5495 results for "*oma"

in 37.62 milliseconds.

• Single-cell G&T sequencing - Transcriptomic data

  Single-cell G&T seq from an untreated PDX mouse with neuroblastoma (MYCN amplified).

  Dataset EGAD50000001514

• Single Cell Multiome ATAC + Gene Expression sequencing

  The SHH medulloblastoma tumor 7316-178 was received through the Childhood Brain Tumor Network (CBTN). From the patient tumor, disassociated cryopreserved cells stored in 10% DMSO/FBS were used. At least 50 mg of tissue (1 M cells) was used for both samples. Disassociated cells were prepared for Single Cell Multiome ATAC + Gene Expression sequencing (10× Genomics) according to the manufacturer’s instructions. Sequencing was performed on an Illumina NovaSeq S4 200 to a depth of at least 250 M reads for snATAC-seq and 200 M reads for snRNA-seq.

  Dataset EGAD50000001515

• Whole exome sequencing of Human High-Grade-B-Cell-Lymphomas, classified according to IGH status

  HGBCL-DH-BCL2(-BCL6) lymphoma cases, classified according to IGH status in IGH+ or IGH-undetectable

  Dataset EGAD50000001527

• Whole genome sequencing of metachronous FL-High-Grade-B-Cell-Lymphomas, classified according to IGH status

  FL-HGBCL-DH-BCL2(-BCL6) metachronous lymphoma pairs, classified according to IGH status in IGH+ or IGH-undetectable

  Dataset EGAD50000001528

• T cell and Antibody Responses in Rituximab-Treated Lymphoma Patients After SARS-CoV-2 Vaccination

  This dataset contains T cell receptor (TCR) sequencing data from 51 RNA samples, each processed into three independent libraries (tot 153 FASTQ files). Sequencing was performed on an Illumina NextSeq 500 platform using the NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles), generating paired-end FASTQ files with dual 10 bp barcodes and 5% PhiX as internal control. Libraries were quantified with the Qubit HS dsDNA kit and assessed for fragment size distribution using the Agilent Tapestation D1000 system before isochoric pooling to 4 nM and sequencing in two independent runs. The resulting dataset enables analysis of TCR β-chain CDR3 sequences for clonal expansion and diversity studies.

  Dataset EGAD50000001714

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• The dataset for "ctDNA residual disease analyses during perioperative nivolumab or nivolumab plus ipilimumab in resectable diffuse pleural mesothelioma”

  The dataset for the study “ctDNA residual disease analyses during perioperative nivolumab or nivolumab plus ipilimumab in resectable diffuse pleural mesothelioma” includes 169 bam files from whole genome sequencing on the Illumina NovaSeq6000 platform. The samples analyzed include tumor (n=28) and normal (n=28) DNA samples, and serial plasma cfDNA (n=113) samples from 28 individuals with resectable diffuse pleural mesothelioma, treated with nivolumab or nivolumab plus ipilimumab on the NCT03918252 trial.

  Dataset EGAD50000001701

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• De novo modeling of chromoplectic Ewing sarcoma tumors from patient-derived mesenchymal stem cells

  Ewing sarcoma is characterized by pathognomonic translocations fusing most frequently EWSR1 with FLI1 (EF1). In addition, Ewing sarcoma can also display alterations in STAG2, TP53 and CDKN2A (SPC). Starting from Ewing sarcoma derived human mesenchymal stem cells (MSCpat), we recapitulated this translocation and SPC alterations using a CRISPR/cas9 approach and generated a bona fide Ewing sarcoma model (EWIma1) displaying transcriptomic (RNA-seq) and epigenetic (ChIP-seq) hallmarks of EwS.

  Dataset EGAD50000001673

• Whole genome sequencing of UM with MSI

  Illumina platform sequencing of whole genome libraries prepared from paired tumour/normal samples from 1 case of melanoma uveal with MSI

  Dataset EGAD50000001337

• WGBS of melanoma patients

  This dataset contains WGBS of seven melanoma patients and one cultured primary melanocyte sample.

  Dataset EGAD50000001319

• WGBS of patients from six tumor types

  This dataset contains healthy and tumor samples from patients covering breast adenocarcinoma, colon adenocarcinoma, kidney renal clear cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma and pancreas adenocarcinoma.

  Dataset EGAD50000001318

• WGBS of stepwise-edited melanoma model

  This dataset contains WGBS of a stepwise-edited, human melanoma model including in vitro samples and corresponding xenografts.

  Dataset EGAD50000001317

• Targeted panel DNA sequencing of melanomas, nevi and melanocytic tumors

  This dataset was derived from 360 formalin-fixed paraffin-embedded (FFPE) samples distributed across (i) 118 primary melanomas, (ii) 132 nevi and (iii) 110 melanocytic tumors. Next generation sequencing (NGS) libraries were prepared following the FFPE DNA Archer VariantPlex Somatic Protocol for Illumina. Input DNA was determined by the PreSeq DNA QC assay, with 100 ng of DNA used for samples with high quality scores, 200 ng for low quality scores and 300 ng for samples with bad quality scores as defined by the PreSeq DNA QC assay. NGS libraries were quantified using the KAPA Library Quantification Kit for Illumina (KK4824) and sequencing performed on the Nextseq 500/2000 without custom primers using paired-end sequencing (151bp for Read 1 and Read 2) with index reads (8bp for Index Read 1 and Index Read 2). For each sample, resulting paired-end fastq files are available as part of this dataset. Prefix for each sample name is associated with the the type of sample: NAE: nevi samples. MEL: Melanoma samples. BL: melanocytic tumor.

  Dataset EGAD50000001297

• Tumor Profiler Project - OV scDNA data additional samples

  The dataset contains 10x Chromium single-cell DNA sequencing data from 6 samples from 5 different patients with ovarian cancer. 4 samples were collected from the tumor, and 2 samples from ascites. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format. This dataset contains additional samples from patients not classified as having high-grade serous adenocarcinoma.

  Dataset EGAD50000001294

• Tumor Profiler Project - OV scRNA data additional samples

  The dataset contains 10x Chromium single-cell transcriptomics data from 6 samples from 4 different patients with ovarian cancer. 3 samples were collected from the tumor, 3 samples from ascites. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format. This dataset contains additional samples from patients not classified as having high-grade serous adenocarcinoma.

  Dataset EGAD50000001293

• Sequencing data for filanesib-treated hepatoblastoma samples

  This dataset contains RNA sequencing data of two hepatoblastoma PDX cell models. Cells were either treated with KSP inhibitor filanesib or with DMSO (controls).

  Dataset EGAD50000001314

• Spatial transcriptomics reveals immune and tissue remodeling, highlighting diverse host responses across mycobacterial granuloma types

  Granulomas are the hallmark of Mycobacterium infections, forming structured immune environments that drive disease persistence. However, their spatial and functional organization remains unclear. Using spatial RNA sequencing on 33 patient explants, we try to reveal the detailed gene expression and cell composition landscape of granulomas.

  Dataset EGAD50000001462

• Fragmentomics profiling and quantification of plasma Epstein-Barr virus DNA enhance prediction of future nasopharyngeal carcinoma.

  This dataset included human plasma EBV DNA target-capture sequencing data. The capture probes were designed to cover the entire EBV genome and selected human autosomal regions. After enrichment, the products were sequenced on the NextSeq500 System (Illumina) and aligned to the EBV genome (AJ507799.2) and the human genome (hg19) in BAM format. A total of 558 cases were analyzed, including seven subjects who developed NPC in the second-round screening, 431 non-NPC subjects with first-round transiently positive EBV, and 120 non-NPC subjects with first-round persistently positive EBV.

  Dataset EGAD50000001449

• Whole-exome and RNA sequencing data from a uveal melanoma patient with multi-regional sampling

  This dataset includes whole-exome sequencing (WES) and RNA sequencing (RNA-seq) data from a uveal melanoma patient. Tumor samples were obtained from three distinct regions, each with matched RNA-seq and WES data. Additionally, WES data from the patient’s peripheral blood mononuclear cells (PBMCs) is provided as a germline reference.

  Dataset EGAD50000001422

• Multi-omics profiling identifies two epithelioid sarcoma molecular subtypes with distinct signaling and immune characteristics

  Bulk RNA Sequencing of 33 epithelioid sarcomas (EpS) and 3 extracranial extra-renal rhabdoid tumors (EERT) Whole-exome sequencing of 30 EpS and 3 EERT Single-cell RNA Sequencing of 8 EpS Visium Spatial Transcriptomics of 3 EpS

  Dataset EGAD50000001419

• SCANDARE TNBC transcriptomics data

  SCANDARE (NCT03017573) is a multicentric biobanking study, enrolling adult patients with newly diagnosed head and neck squamous cell carcinoma (HNSCC), triple negative breast cancer (TNBC), ovarian and cervical cancer. Tumor tissue and blood samples are collected at several time points during patient's journey, including at diagnosis, post-neoadjuvant chemotherapy in case of neoadjuvant treatment, at surgery, at recurrence and at disease progression following treatment initiated at recurrence. Since its launch in 2017 at Institut Curie, SCANDARE has enabled the longitudinal collection and preservation of samples for in-depth analyses. Here, we describe molecular alterations in 124 frozen samples (n=84 at baseline and n=40 paired at post-NAC surgery) from 91 TNBC patients using total RNAseq technology, with FASTQ files deposited in the dataset.

  Dataset EGAD50000001416

• Tumor Profiler Project - OV cell-free DNA data additional samples

  The dataset contains amplicon sequencing data from 7 samples from 7 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format. These samples are from patients not classified as having high-grade serous adenocarcinoma.

  Dataset EGAD50000001412

• Tumor Profiler Project - OV bulk transcriptomics data additional samples

  The dataset contains bulk transcriptomics data from 4 samples from 3 different patients with ovarian cancer. 3 samples were collected from the tumor, 1 sample from ascites. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format. These samples are from patients not classified as as having high-grade serous adenocarcinoma.

  Dataset EGAD50000001411

• PCR-Free Shallow Whole Genome Sequencing for Chromosomal Copy Number Detection

  Archival peripheral blood or bone marrow plasma samples from non small-cell lung cancer, B-cell lymphoma and acute myeloid leukemia patients, and healthy donors. Shallow whole genome sequencing of 100 Samples by two distinct library preparation methods (PCR = 45, PCR-Free = 55). sWGS done for Chromosomal CN detection.

  Dataset EGAD50000001404

• Spatial transcriptomic analysis of renal cell carcinoma

  Spatial transcriptomic analysis of two Japanese ELOC-mutated renal cell carcinoma

  Dataset EGAD50000001400

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• Targeted sequencing data of cfDNA, archival tissue, and WBC from 226 patients with mUC

  Targeted tissue (n=210), cfDNA (n=402), and WBC (n=245) Illumina sequencing of metastatic urothelial carcinoma patients. All cfDNA is collected in the metastatic setting, while archival tissue is from across the disease course. White blood cell (WBC) samples are used as patient matched germline samples. All files are in paired-end fastq format.

  Dataset EGAD50000001571

• Whole genome sequencing data of cfDNA and WBC from 5 patients with mUC

  Whole genome Illunima sequencing of cfDNA of 5 metastatic urothelial carcinoma patients. White blood cell (WBC) samples are used as patient matched germline samples (n=5). All files are in paired-end fastq format.

  Dataset EGAD50000001570

• Melanoma transcriptomic data from patients undergoing immunotherapy

  This dataset contains raw RNA sequencing data from melanoma patient tumor samples collected before and during immunotherapy. The data support investigation of treatment-related changes in tumor cell populations. Samples were analyzed as part of a study exploring cellular responses to immune-based therapies.

  Dataset EGAD50000001569

• Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant

  Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant. The Panel was designed using Agilent SureDesign on SureSelect XTHS Hybrid Capture Panel. Sequencing was done on Illumina NovaSeq 6000

  Dataset EGAD50000001548

• WGS Sequencing of Urothelial Carcinoma from Taiwan

  Normal and Tumor paired WGS sequencing of UC Tissues

  Dataset EGAD50000001547

• Datasets of RNA-seq of tumor samples from clear cell renal cell carcinoma patients included in the Translational Program of the NIVOREN GETUG-AFU-26 trial

  RNA-seq analyses were performed on tumor tissue samples of 115 advanced clear cell renal cell carcinoma patients who participated in the NIVOREN GETUG-AFU-26 trial. The samples were obtained prior to treatment initiation. RNA-seq was performed to evaluate previously published gene expression signatures. These included: the IMmotion T effector (CD8A, EOMES, PRF1, IFNG and CD274) and the IMmotion Myeloid (IL-6, CXCL1, CXCL2, CXCL3, CXCL8, and PTGS2) gene signatures represent gene expression patterns associated with T effector cells and myeloid cells, respectively, while JAVELIN Renal 101 Immuno (T-cell receptor signaling: CD3G, CD3E, CD8B, THEMIS, TRAT1, GRAP2, CD247; T-cell activation, proliferation, and differentiation: CD2, CD96, PRF1, CD6, IL7R, ITK, GPR18, EOMES, SIT1, NLRC3; Natural killer cell mediated cytotoxicity: D2, CD96, PRF1, CD244, KLRD1, SH2D1A; Chemokine: CCL5, XCL2; and Other immune response genes: CST7, GFI1, KCNA3, PSTPIP1) represents gene expression patterns associated with both innate and adaptive immune response.

  Dataset EGAD50000001541

• Clinical Outcomes for 344 Diffuse Large B-Cell Lymphoma Patients

  This dataset contains clinical outcomes for 344 Diffuse Large B-Cell Lymphoma patients. For each subject we have recorded AGE (binarized: > 60, <= 60), SEX (male or female), LDH (serum lactate dehydrogenase), ECOG (Performance status 3 or 4), STAGE (Disease stage III or IV according to the Ann Arbor staging system), EXBM (Two or more extranodal sites of disease (outside of a lymph node), BSYMP (Presence of B symptoms), and BM (Bone marrow involvement). All data are delivered as a single XLSX file with one row per patient.

  Dataset EGAD50000001536

• Visium CytAssist Spatial Gene Expression analysis for glioblastoma

  The glioblastoma spatial transcriptomics dataset was generated from 4 FFPE fixed adult glioblastoma samples, using the 10x Genomics Visium platform, producing raw FASTQ files, spatial feature matrices (.h5, .mtx, .tsv), and paired histology images (.tif). Spot-level transcript counts were aligned to tissue architecture and processed in Seurat, with results stored as .rds objects. Data visualization was performed using SpatialFeaturePlot, and quantitative analyses were supported by custom Matlab scripts. The dataset provides both raw and processed files, offering reproducible spatially resolved transcriptomic profiles of glioblastoma tissue sections

  Dataset EGAD50000001767

• SIA Subtyping RNA Sequencing

  Associated with Molecular classification of small intestinal adenocarcinomas. RNA sequencing generated 849 .fastq files from 137 primary and recurrent small intestine adenocarcinoma samples from 135 patients.

  Dataset EGAD50000001762

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing (part 2)

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38). This dataset contains the remaining file of this study.

  Dataset EGAD50000001757

• Targeted panel sequencing of two patient-derived melanoma cell lines

  Targeted panel sequencing was conducted on patient-derived cell lines: Mel-DCC-11 (the parental line, sensitive to the BRAF inhibitor) and Mel-DCC-11-R (resistant to the BRAF inhibitor). The parental cell line was generated from disseminated cancer cells (DCCs) obtained from a lymph node sample of a melanoma patient. The resistant cell line was generated from the parental one through exposure to Vemurafenib. Normal peripheral blood lymphocytes from the same patient served as the control for comparison. Sequencing on NovaSeq6000. Fastq files.

  Dataset EGAD50000001745

• Patient-derived organoids cohort raw FASTQ from SGMedical

  Raw FASTQ files for a glioblastoma multiforme organoid study, including exome sequencing and RNA-seq. 29 runs (paired-end), 58 FASTQ.c4gh files (R1/R2). Short-read Illumina; library strategies include exome capture and stranded total RNA-seq (see Experiment records for kit/instrument details). No processed results are included; access is controlled under the selected Policy.

  Dataset EGAD50000001741

• Shallow Whole Genome Sequencing (sWGS) of pancreatic ductal adenocarcinoma

  Associated with CNA differences between RNA-based subtypes of PDAC. Shallow Whole Genome Sequencing (sWGS) generated 47 .bam files from 37 patients. sWGS was used for Copy number aberrations (CNA) determination.

  Dataset EGAD50000001732

• WES dataset of a TIL-ACT metastatic melanoma cohort

  Whole-exome sequencing (WES) data from 13 patients with metastatic melanoma in a TIL-ACT cohort, generated to characterize tumor genomics and neoantigen landscapes relevant to adoptive T cell therapy.

  Dataset EGAD50000001731

• Five Mantle Cell Lymphoma Patients Before and After Failure of Standard Chemotherapy

  MCL cells were isolated from different tissues of five patients with MCL at diagnosis, and at the time of the first clinical relapse after failure of standard immunochemotherapy based on alternation of R(ituximab)-CHOP and R-high-dose-araC. All patients signed informed consent according to the Declaration of Helsinki. Four patients were diagnosed with classical nodal aggressive MCL, and all these patients experienced early relapse (i.e., progression of disease POD < 12 months). One patient was diagnosed with indolent non-nodal MCL and relapsed 9 years after initial MCL diagnosis. The dataset presents single cell RNA sequencing data as well as whole exome sequencing data for these five patients.

  Dataset EGAD50000001213

• Exome-sequencing on early oral squamous cell carcinoma with clear margins

  Whole exome sequencing (WES) on early oral squamous cell carcinoma (OSCC) with clear margins, and on resection margins, 86 patients with a median follow-up of 58 months (range 30.4-83 months). Raw data (fastq format).

  Dataset EGAD50000001209

• Single-cell RNA-sequencing on malignant and benign tissue samples

  Single-cell RNA-sequencing on malignant and benign tissue samples from untreated donors with colorectal adenocarcinoma and liver metastasis was performed in order to deduce tissue adaptive expression patterns of the disease. Matching tissue from five donors with untreated CRC and liver metastasis were sampled.

  Dataset EGAD50000001203

• Whole Exome Sequencing of paired gDNAs and PPGL tumor DNA from patients with cyanotic congenital heart disease

  Fastq files from Whole Exome Sequencing of 12 paired germline DNA (from blood/saliva) and 14 PPGL tumor DNA (from formalin-fixed paraffin-embedded (FFPE) blocks from surgery) from patients with cyanotic congenital heart disease (CCHD) and pheochromocytoma and paraganglioma (PPGL). Sequencing was performed using the Illumina HiSeq4000.

  Dataset EGAD50000001201

• Single-Cell and Bulk RNA Sequencing of Oncolytic Measles Virus Treatment in Pediatric Medulloblastoma and ATRT

  This dataset includes single-cell RNA sequencing profiles from five mice bearing Group 3 medulloblastoma (CSCG) treated with oncolytic measles virus (MV-NIS) and three mice treated with MV-NIS combined with anti-PD1 therapy. Additionally, bulk RNA sequencing data were generated from 12 samples across PBS control, heat-inactivated (HI) control, MV mid-treatment, and treatment resistance conditions. Pediatric patient data were collected from the PNOC005 trial, which enrolled patients into three strata: Stratum A (focal recurrence, local MV-NIS administration post-surgical resection), Stratum B (disseminated recurrence, single MV-NIS dose via lumbar puncture), and Stratum C (disseminated recurrence, two consecutive MV-NIS doses via lumbar puncture on Day 0 and Day 7). Whole blood and PBMC samples were collected from 17 patients across all strata, generating 72 bulk RNA-seq datasets at multiple time points. All datasets are provided as raw sequencing data in FASTQ format.

  Dataset EGAD50000001197

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• Shallow dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. shallow Whole Genome Sequencing (sWGS) of 63 samples. sWGS was done to analyze copy number aberration.

  Dataset EGAD50000001165

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Refractory Classic Hodgkins Lymphoma (cHL) sWGS

  Associated with the study: Blood-based Monitoring of Relapsed/Refractory Hodgkin Lymphoma Patients Predict Responses to Anti-PD-1 Treatment. 26 ctDNA Samples from 4 patients followed longitudinally. sWGS performed for copy number aberration (CNA) analysis.

  Dataset EGAD50000001163

• nEODURVARIB clinical trial. Exome sequencing in advanced urothelial carcinoma

  Exome sequencing (BAM and VCF files) in advanced urothelial carcinoma in diagnostic and pos-ttreatment samples

  Dataset EGAD50000001162

• mUM patient biopsies bulk RNAseq

  Tumour biopsies were obtained from uveal melanoma patients (n = 35) pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system

  Dataset EGAD50000001225

• Bulk RNA-sequencing data of advanced hepatocellular carcinoma (HCC) patients treated with atezolizumab plus bevacizumab.

  The dataset includes FASTq files and normalised gene expression counts from bulk RNA-sequencing of pre-treatment tumour (n=39) and adjacent non-tumour tissue samples (n=13) from advanced hepatocellular carcinoma (HCC) patients treated with atezolizumab plus bevacizumab. Specifically, RNA was extracted from the FFPE tumour tissue using RNeasy Plus Mini Kit (Qiagen), according to the manufacturer’s instructions. RNA quality and quantity were evaluated using Agilent RNA 600 Pico Chips (Agilent Technologies). Sequencing libraries were prepared using the SMARTer Stranded Total RNA-seq kit v3 (Takara Bio). Sequencing was performed on an Illumina NovaSeq 6000 system. After obtaining the Fastq files, read 2 UMIs and adapters were trimmed using seqtk (v1.2), reads were aligned using STAR (v2.7.7a) to the human reference genome (GRCh38) and quantified with HTSeq (v2.0.2).

  Dataset EGAD50000001227

• WES PTCL Data

  Whole Exome Sequencing (WES) of 153 FFPE DNA samples of Peripheral T-Cell Lymphoma. Associated with "Molecular biomarkers for stratification periheral T cell lymphoma" study.

  Dataset EGAD50000001250

• Low-coverage Single-cell Whole Genome Sequencing Data from Paired Meningioma Samples

  This dataset comprises low-coverage (~0.5X) whole genome sequencing data from 179 single cells isolated from paired meningioma samples (88 cells from initial grade II and 91 cells from recurrent grade III tumor from the same patient). The single-cell libraries were constructed using Primary Template Amplification and ResolveDNA protocol, with libraries subsequently sequenced on NextSeq 1000 using 2x150bp paired-end reads targeting 8M reads per cell. This dataset includes the sequencing data in Fastq format.

  Dataset EGAD50000001254

• mUM patient biopsies pre and post treatment with tebentafusp

  The dataset includes 141 RNA-seq samples form mUM patietns. Tumour biopsies were obtained from uveal melanoma patients pre and post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dataset EGAD50000001258

• Paired FastQ files from deep targeted DNA sequencing

  This dataset comprises paired-end and time-matched FastQ files from 356 cell-free DNA samples and 356 white blood cell DNA samples, derived from 299 patients with metastatic renal cell carcinoma or urothelial carcinoma. A baseline sample was available for all patients. Sequencing was performed using Illumina technology.

  Dataset EGAD50000001267

• RNA-sequencing from ALL patients treated on the Australasian Leukaemia and Lymphoma Group (ALLG) ALL06 study.

  Dataset contains RNA-sequencing data (fastq files) from 45 patients treated on the the Australasian Leukaemia and Lymphoma Group (ALLG) ALL06 study, an MRD-stratified Paediatric Protocol. Patient samples (bone marrow or peripheral blood) were taken at diagnosis. mRNA was extracted from blast cells and underwent paired-end sequencing (75bp) using the illumina NextSeq platform. Genomic data was used for identification of genomic drivers of acute lymphoblastic leukaemia (ALL).

  Dataset EGAD50000001111

• Dataset for scRNA glioblastoma samples

  This dataset contains 5 scRNA samples of human glioblastoma samples, human cortical spheroid derived from hiPSC line 028-4 and 3 samples of mouse xenografts. Sequencing has been performed on Illumina NovaSeq 6000. Sequencing has always been paired.

  Dataset EGAD50000001117

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• High-grade serous ovarian carcinoma tumour whole genome sequencing variants

  Tumour somatic variants (in VCF format) called from paired tumour-germline whole genome sequencing (using IDT library preparation system followed by sequencing on Illumina NovaSeq platform) of three high-grade serous ovarian tumour samples. The dataset comprises three VCF variant files.

  Dataset EGAD50000001131

• High-grade serous ovarian carcinoma tumour exome sequencing variants

  Tumour variants (in VCF format) from exome sequencing (using Agilent SureSelect and TWIST library preparation systems followed by sequencing on Illumina HiSeq and NovaSeq platforms) of 108 high-grade serous ovarian tumour samples. Germline variants from EGAD00001006030 for these individuals were used to call somatic and tumour-only variants separately, creating two VCF files per sample (except for one sample without paired germline data- somatic variant file only provided). The dataset comprises 215 VCF variant files.

  Dataset EGAD50000001132

• Whole Exome Sequencing Data of 34 indolent primary renal B-Cell lymphoma cases

  Here, 34 iNHL samples were sequenced using whole exome sequencing to describe the mutational landscape of indolent primary renal B-Cell lymphomas. Mutational profiles were compared to other Marginal Zone Lymphomas.

  Dataset EGAD50000001136

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• Transcriptome - Uveal Melanomas MPI

  Total RNA sequencing on 4 uveal melanoma samples. Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001138

• scRNA-seq of human follicular lymphoma and lymph node

  Cryopreserved cells from human nodal follicular lymphoma and lymph node samples were thawed and processed for scRNA-seq analysis. CD3+ CD19− 7-AAD− live T cells (six FL samples from the Original cohort) or 7-AAD− whole live hematopoietic cells (five lymph node and nine FL samples from Validation cohort 1) were sorted using a FACS Aria II or III instrument (BD Biosciences). To generate single-cell emulsions, 6,000–10,000 live cells were loaded into the 10X Genomics Chromium Controller for single-cell partitioning, along with the reverse transcriptase reagent mixture and 3' or 5' gel beads. Sorted T or whole hematopoietic cells were converted to barcoded scRNA-seq libraries using 10X Genomics Chromium single cell 3' reagent kits (v3) for the Validation cohort 1, 5' reagent kits (v1) for the Original cohort, according to the manufacturer’s instructions. The libraries were sequenced on an Illumina HiSeq X Ten or NovaSeq X Plus system, mapped to the human genome (build GRCh38), and demultiplexed using CellRanger pipelines (v3.1.0, 10x Genomics).

  Dataset EGAD50000001143

• Peripheral T cell lymphoma (PTCL) Shallow Whole Genome Sequencing

  Shallow Whole Genome Sequencing (sWGS) of 148 FFPE DNA samples from peripheral T cell lymphoma (PTCL) samples. Assoicated with the "Molecular biomarkers for stratification peripheral T cell lymphoma" study.

  Dataset EGAD50000001146

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• scRNA seq and scTCR seq data from 5 melanoma patients

  The Chromium Controller and Chromium X platfor of 10X Genomics were used for single cell partitioning and barcoding. Each cell's transcriptome was barcoded during reverse transcription, pooled cDNA was amplified and Single Cell 5' Gene Expression (GEX), V(D)J and Feature Barcode (FB) Libraries were prepared according to the manufacturer's protocols (CG000330 and CG000331, 10X Genomics). All libraries were quantified and normalized on library QC data generated on the Bioanalyzer system according to manufacturer's protocols (G2938-90321 and G2938-90024, Agilent Technologies). Based on the expected target cell counts, a balanced library sub-pool of samples was compsed for SC5'GEX, V(D)J and FB libraries. Library sub-pools were quantified by qPCR, accodring to the KAPA Library Quantification Kit Illumina(R) Platforms protocol (KR0405, KAPA Biosystems). Based on qPCR results a final sequencing pool was composed. Paired end sequencing was performed on a NovaSeq 6000 Instrument (Illumina) using NovaSeq 6000 Reagent Kits v1.5 100 cycles (cat. no. 20028401, 20028319, 20028316 Illumina), using 28 cycles for Read 1, 10 cycles for Read i7, 10 cycles for Read i5 and 90 cycles for Read 2.

  Dataset EGAD50000001155

• RNAseq of Thymic epithelial tumors and paired normals

  Between November 2010 and May 2014, 20 cases—17 thymomas and 3 thymic carcinomas (including 2 squamous and 1 neuroendocrine carcinoma)—were newly sequenced from surgically removed TETs at Seoul National University Hospital, with written informed consent. Tumors and normal tissues were carefully separated and immediately preserved in liquid nitrogen after resection. DNA and RNA were extracted from the tumors, adjacent normal tissues, and/or blood samples. Libraries for RNA-seq were prepared using the TruSeq Stranded mRNA LT Sample Prep Kit following standard Illumina protocols.

  Dataset EGAD50000001158

• WES of thymic epithelial tumors and paired normals

  Between November 2010 and May 2014, 20 cases—17 thymomas and 3 thymic carcinomas (including 2 squamous and 1 neuroendocrine carcinoma)—were newly sequenced from surgically removed TETs at Seoul National University Hospital, with written informed consent. Tumors and normal tissues were carefully separated and immediately preserved in liquid nitrogen after resection. DNA and RNA were extracted from the tumors, adjacent normal tissues, and/or blood samples. Libraries for WES were prepared using the SureSelect XT (Human All Exon + UTR v5) Library Prep Kit following standard Illumina protocols.

  Dataset EGAD50000001159

• Shallow Whole Genome Sequencing (sWGS) from REPEAT trial

  Samples associated to: "A phase Ib/II study of regorafenib and paclitaxel in patients with beyond first-line advanced esophagogastric carcinoma (REPEAT)". sWGS from 97 Esophagogastric Carcinoma samples. sWGS was done to carry out Copy Number Analysis. Dataset includes: .fastq, .bam and .bai files.

  Dataset EGAD50000001161

• WGS of single CTCs from 4 patients with metastatic cancer

  This dataset contains 352 paired fastq files sequenced by illumina Novoseq6000. Single-cell low-pass WGS analysis (illumina platform, PE150, 1-2x coverage) was performed on CTCs enriched using high-throughout microfluidic device from entire leukopak from patients with metastatic prostate cancer (GU-1 and GU-2) and metastatic hepatocellular carcinoma (HCC-1 and HCC-2). Patient matched white blood cells (WBC) served as internal controls.

  Dataset EGAD50000001006

• Distinct immune cell infiltration patterns in pancreatic ductal adenocarcinoma (PDAC) exhibit divergent immune cell selection and immunosuppressive mechanisms

  To elucidate the heterogeneity of tumour immune cell infiltration, we performed single cell RNAseq sequencing on CD45+ cells enriched from matched fresh tumour tissue following surgical resection of 12 treatment-naïve patients and matched PBMCs.

  Dataset EGAD50000001008

• RNA-seq of chordoma samples

  This dataset contains paired-end bulk RNA-seq data of advanced chordoma samples from 7 patients. Sequencing was performed on Illumina HiSeq 4000 or NovaSeq 6000.

  Dataset EGAD50000001019

• fragmentomic features of individuals with different cfDNA concentrations

  The uploaded data includes sequencing data of 862 individuals from the nasopharyngeal carcinoma (NPC) screening study. Samples from this cohort were sequenced using targeted sequencing methods for the Epstein Barr Virus (EBV) and selected autosomal DNA, but only ‘off-target’ reads were used for fragmentomic analyses. We have also performed genome-wide (non-targeted sequencing) for 1) Individuals with the highest and lowest cell-free DNA concentration (40 individuals); 2) A subsequent collection of the subjects with the highest and lowest DNA concentrations after six years (26 individuals); 3) 30 cases of pregnancy and 4) 20 patients with hepatocellular carcinoma. All sequencing data are of extracted plasma cfDNA from human subjects. The targeted sequencing samples from 862 individuals were sequenced on the NextSeq500 System (Illumina) and aligned to the EBV genome (AJ507799.2) and the human genome (hg19). The alignments were provided in bam format. The original fastq files of the remaining non-target sequencing samples were provided.

  Dataset EGAD50000000970

• Dataset with fibroblast samples from LFS patients

  This dataset contains paired-end 10x scRNAseq, 10x ATACseq and bulk WGS data of fibroblast samples from LFS patients and patient-derived xenograft samples of medulloblastoma. Sequencing was performed on Illumina NovaSeq 6000.

  Dataset EGAD50000000969

• RNA-seq from Glioblastoma treated with Indisulam

  The dataset includes RNA-sequencing results from four patient-derived glioblastoma cell lines treated with DMSO (vehicle control) or the splicing modulating-drug indisulam (at 6 and 16 hours), resulting in 12 RNA-seq samples. Paired-end sequencing produced 24 FASTQ.gz files. The RNA libraries were prepared using PolyA selection and ERCC spike-ins and sequenced on a NovaSeq platform. This dataset supports the analysis of drug-induced transcriptomic changes and the prediction of subsequent non-canonical tumor-specific antigens (ncTSAs) using the NovumRNA pipeline.

  Dataset EGAD50000000957

• Shallow whole genome sequencing data from circulating tumour DNA (ctDNA) data of High Grade Serous Ovarian Cancer Patients (batch 1)

  The dataset contains shallow whole genome sequencing data of 128 high-grade serous carcinoma (HGSC) patients sequenced with Novoseq 6000. The 128 samples are plasma samples that have been collected before treatment. The files provided are paired fastq files.

  Dataset EGAD50000000949

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• WES and RNA-seq of pre-invasive lung adenocarcinoma

  The prevalence of lung adenocarcinoma (LUAD) has increased sharply in East Asia. Early diagnosis leads to better survival rates, but this requires an improved understanding of the molecular changes during early tumorigenesis, particularly in non-smokers. We performed whole exome-sequencing and RNA-sequencing of samples from 94 East Asian patients with precancerous lesions (25 with atypical adenomatous hyperplasia [AAH]; 69 with adenocarcinoma in situ [AIS]) and 73 patients with early invasive lesions (minimally invasive adenocarcinoma [MIA]). This datasets contains the sequencing raw data (FASTQ format).

  Dataset EGAD50000000637

• WES of precancerous lesions from 10 lynch patients and 3 sporadics

  Raw sequencing data of WES that were obtained from precancerous samples as adenoma and MMR-deficient crypts and paired healthy tissue from MSI CRC patients of which 10 are diagnosed with lynch syndrome and 3 had sporadic cancer. These data were analyzed in order to evaluate microsatellite instability though tumorigenesis and associated to splicing deregulation in MSI tumors RNA.

  Dataset EGAD50000000644

• GBM Study Complete Raw Data

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside total RNA from the tumors.

  Dataset EGAD50000000650

• HCC cfMeDIP-seq

  This dataset comprises 406 raw fastq files derived from 203 plasma cfDNA samples from 90 patients diagnosed with hepatocellular carcinoma (HCC). The samples include 90 baseline HCC (b-HCC) samples, collected during liver transplant or resection surgeries, and 113 postoperative follow-up (f-HCC) samples. For each sample, 10ng of cfDNA was used for library preparation utilizing cfMeDIP-seq technology based on the 5mC antibody-immunoprecipitation strategy. Libraries were validated via Bioanalyzer trace analysis and sequenced on Illumina NovaSeq 6000 or HiSeq 2500 platform with paired-end 150-bp (NovaSeq) or 125-bp (HiSeq) model for ~100 million reads per sample.

  Dataset EGAD50000000651

• Dataset for Multiple Myeloma WGS data, part 2

  This dataset contains 518 case and control WGS sequencing samples of patients with multiple myeloma. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X using TruSeq Nano DNA Kits. The sequencing was always paired.

  Dataset EGAD50000000681

• Dataset for Multiple Myeloma WGS samples

  This dataset contains 221 case and control WGS sequencing samples of patients with multiple myeloma. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X using TruSeq Nano DNA Kits. The sequencing was always paired.

  Dataset EGAD50000000682

• Dataset for Multiple Myeloma RNA data

  This dataset contains 371 case and control RNA sequencing samples of patients with multiple myeloma. Sequencing was performed on Illumina NovaSeq 6000 and HiSeq X, HiSeq 4000 and HiSeq 2000 using TruSeq Stranded RNA and TruSeq Stranded total mRNA Kits. The sequencing was always paired.

  Dataset EGAD50000000683

• Dataset for RNA sequencing glioblastoma data

  This dataset contains RNA sequencing data of 36 glioblastoma samples. Sequencing was performed on Illumina NovaSeq 6000 using TruSeq Stranded RNA Kit. The sequencing was always paired.

  Dataset EGAD50000000688

• Whole genome sequencing data of high-grade serous ovarian cancer samples (set 15)

  The dataset contains whole genome sequencing data of 8 high-grade serous carcinoma (HGSC) patients sequenced with Novoseq 6000. The 16 samples are either fresh frozen tumour samples or blood samples. The files provided are paired fastq files.

  Dataset EGAD50000000526

• Human skin cancer (BCC, SCC, melanoma) and healthy control skin

  Smart-seq2 single cell RNA sequencing of human BCC, SCC, melanoma (ALM) and healthy control skin samples.

  Dataset EGAD50000000540

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma cases. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dataset EGAD50000000546

• SDR-seq_06_BCL

  SDR-seq_BCL data access. Two follicular lymphoma (FL) primary patient samples and one germinal center subtype diffuse large B-cell lymphoma (GCB) primary patient sample. FL1 and GCB1 are sequenced in Run1. FL2 is sequenced in Run2.

  Dataset EGAD50000000551

• Whole exome sequencing of Ewing sarcoma and CIC-DUX4 sarcoma

  Whole exome sequencing of a collection of 6 Ewing sarcoma and 3 CIC-DUX4 sarcoma tumoroids plus 4 matched patient tumors and normal tissue. Tumoroids were established from digested patient tumor material as 3D culture in Matrigel. After 2-3 month of growth, Genomic DNA was isolated from individual tumoroid models using the DNeasy Blood & Tissue Kit (Qiagen) and used for whole exome sequencing. Genomic DNA from corresponding patient tumors and matched normal tissue was tested in parallel, if available.

  Dataset EGAD50000000556

• RNA sequencing of Ewing sarcoma and CIC-DUX4 sarcoma

  RNA sequencing of a collection of 6 Ewing sarcoma and 3 CIC-DUX4 sarcoma tumoroids plus 3 matched patient tumors. Tumoroids were established from digested patient tumor material as 3D culture in Matrigel. After 2-3 month of growth, RNA was isolated from individual tumoroid models using the RNeasy Kit (Qiagen) and used for whole exome sequencing. RNA from corresponding patient tumors was tested in parallel, if available.

  Dataset EGAD50000000557

• CATNON: IDH-mutant astroctyoma RNA FASTQ

  Raw fastq files obtained by RNA sequencing 138 IDH-mutant astrocytomas included in the CATNON trial. RNA was extracted from formalin-fixed paraffin-embedded (FFPE) tissue blocks using the RNeasy FFPE kit. RNA sequencing was performed on an Illumina NovaSeq 6000 (GenomeScan BV, Leiden, The Netherlands) with 150bp paired-end reads including UMI tags.

  Dataset EGAD50000000558

• CAYA glioma sequencing data

  Low pass WGS and targeted glioma panel sequencing of low and high-grade gliomas in children, adolescent, and young adult patients.. File type is paired-read fastq files (2 per sample). Sequencing was performed on Illumina NextSex instruments. Genes covered on panel: TP53, H3F3A, HIST1H3B, HIST1H3C, IDH1, IDH2, KRAS, PIK3CA, TERT promoter, PTPN11, FGFR1/2/3, MYB, BRAF, MYBL1, EGFR, PDGFRA, MYCN, MYC, CDKN2A.

  Dataset EGAD50000000560

• mRNA-Sequencing of 73 primary multiple myeloma (MM) samples and human MM cell lines

  mRNA-Sequencing of 73 primary multiple myeloma (MM) samples and human MM cell lines before and after siRNA-mediated knockdown of ADAM8 (n=5 cell lines), ADAM9 (n=7 cell lines) and ADAM15 (n=5 cell lines). Paired-end sequencing was performed on a NovaSeq (Illumina). Fastq and bam files are provided for each sample.

  Dataset EGAD50000000575

• RCRF release 2

  RNA sequencing of a Chromophobe renal cell carcinoma, Non-clear cell chromophobe renal cell carcinoma, Neuroendocrine PDAC and clear cell sarcoma

  Dataset EGAD50000000872