CD274) and the IMmotion Myeloid (IL-6, CXCL1, CXCL2, CXCL3, CXCL8, and PTGS2) gene signatures represent gene expression patterns associated with T effector cells and myeloid cells, respectively, while JAVELIN Renal 101 Immuno (T-cell receptor signaling: CD3G, CD3E, CD8B, THEMIS, TRAT1, GRAP2, CD247; T-cell activation, proliferation, and differentiation: CD2, CD96, PRF1, CD6, IL7R, ITK, GPR18, EOMES, SIT1, NLRC3; Natural killer cell mediated cytotoxicity: D2, CD96, PRF1, CD244, KLRD1, SH2D1A; Chemokine: CCL5, XCL2; and Other immune response genes: CST7, GFI1, KCNA3, PSTPIP1) represents gene expression patterns associated with both innate and adaptive immune response.

  Dataset EGAD50000001541

• Clinical Outcomes for 344 Diffuse Large B-Cell Lymphoma Patients

  This dataset contains clinical outcomes for 344 Diffuse Large B-Cell Lymphoma patients. For each subject we have recorded AGE (binarized: > 60, <= 60), SEX (male or female), LDH (serum lactate dehydrogenase), ECOG (Performance status 3 or 4), STAGE (Disease stage III or IV according to the Ann Arbor staging system), EXBM (Two or more extranodal sites of disease (outside of a lymph node), BSYMP (Presence of B symptoms), and BM (Bone marrow involvement). All data are delivered as a single XLSX file with one row per patient.

  Dataset EGAD50000001536

• Visium CytAssist Spatial Gene Expression analysis for glioblastoma

  The glioblastoma spatial transcriptomics dataset was generated from 4 FFPE fixed adult glioblastoma samples, using the 10x Genomics Visium platform, producing raw FASTQ files, spatial feature matrices (.h5, .mtx, .tsv), and paired histology images (.tif). Spot-level transcript counts were aligned to tissue architecture and processed in Seurat, with results stored as .rds objects. Data visualization was performed using SpatialFeaturePlot, and quantitative analyses were supported by custom Matlab scripts. The dataset provides both raw and processed files, offering reproducible spatially resolved transcriptomic profiles of glioblastoma tissue sections

  Dataset EGAD50000001767

• SIA Subtyping RNA Sequencing

  Associated with Molecular classification of small intestinal adenocarcinomas. RNA sequencing generated 849 .fastq files from 137 primary and recurrent small intestine adenocarcinoma samples from 135 patients.

  Dataset EGAD50000001762

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing (part 2)

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38). This dataset contains the remaining file of this study.

  Dataset EGAD50000001757

• Targeted panel sequencing of two patient-derived melanoma cell lines

  Targeted panel sequencing was conducted on patient-derived cell lines: Mel-DCC-11 (the parental line, sensitive to the BRAF inhibitor) and Mel-DCC-11-R (resistant to the BRAF inhibitor). The parental cell line was generated from disseminated cancer cells (DCCs) obtained from a lymph node sample of a melanoma patient. The resistant cell line was generated from the parental one through exposure to Vemurafenib. Normal peripheral blood lymphocytes from the same patient served as the control for comparison. Sequencing on NovaSeq6000. Fastq files.

  Dataset EGAD50000001745

• Patient-derived organoids cohort raw FASTQ from SGMedical

  Raw FASTQ files for a glioblastoma multiforme organoid study, including exome sequencing and RNA-seq. 29 runs (paired-end), 58 FASTQ.c4gh files (R1/R2). Short-read Illumina; library strategies include exome capture and stranded total RNA-seq (see Experiment records for kit/instrument details). No processed results are included; access is controlled under the selected Policy.

  Dataset EGAD50000001741

• Shallow Whole Genome Sequencing (sWGS) of pancreatic ductal adenocarcinoma

  Associated with CNA differences between RNA-based subtypes of PDAC. Shallow Whole Genome Sequencing (sWGS) generated 47 .bam files from 37 patients. sWGS was used for Copy number aberrations (CNA) determination.

  Dataset EGAD50000001732

• WES dataset of a TIL-ACT metastatic melanoma cohort

  Whole-exome sequencing (WES) data from 13 patients with metastatic melanoma in a TIL-ACT cohort, generated to characterize tumor genomics and neoantigen landscapes relevant to adoptive T cell therapy.

  Dataset EGAD50000001731

• Five Mantle Cell Lymphoma Patients Before and After Failure of Standard Chemotherapy

  MCL cells were isolated from different tissues of five patients with MCL at diagnosis, and at the time of the first clinical relapse after failure of standard immunochemotherapy based on alternation of R(ituximab)-CHOP and R-high-dose-araC. All patients signed informed consent according to the Declaration of Helsinki. Four patients were diagnosed with classical nodal aggressive MCL, and all these patients experienced early relapse (i.e., progression of disease POD < 12 months). One patient was diagnosed with indolent non-nodal MCL and relapsed 9 years after initial MCL diagnosis. The dataset presents single cell RNA sequencing data as well as whole exome sequencing data for these five patients.

  Dataset EGAD50000001213

• Exome-sequencing on early oral squamous cell carcinoma with clear margins

  Whole exome sequencing (WES) on early oral squamous cell carcinoma (OSCC) with clear margins, and on resection margins, 86 patients with a median follow-up of 58 months (range 30.4-83 months). Raw data (fastq format).

  Dataset EGAD50000001209

• Single-cell RNA-sequencing on malignant and benign tissue samples

  Single-cell RNA-sequencing on malignant and benign tissue samples from untreated donors with colorectal adenocarcinoma and liver metastasis was performed in order to deduce tissue adaptive expression patterns of the disease. Matching tissue from five donors with untreated CRC and liver metastasis were sampled.

  Dataset EGAD50000001203

• Whole Exome Sequencing of paired gDNAs and PPGL tumor DNA from patients with cyanotic congenital heart disease

  Fastq files from Whole Exome Sequencing of 12 paired germline DNA (from blood/saliva) and 14 PPGL tumor DNA (from formalin-fixed paraffin-embedded (FFPE) blocks from surgery) from patients with cyanotic congenital heart disease (CCHD) and pheochromocytoma and paraganglioma (PPGL). Sequencing was performed using the Illumina HiSeq4000.

  Dataset EGAD50000001201

• Single-Cell and Bulk RNA Sequencing of Oncolytic Measles Virus Treatment in Pediatric Medulloblastoma and ATRT

  This dataset includes single-cell RNA sequencing profiles from five mice bearing Group 3 medulloblastoma (CSCG) treated with oncolytic measles virus (MV-NIS) and three mice treated with MV-NIS combined with anti-PD1 therapy. Additionally, bulk RNA sequencing data were generated from 12 samples across PBS control, heat-inactivated (HI) control, MV mid-treatment, and treatment resistance conditions. Pediatric patient data were collected from the PNOC005 trial, which enrolled patients into three strata: Stratum A (focal recurrence, local MV-NIS administration post-surgical resection), Stratum B (disseminated recurrence, single MV-NIS dose via lumbar puncture), and Stratum C (disseminated recurrence, two consecutive MV-NIS doses via lumbar puncture on Day 0 and Day 7). Whole blood and PBMC samples were collected from 17 patients across all strata, generating 72 bulk RNA-seq datasets at multiple time points. All datasets are provided as raw sequencing data in FASTQ format.

  Dataset EGAD50000001197

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• Shallow dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. shallow Whole Genome Sequencing (sWGS) of 63 samples. sWGS was done to analyze copy number aberration.

  Dataset EGAD50000001165

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Refractory Classic Hodgkins Lymphoma (cHL) sWGS

  Associated with the study: Blood-based Monitoring of Relapsed/Refractory Hodgkin Lymphoma Patients Predict Responses to Anti-PD-1 Treatment. 26 ctDNA Samples from 4 patients followed longitudinally. sWGS performed for copy number aberration (CNA) analysis.

  Dataset EGAD50000001163

• nEODURVARIB clinical trial. Exome sequencing in advanced urothelial carcinoma

  Exome sequencing (BAM and VCF files) in advanced urothelial carcinoma in diagnostic and pos-ttreatment samples

  Dataset EGAD50000001162

• mUM patient biopsies bulk RNAseq

  Tumour biopsies were obtained from uveal melanoma patients (n = 35) pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system

  Dataset EGAD50000001225

• Bulk RNA-sequencing data of advanced hepatocellular carcinoma (HCC) patients treated with atezolizumab plus bevacizumab.

  The dataset includes FASTq files and normalised gene expression counts from bulk RNA-sequencing of pre-treatment tumour (n=39) and adjacent non-tumour tissue samples (n=13) from advanced hepatocellular carcinoma (HCC) patients treated with atezolizumab plus bevacizumab. Specifically, RNA was extracted from the FFPE tumour tissue using RNeasy Plus Mini Kit (Qiagen), according to the manufacturer’s instructions. RNA quality and quantity were evaluated using Agilent RNA 600 Pico Chips (Agilent Technologies). Sequencing libraries were prepared using the SMARTer Stranded Total RNA-seq kit v3 (Takara Bio). Sequencing was performed on an Illumina NovaSeq 6000 system. After obtaining the Fastq files, read 2 UMIs and adapters were trimmed using seqtk (v1.2), reads were aligned using STAR (v2.7.7a) to the human reference genome (GRCh38) and quantified with HTSeq (v2.0.2).

  Dataset EGAD50000001227

• WES PTCL Data

  Whole Exome Sequencing (WES) of 153 FFPE DNA samples of Peripheral T-Cell Lymphoma. Associated with "Molecular biomarkers for stratification periheral T cell lymphoma" study.

  Dataset EGAD50000001250

• Low-coverage Single-cell Whole Genome Sequencing Data from Paired Meningioma Samples

  This dataset comprises low-coverage (~0.5X) whole genome sequencing data from 179 single cells isolated from paired meningioma samples (88 cells from initial grade II and 91 cells from recurrent grade III tumor from the same patient). The single-cell libraries were constructed using Primary Template Amplification and ResolveDNA protocol, with libraries subsequently sequenced on NextSeq 1000 using 2x150bp paired-end reads targeting 8M reads per cell. This dataset includes the sequencing data in Fastq format.

  Dataset EGAD50000001254

• mUM patient biopsies pre and post treatment with tebentafusp

  The dataset includes 141 RNA-seq samples form mUM patietns. Tumour biopsies were obtained from uveal melanoma patients pre and post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dataset EGAD50000001258

• Paired FastQ files from deep targeted DNA sequencing

  This dataset comprises paired-end and time-matched FastQ files from 356 cell-free DNA samples and 356 white blood cell DNA samples, derived from 299 patients with metastatic renal cell carcinoma or urothelial carcinoma. A baseline sample was available for all patients. Sequencing was performed using Illumina technology.

  Dataset EGAD50000001267

• RNA-sequencing from ALL patients treated on the Australasian Leukaemia and Lymphoma Group (ALLG) ALL06 study.

  Dataset contains RNA-sequencing data (fastq files) from 45 patients treated on the the Australasian Leukaemia and Lymphoma Group (ALLG) ALL06 study, an MRD-stratified Paediatric Protocol. Patient samples (bone marrow or peripheral blood) were taken at diagnosis. mRNA was extracted from blast cells and underwent paired-end sequencing (75bp) using the illumina NextSeq platform. Genomic data was used for identification of genomic drivers of acute lymphoblastic leukaemia (ALL).

  Dataset EGAD50000001111

• Dataset for scRNA glioblastoma samples

  This dataset contains 5 scRNA samples of human glioblastoma samples, human cortical spheroid derived from hiPSC line 028-4 and 3 samples of mouse xenografts. Sequencing has been performed on Illumina NovaSeq 6000. Sequencing has always been paired.

  Dataset EGAD50000001117

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• High-grade serous ovarian carcinoma tumour whole genome sequencing variants

  Tumour somatic variants (in VCF format) called from paired tumour-germline whole genome sequencing (using IDT library preparation system followed by sequencing on Illumina NovaSeq platform) of three high-grade serous ovarian tumour samples. The dataset comprises three VCF variant files.

  Dataset EGAD50000001131

• High-grade serous ovarian carcinoma tumour exome sequencing variants

  Tumour variants (in VCF format) from exome sequencing (using Agilent SureSelect and TWIST library preparation systems followed by sequencing on Illumina HiSeq and NovaSeq platforms) of 108 high-grade serous ovarian tumour samples. Germline variants from EGAD00001006030 for these individuals were used to call somatic and tumour-only variants separately, creating two VCF files per sample (except for one sample without paired germline data- somatic variant file only provided). The dataset comprises 215 VCF variant files.

  Dataset EGAD50000001132

• Whole Exome Sequencing Data of 34 indolent primary renal B-Cell lymphoma cases

  Here, 34 iNHL samples were sequenced using whole exome sequencing to describe the mutational landscape of indolent primary renal B-Cell lymphomas. Mutational profiles were compared to other Marginal Zone Lymphomas.

  Dataset EGAD50000001136

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• Transcriptome - Uveal Melanomas MPI

  Total RNA sequencing on 4 uveal melanoma samples. Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001138

• scRNA-seq of human follicular lymphoma and lymph node

  Cryopreserved cells from human nodal follicular lymphoma and lymph node samples were thawed and processed for scRNA-seq analysis. CD3+ CD19− 7-AAD− live T cells (six FL samples from the Original cohort) or 7-AAD− whole live hematopoietic cells (five lymph node and nine FL samples from Validation cohort 1) were sorted using a FACS Aria II or III instrument (BD Biosciences). To generate single-cell emulsions, 6,000–10,000 live cells were loaded into the 10X Genomics Chromium Controller for single-cell partitioning, along with the reverse transcriptase reagent mixture and 3' or 5' gel beads. Sorted T or whole hematopoietic cells were converted to barcoded scRNA-seq libraries using 10X Genomics Chromium single cell 3' reagent kits (v3) for the Validation cohort 1, 5' reagent kits (v1) for the Original cohort, according to the manufacturer’s instructions. The libraries were sequenced on an Illumina HiSeq X Ten or NovaSeq X Plus system, mapped to the human genome (build GRCh38), and demultiplexed using CellRanger pipelines (v3.1.0, 10x Genomics).

  Dataset EGAD50000001143

• Peripheral T cell lymphoma (PTCL) Shallow Whole Genome Sequencing

  Shallow Whole Genome Sequencing (sWGS) of 148 FFPE DNA samples from peripheral T cell lymphoma (PTCL) samples. Assoicated with the "Molecular biomarkers for stratification peripheral T cell lymphoma" study.

  Dataset EGAD50000001146

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• scRNA seq and scTCR seq data from 5 melanoma patients

  The Chromium Controller and Chromium X platfor of 10X Genomics were used for single cell partitioning and barcoding. Each cell's transcriptome was barcoded during reverse transcription, pooled cDNA was amplified and Single Cell 5' Gene Expression (GEX), V(D)J and Feature Barcode (FB) Libraries were prepared according to the manufacturer's protocols (CG000330 and CG000331, 10X Genomics). All libraries were quantified and normalized on library QC data generated on the Bioanalyzer system according to manufacturer's protocols (G2938-90321 and G2938-90024, Agilent Technologies). Based on the expected target cell counts, a balanced library sub-pool of samples was compsed for SC5'GEX, V(D)J and FB libraries. Library sub-pools were quantified by qPCR, accodring to the KAPA Library Quantification Kit Illumina(R) Platforms protocol (KR0405, KAPA Biosystems). Based on qPCR results a final sequencing pool was composed. Paired end sequencing was performed on a NovaSeq 6000 Instrument (Illumina) using NovaSeq 6000 Reagent Kits v1.5 100 cycles (cat. no. 20028401, 20028319, 20028316 Illumina), using 28 cycles for Read 1, 10 cycles for Read i7, 10 cycles for Read i5 and 90 cycles for Read 2.

  Dataset EGAD50000001155

• RNAseq of Thymic epithelial tumors and paired normals

  Between November 2010 and May 2014, 20 cases—17 thymomas and 3 thymic carcinomas (including 2 squamous and 1 neuroendocrine carcinoma)—were newly sequenced from surgically removed TETs at Seoul National University Hospital, with written informed consent. Tumors and normal tissues were carefully separated and immediately preserved in liquid nitrogen after resection. DNA and RNA were extracted from the tumors, adjacent normal tissues, and/or blood samples. Libraries for RNA-seq were prepared using the TruSeq Stranded mRNA LT Sample Prep Kit following standard Illumina protocols.

  Dataset EGAD50000001158

• WES of thymic epithelial tumors and paired normals

  Between November 2010 and May 2014, 20 cases—17 thymomas and 3 thymic carcinomas (including 2 squamous and 1 neuroendocrine carcinoma)—were newly sequenced from surgically removed TETs at Seoul National University Hospital, with written informed consent. Tumors and normal tissues were carefully separated and immediately preserved in liquid nitrogen after resection. DNA and RNA were extracted from the tumors, adjacent normal tissues, and/or blood samples. Libraries for WES were prepared using the SureSelect XT (Human All Exon + UTR v5) Library Prep Kit following standard Illumina protocols.

  Dataset EGAD50000001159

• Shallow Whole Genome Sequencing (sWGS) from REPEAT trial

  Samples associated to: "A phase Ib/II study of regorafenib and paclitaxel in patients with beyond first-line advanced esophagogastric carcinoma (REPEAT)". sWGS from 97 Esophagogastric Carcinoma samples. sWGS was done to carry out Copy Number Analysis. Dataset includes: .fastq, .bam and .bai files.

  Dataset EGAD50000001161

• WGS of single CTCs from 4 patients with metastatic cancer

  This dataset contains 352 paired fastq files sequenced by illumina Novoseq6000. Single-cell low-pass WGS analysis (illumina platform, PE150, 1-2x coverage) was performed on CTCs enriched using high-throughout microfluidic device from entire leukopak from patients with metastatic prostate cancer (GU-1 and GU-2) and metastatic hepatocellular carcinoma (HCC-1 and HCC-2). Patient matched white blood cells (WBC) served as internal controls.

  Dataset EGAD50000001006

• Distinct immune cell infiltration patterns in pancreatic ductal adenocarcinoma (PDAC) exhibit divergent immune cell selection and immunosuppressive mechanisms

  To elucidate the heterogeneity of tumour immune cell infiltration, we performed single cell RNAseq sequencing on CD45+ cells enriched from matched fresh tumour tissue following surgical resection of 12 treatment-naïve patients and matched PBMCs.

  Dataset EGAD50000001008

• RNA-seq of chordoma samples

  This dataset contains paired-end bulk RNA-seq data of advanced chordoma samples from 7 patients. Sequencing was performed on Illumina HiSeq 4000 or NovaSeq 6000.

  Dataset EGAD50000001019

• fragmentomic features of individuals with different cfDNA concentrations

  The uploaded data includes sequencing data of 862 individuals from the nasopharyngeal carcinoma (NPC) screening study. Samples from this cohort were sequenced using targeted sequencing methods for the Epstein Barr Virus (EBV) and selected autosomal DNA, but only ‘off-target’ reads were used for fragmentomic analyses. We have also performed genome-wide (non-targeted sequencing) for 1) Individuals with the highest and lowest cell-free DNA concentration (40 individuals); 2) A subsequent collection of the subjects with the highest and lowest DNA concentrations after six years (26 individuals); 3) 30 cases of pregnancy and 4) 20 patients with hepatocellular carcinoma. All sequencing data are of extracted plasma cfDNA from human subjects. The targeted sequencing samples from 862 individuals were sequenced on the NextSeq500 System (Illumina) and aligned to the EBV genome (AJ507799.2) and the human genome (hg19). The alignments were provided in bam format. The original fastq files of the remaining non-target sequencing samples were provided.

  Dataset EGAD50000000970

• Dataset with fibroblast samples from LFS patients

  This dataset contains paired-end 10x scRNAseq, 10x ATACseq and bulk WGS data of fibroblast samples from LFS patients and patient-derived xenograft samples of medulloblastoma. Sequencing was performed on Illumina NovaSeq 6000.

  Dataset EGAD50000000969

• RNA-seq from Glioblastoma treated with Indisulam

  The dataset includes RNA-sequencing results from four patient-derived glioblastoma cell lines treated with DMSO (vehicle control) or the splicing modulating-drug indisulam (at 6 and 16 hours), resulting in 12 RNA-seq samples. Paired-end sequencing produced 24 FASTQ.gz files. The RNA libraries were prepared using PolyA selection and ERCC spike-ins and sequenced on a NovaSeq platform. This dataset supports the analysis of drug-induced transcriptomic changes and the prediction of subsequent non-canonical tumor-specific antigens (ncTSAs) using the NovumRNA pipeline.

  Dataset EGAD50000000957

• Shallow whole genome sequencing data from circulating tumour DNA (ctDNA) data of High Grade Serous Ovarian Cancer Patients (batch 1)

  The dataset contains shallow whole genome sequencing data of 128 high-grade serous carcinoma (HGSC) patients sequenced with Novoseq 6000. The 128 samples are plasma samples that have been collected before treatment. The files provided are paired fastq files.

  Dataset EGAD50000000949

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• WES and RNA-seq of pre-invasive lung adenocarcinoma

  The prevalence of lung adenocarcinoma (LUAD) has increased sharply in East Asia. Early diagnosis leads to better survival rates, but this requires an improved understanding of the molecular changes during early tumorigenesis, particularly in non-smokers. We performed whole exome-sequencing and RNA-sequencing of samples from 94 East Asian patients with precancerous lesions (25 with atypical adenomatous hyperplasia [AAH]; 69 with adenocarcinoma in situ [AIS]) and 73 patients with early invasive lesions (minimally invasive adenocarcinoma [MIA]). This datasets contains the sequencing raw data (FASTQ format).

  Dataset EGAD50000000637

• WES of precancerous lesions from 10 lynch patients and 3 sporadics

  Raw sequencing data of WES that were obtained from precancerous samples as adenoma and MMR-deficient crypts and paired healthy tissue from MSI CRC patients of which 10 are diagnosed with lynch syndrome and 3 had sporadic cancer. These data were analyzed in order to evaluate microsatellite instability though tumorigenesis and associated to splicing deregulation in MSI tumors RNA.

  Dataset EGAD50000000644

• GBM Study Complete Raw Data

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside total RNA from the tumors.

  Dataset EGAD50000000650

• HCC cfMeDIP-seq

  This dataset comprises 406 raw fastq files derived from 203 plasma cfDNA samples from 90 patients diagnosed with hepatocellular carcinoma (HCC). The samples include 90 baseline HCC (b-HCC) samples, collected during liver transplant or resection surgeries, and 113 postoperative follow-up (f-HCC) samples. For each sample, 10ng of cfDNA was used for library preparation utilizing cfMeDIP-seq technology based on the 5mC antibody-immunoprecipitation strategy. Libraries were validated via Bioanalyzer trace analysis and sequenced on Illumina NovaSeq 6000 or HiSeq 2500 platform with paired-end 150-bp (NovaSeq) or 125-bp (HiSeq) model for ~100 million reads per sample.

  Dataset EGAD50000000651

• Dataset for Multiple Myeloma WGS data, part 2

  This dataset contains 518 case and control WGS sequencing samples of patients with multiple myeloma. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X using TruSeq Nano DNA Kits. The sequencing was always paired.

  Dataset EGAD50000000681

• Dataset for Multiple Myeloma WGS samples

  This dataset contains 221 case and control WGS sequencing samples of patients with multiple myeloma. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X using TruSeq Nano DNA Kits. The sequencing was always paired.

  Dataset EGAD50000000682

• Dataset for Multiple Myeloma RNA data

  This dataset contains 371 case and control RNA sequencing samples of patients with multiple myeloma. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X, HiSeq 4000 and HiSeq 2000 using TruSeq Stranded RNA and TruSeq Stranded total mRNA Kits. The sequencing was always paired.

  Dataset EGAD50000000683

• Dataset for RNA sequencing glioblastoma data

  This dataset contains RNA sequencing data of 36 glioblastoma samples. Sequencing was performed on Illumina NovaSeq 6000 using TruSeq Stranded RNA Kit. The sequencing was always paired.

  Dataset EGAD50000000688

• Whole genome sequencing data of high-grade serous ovarian cancer samples (set 15)

  The dataset contains whole genome sequencing data of 8 high-grade serous carcinoma (HGSC) patients sequenced with Novoseq 6000. The 16 samples are either fresh frozen tumour samples or blood samples. The files provided are paired fastq files.

  Dataset EGAD50000000526

• Human skin cancer (BCC, SCC, melanoma) and healthy control skin

  Smart-seq2 single cell RNA sequencing of human BCC, SCC, melanoma (ALM) and healthy control skin samples.

  Dataset EGAD50000000540

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma cases. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dataset EGAD50000000546

• SDR-seq_06_BCL

  SDR-seq_BCL data access. Two follicular lymphoma (FL) primary patient samples and one germinal center subtype diffuse large B-cell lymphoma (GCB) primary patient sample. FL1 and GCB1 are sequenced in Run1. FL2 is sequenced in Run2.

  Dataset EGAD50000000551

• Whole exome sequencing of Ewing sarcoma and CIC-DUX4 sarcoma

  Whole exome sequencing of a collection of 6 Ewing sarcoma and 3 CIC-DUX4 sarcoma tumoroids plus 4 matched patient tumors and normal tissue. Tumoroids were established from digested patient tumor material as 3D culture in Matrigel. After 2-3 month of growth, Genomic DNA was isolated from individual tumoroid models using the DNeasy Blood & Tissue Kit (Qiagen) and used for whole exome sequencing. Genomic DNA from corresponding patient tumors and matched normal tissue was tested in parallel, if available.

  Dataset EGAD50000000556

• RNA sequencing of Ewing sarcoma and CIC-DUX4 sarcoma

  RNA sequencing of a collection of 6 Ewing sarcoma and 3 CIC-DUX4 sarcoma tumoroids plus 3 matched patient tumors. Tumoroids were established from digested patient tumor material as 3D culture in Matrigel. After 2-3 month of growth, RNA was isolated from individual tumoroid models using the RNeasy Kit (Qiagen) and used for whole exome sequencing. RNA from corresponding patient tumors was tested in parallel, if available.

  Dataset EGAD50000000557

• CATNON: IDH-mutant astroctyoma RNA FASTQ

  Raw fastq files obtained by RNA sequencing 138 IDH-mutant astrocytomas included in the CATNON trial. RNA was extracted from formalin-fixed paraffin-embedded (FFPE) tissue blocks using the RNeasy FFPE kit. RNA sequencing was performed on an Illumina NovaSeq 6000 (GenomeScan BV, Leiden, The Netherlands) with 150bp paired-end reads including UMI tags.

  Dataset EGAD50000000558

• CAYA glioma sequencing data

  Low pass WGS and targeted glioma panel sequencing of low and high-grade gliomas in children, adolescent, and young adult patients.. File type is paired-read fastq files (2 per sample). Sequencing was performed on Illumina NextSex instruments. Genes covered on panel: TP53, H3F3A, HIST1H3B, HIST1H3C, IDH1, IDH2, KRAS, PIK3CA, TERT promoter, PTPN11, FGFR1/2/3, MYB, BRAF, MYBL1, EGFR, PDGFRA, MYCN, MYC, CDKN2A.

  Dataset EGAD50000000560

• mRNA-Sequencing of 73 primary multiple myeloma (MM) samples and human MM cell lines

  mRNA-Sequencing of 73 primary multiple myeloma (MM) samples and human MM cell lines before and after siRNA-mediated knockdown of ADAM8 (n=5 cell lines), ADAM9 (n=7 cell lines) and ADAM15 (n=5 cell lines). Paired-end sequencing was performed on a NovaSeq (Illumina). Fastq and bam files are provided for each sample.

  Dataset EGAD50000000575

• RCRF release 2

  RNA sequencing of a Chromophobe renal cell carcinoma, Non-clear cell chromophobe renal cell carcinoma, Neuroendocrine PDAC and clear cell sarcoma

  Dataset EGAD50000000872

• Mucosal Melanoma transcriptomes

  This is an RNA sequencing dataset of 101 mucosal melanoma tumors. The original corresponding study is titled "Diversity of the immune microenvironment and response to checkpoint inhibitor immunotherapy in mucosal melanoma" by J.L. Vos et al., published in JCI Insight.

  Dataset EGAD50000000892

• Single Cell Sequencing of Medulloblastoma Samples

  This dataset contains the results of sequencing 9 samples (7 human/PDX, 2 cell lines) of medulloblastoma tumours (or 2 Neural Stem Cell lines). The data was collected to characterize the intratumour heterogeneity of chromothripsis in this tumour type. The 7 tumour samples underwent single cell DNA and RNA sequencing using the 10x CNVkit and 10xRNA protocols, and 1 of the tumour samples as well as the Neural Stem Cell lines underwent StrandSeq sequencing. All experiments were sequenced on Illumina sequencers. The provided files are paired-end fastq files from the sequencing experiments.

  Dataset EGAD50000000909

• Nanopore whole-genome sequencing of human osteosarcomas

  We performed single and multi-region nanopore whole-genome sequencing on human osteosarcoma samples from adult and paediatric patients.

  Dataset EGAD50000000925

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Exome - Uveal Melanomas

  Whole exome sequencing on 11 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the SureSelectXT2 Clinical Research Exome V2 kit (Agilent, 5190-9500 and G9621B). Paired-end libraries (2 x 100 bp) were sequenced on HiSeq 2000/2500 or NovaSeq 6000 instruments (Illumina).

  Dataset EGAD50000000767

• FASTQ Data from In Situ Hi-C on Medulloblastoma Tissue Samples

  29 Hi-C datasets [8 G3 (MB3667, MB3687, MB3690, MB3692, MB3693, MB4010, MB4037, MB4141), 13 G4 (MB0558, MB3510, MB3670, MB3689, MB3716, MB3760, MB3761, MB3807, MB4079, MB4132, MB4174, MBSF7, SNC_2_5), 7 SHH (MB3612, MB3661, MB3662, MB3695, MB3697, MB3724, MB4143), and 1 WNT (MB4036)]. Fresh tissue samples were obtained from The Hospital for Sick Children (Toronto, ON). In situ Hi-C libraries were generated using approximately 2.5 million dissociated cells as input. All Hi-C libraries were sequenced at 150 bp PE with a Hi-Seq X instrument (Illumina) at McGill Genome Centre (Montreal, QC).

  Dataset EGAD50000000771

• Whole Genome Sequencing of Multiple Myeloma patients treated with T-cell redirecting immunotherapies

  Samples was collected at the Arnie Charbonneau Cancer Institute (University of Calgary). Whole Genome Sequencing was performed at the New York Genome Center, and libraries were prepared using the Truseq DNA Nano Library Preparation Kit. Libraries were sequenced on an Illumina Novaseq 6000 sequencer using 2 x 150-bp cycles. The dataset consists in 85 BAM files from patients with Multiple Myeloma treated with bi-specific and CAR-T therapies. Reference Genome: GRCh38.

  Dataset EGAD50000000776

• Whole genome sequencing data of high-grade serous ovarian cancer samples (set 16)

  The dataset contains whole genome sequencing data of 58 high-grade serous carcinoma (HGSC) patients sequenced with Novoseq 6000. The 144 samples are either fresh frozen tumour samples or blood samples. The files provided are paired fastq files.

  Dataset EGAD50000000777

• WGS from melanoma patient tumor/normal pairs and longitudinal panel-based cfDNA sequencing data

  This data includes paired WGS from tumor/normal and longitudinal panel-based sequencing data of plasma-derived cfDNA from melanoma patients being treated with ICI.

  Dataset EGAD50000000785

• Exome Sequencing of Multiple Localised Spiradenoma and Spiradenocarcinoma

  Tumor samples were microdissected from formalin-fixed, paraffin-embedded tissue and genomic DNA was extracted. DNA libraries were generated using xGen ssDNA & Low-Input DNA Library Preparation Kit (IDT). The libraries were enriched for the exome using xGen Exome Hyb Panel (IDT) and sequenced on DNBSEQ G400RS.

  Dataset EGAD50000000788

• BAM files from whole-exome sequencing of 5 agressive B-cell lymphoma tumour samples

  This dataset contains BAM files from whole-exome sequencing (WES) of 5 agressive B-cell lymphoma tumour samples for cases 2, 3, 4 and 5. For case 2, non-tumor whole-exome sequencing is also available.

  Dataset EGAD50000000803

• Single-cell transcriptomics of hepatoblastoma

  10X Genomics single-cell transcriptomics of hepatoblastoma tissues using Chromium Next GEM Single-Cell 3’ Reagent Kits v3.1. Single-cell transcriptomics data (bam files) of PT9, post-chemotherapy tumor sample, and PT13, treatment naive tumor sample. Single-cell solutions were obtained from viably frozen tissue samples using enzymatic digestion.

  Dataset EGAD50000000794

• Single-cell multiome ATAC and gene expression profiling of hepatoblastoma tumor organoids

  10X Genomics single-cell multiome profiling of hepatoblastoma tumor organoids using Chromium Next GEM Single-Cell Multiome ATAC + Gene Expression Kit. Single-cell transcriptomics data (bam file) of multiplexed sample of hepatoblastoma tumor organoids: 3E, 8F1, 10F2, 13F2, 13E, 17E and 96F1. Single-cell solutions were obtained from fresh organoid samples using enzymatic digestion.

  Dataset EGAD50000000795

• Single-cell transcriptomic profiling of hepatoblastoma tumor organoids

  10X Genomics single-cell transcriptomic profiling of hepatoblastoma tumor organoids using Chromium Next GEM Single-Cell 3’ Reagent Kits v3.1 or 3’ CellPlex Multiplexing Kit. Single-cell transcriptomics data (bam files) of hepatoblastoma tumor organoids: 3E, 8F1, 10F2, 13F2, 13F2 late, 13E, 17E, 17F1, 22E, 27F1, 28F1, 31E, 96F1, 121E and 135. Single-cell solutions were obtained from fresh organoid samples using enzymatic digestion.

  Dataset EGAD50000000796

• Spatial transcriptomics of hepatoblastoma

  10X Genomics Visium Spatial transcriptomics analysis of hepatoblastoma and adjacent normal liver. Spatial data of normal liver and PT2 (fastq files), and and PT13, PT14 and PT16 (bam files) using the Visium Spatial Gene Expression Solution. All samples, except PT13, were collected post-chemotherapy.

  Dataset EGAD50000000797

• BAM files from whole-genome sequencing of 3 agressive B-cell lymphoma tumour and non-tumor samples

  This dataset contains BAM files from whole-genome sequencing (WGS) of 3 agressive B-cell lymphoma tumour samples for cases 1, 6, and 7 as well as the corresponding non-tumor whole-genome sequencing BAM files.

  Dataset EGAD50000000800

• BAM files from capture-based targeted sequencing of 12 agressive B-cell lymphoma tumour samples (IG-MCL-panel)

  This dataset contains BAM files from capture-based targeted sequencing of 12 agressive B-cell lymphoma tumour samples for cases 1 to 6 and 8 to 13. The sequencing panel used is a MCL-oriented panel containing 159 genes.

  Dataset EGAD50000000801

• BAM files from capture-based targeted sequencing of 4 agressive B-cell lymphoma tumour samples (DLBCL-panel)

  This dataset contains BAM files from capture-based targeted sequencing of 4 agressive B-cell lymphoma tumour samples for cases 2, 3, 4 and 13. The sequencing panel used is a DLBCL-oriented panel containing 136 genes, described in Mozas P. et al., Hematol Oncol 2023.

  Dataset EGAD50000000802

• ONT sequencing neuroblastoma cell lines

  Shallow long-read nanopore WGS of ecDNA containing neuroblastoma cell lines.

  Dataset EGAD50000000509

• ONT sequencing of primary neuroblastoma samples

  Shallow WGS long-read sequencing of primary neuroblastoma samples.

  Dataset EGAD50000000508

• Whole genome sequencing data of high-grade serous ovarian cancer samples (set 14)

  The dataset contains whole genome sequencing data of 42 high-grade serous carcinoma (HGSC) patients sequenced with Novoseq 6000. The 100 samples are either fresh frozen tumour samples or blood samples. The files provided are paired fastq files.

  Dataset EGAD50000000507

• Single-nuclei RNA sequencing of pheochromocytoma and paraganglioma arising from germline SDHB mutations

  10x genomics single-nuclei RNA sequencing of 9 SDHB-deficient non-metastatic and metastatic pheochromocytoma and paraganglioma. snRNA-seq was performed using the ‘Frankenstein’ protocol (dx.doi.org/10.17504/protocols.io.bqxymxpw). Briefly, nuclei were extracted from frozen tissues and subjected to fluorescence-activated nuclei sorting (FANS) using 4′,6-diamidino-2-phenylindole (DAPI). Sorting was performed using a BD FACSaria 2 instrument, sorting between 3000 and 10,000 nuclei per sample, capturing both diploid and tetraploid populations. FAN-sorted nuclei were immediately processed using either the 10x Chromium Single Cell 5’ (PN-1000006, 4 samples) or 3’ (PN-1000075, 4 samples) Library & Gel Bead Kit (10x Genomics, USA). Once processed, snRNA-seq libraries were sequenced on the Illumina Nova-Seq 6000 (Illumina, USA) using 150bp paired-end sequencing. This dataset contains raw sequencing reads in FASTQ format.

  Dataset EGAD50000000505

• Whole transcriptome sequencing of pheochromocytoma and paraganglioma arising from germline SDHB mutations

  Paired-end 150 basepair whole transcriptome sequencing of 91 SDHB-deficient non-metastatic and metastatic pheochromocytoma and paraganglioma. Samples were prepared using the NEB-Next directional RNA-Seq kit (NEB, USA) and underwent 150bp paired-end sequencing on the Illumina NovaSeq 6000 (Illumina, USA) according to manufacturer’s instructions. This dataset contains raw sequencing reads in FASTQ format.

  Dataset EGAD50000000504

• Single-nuclei ATAC sequencing of pheochromocytoma and paraganglioma arising from germline SDHB mutations

  10x genomics single-nuclei ATAC sequencing of 7 SDHB-deficient non-metastatic and metastatic pheochromocytoma and paraganglioma, and 1 normal adrenal medulla sample. snATAC-seq was conducted using the "Van Helsing" protocol (dx.doi.org/10.17504/protocols.io.bw52pg8e). Once processed, snATAC-seq libraries were sequenced on the Illumina NextSeq 500 (Illumina, USA) using 50bp paired-end sequencing. Raw sequencing data in BCL format was demultiplexed using cellranger-atac mkfastq (V2.0.0). This dataset contains sequencing reads in FASTQ format. R1/R3 files contain the forward and reverse sequencing reads, respectively, R2 contains the 10x Barcode.

  Dataset EGAD50000000503

• Whole genome sequencing of pheochromocytoma and paraganglioma arising from germline SDHB mutations

  Paired-end 150 basepair whole genome sequencing of 94 SDHB-deficient non-metastatic and metastatic pheochromocytoma and paraganglioma. Libraries were prepared using the Illumina® TruSeq™ DNA Nano library preparation method according to the manufacturer’s instructions at The University of Melbourne Centre for Cancer Research (UMCCR) using 200ng input DNA and a 550 base pair insert size. Samples were sequenced in separate batches on the Illumina® Nova-Seq 6000 according to manufacturer’s instructions (Illumina, USA). Included in this dataset are FASTQ format files containing raw read data, CRAM format files containing reads aligned to GRCh38, and VCF format files containing germline variants calls.

  Dataset EGAD50000000502

• Small-RNA sequencing of pheochromocytoma and paraganglioma arising from germline SDHB mutations

  Single-end 75 basepair small-RNA sequencing of 90 SDHB-deficient non-metastatic and metastatic pheochromocytoma and paraganglioma. Samples were prepared using the NEXTFLEX® Small RNA-Seq Kit v3 (Bioo Scientific ). Samples were sequenced at the molecular genomics core (Peter MacCallum Cancer Centre) using 50bp single end sequencing on the Illumina NextSeq 500 (Illumina, USA). This dataset contains raw sequencing reads in FASTQ format.

  Dataset EGAD50000000501

• Spatially Resolved Tumor Ecosystems and Cell States in Gastric Adenocarcinoma Progression and Evolution

  This whole-section GeoMx Digital Spatial Profiler (DSP) dataset was a part of the discovery cohort in the study. The dataset contains raw FASTQ files from Regions of Interest (ROIs) across complete tumor tissue sections, enabling detection of 18,000 protein-coding genes. GeoMx DSP data from 1063 ROIs (after QC) from 15 GCs were included in the datasets.

  Dataset EGAD50000000500

• RNAseq from a study of MYC, BCL2 and BCL6 rearrangements in non-Hodgkin lymphoma.

  Paired-end ribodepletion RNAseq performed on 257 samples of Burkitt lymphoma, diffuse large B cell lymphoma, follicular lymphoma, and high-grade B cell lymphoma with MYC and BCL2 or BCL6 rearrangements. RNA was derived from either fresh frozen or formalin fixed/paraffin embedded (FFPE) tissues. Sequencing was performed on Illumina HiSeqX or NovaSeqX instruments.

  Dataset EGAD50000000496

• WGS of primary mediastinal large B-cell lymphoma

  This dataset includes 19 bamfiles of tumor, relapsed tumor and normal samples derived from 7 patients.

  Dataset EGAD50000000494

• Single cell RNA sequencing data of advanced melanoma patients treated with checkpoint inhibitor immunotherapy

  Single cell RNA libraries were prepared using 10x Genomics Chromium Next GEM Single Cell 3’ v2 reagents. The samples were barcoded and each library were pooled with two samples at equimolar concentrations. The pooled libraries (n=4) were sequenced on the NextSeq 500 machine (Illumina) with paired-end sequencing and dual indexing as recommended in the manufacturer’s protocol; 26 and 98 cycles for the respective Read 1 and 2, and 8 cycles for i7 index.

  Dataset EGAD50000000493