5246 results for "*oma"

in 32.90 milliseconds.

• Bulk RNAseq FASTQ files of three PDAC organoid lines treated with LGK974 or DMSO for 24h

  This dataset contains raw FASTQ files from bulk RNA sequencing of three patient-derived pancreatic ductal adenocarcinoma (PDAC) organoid lines (P28, P40, P47). Each organoid line was treated with either the WNT secretion inhibitor LGK974 or DMSO for 24 hours, with three biological replicates per treatment condition. RNA was extracted using the Qiagen QiaSymphony SP system, and libraries were prepared with the Illumina Truseq stranded polyA kit. Sequencing was performed on an Illumina NextSeq2000 platform using single-end 50bp reads. Quality control was conducted with FastQC, and reads were trimmed with TrimGalore as appropriate. Data are controlled-access and intended for transcriptomic analysis of WNT pathway perturbation in PDAC organoid models.

  Dataset EGAD50000002219

• WES data for HGSC patient-derived organoids (Kallunki)

  The dataset contains whole exome sequencing (WES) data of organoids from 10 high-grade serous carcinoma (HGSC) patients. The 31 samples are sequenced with Novaseq6000. The files provided are paired fastq files.

  Dataset EGAD50000002216

• cell-free Methylated DNA by Immunoprecipitation and Sequencing (cfMeDIP) of human meningioma samples.

  Raw data for cell-free Methylated DNA by Immunoprecipitation and Sequencing (cfMeDIP) of human meningioma samples.

  Dataset EGAD50000002214

• Transcriptomics for IMMU-SCCHN1 cohort

  The goal of IMMUcan is to understand how the immune system interacts with tumors and how therapeutic interventions influence this interaction. This cohort includes patients with confirmed locally recurrent and/or metastatic squamous cell carcinoma of the head and neck (SCCHN) who receive first-line treatment with immune checkpoint inhibitors (ICI) or ICI combined with chemotherapy. This dataset contains transcriptomics data processed with the STAR pipeline. Two sequencing kits were employed: Roche KAPA for high-quality RNA samples and Takara SMART-Seq Stranded for samples with limited RNA quantities.

  Dataset EGAD50000002206

• Variant calling for IMMU-SCCHN1 cohort

  The goal of IMMUcan is to understand how the immune system interacts with tumors and how therapeutic interventions influence this interaction. This cohort includes patients with confirmed locally recurrent and/or metastatic squamous cell carcinoma of the head and neck (SCCHN) who receive first-line treatment with immune checkpoint inhibitors (ICI) or ICI combined with chemotherapy. This dataset contains whole exome sequencing data from tumor and matching germline samples processed with the Vegan pipeline. It includes SNP and CNV calling.

  Dataset EGAD50000002205

• scRNAseq of fresh CRC punch biopsies

  The dataset includes single-cell RNAseq data generated by Plate-Seq technology from scDiscoveries. The dataset contains samples from a total of 5 different early CRC biobank patients (pt5, pt11, pt13, pt14, pt16) from 4 different sequencing runs. Punch biopsies of different regions of the tumor (Core, Invasive front and, if available, Adenoma) were FACS sorted onto plates prior to sequencing.

  Dataset EGAD50000002203

• RNAseq of organoid and fibroblast co-cultures

  The dataset includes whole transcriptome RNAseq BAM files of both organoids and fibroblast mono- and co-cultures with have been processed by Picard markdups. The experiment featured 6 fibroblast cell lines derived from 5 different early CRC biobank patients (pt10, pt12, pt15, pt19, pt22) as well as from different regions within those samples (normal tissue, core or invasive front). The organoids were generated from patient pt5 carcinoma samples.

  Dataset EGAD50000002202

• Neuroblastoma cell-lines and healthy cfDNA used for the benchmarking study

  This dataset comprises nine neuroblastoma cell lines used to construct the reference matrix for the RRBS-CL dataset in the corresponding benchmarking study. In addition, it includes one extra neuroblastoma cell line and a pooled cfDNA sample from multiple donors, which were used to generate the in silico mixtures. All the samples were profiled using DNA methylation sequencing.

  Dataset EGAD50000002199

• STimage: Robust and interpretable prediction of gene markers and cell types from spatial transcriptomics data

  This dataset comprises raw sequencing data (FASTQ files) derived from 13 Formalin-Fixed Paraffin-Embedded (FFPE) melanoma tissue samples profiled using the 10x Genomics Visium platform. These spatially resolved transcriptomic profiles serve as the primary dataset for the STimage study, enabling the development and benchmarking of deep learning models that predict gene expression directly from H&E histology images.

  Dataset EGAD50000002172

• RNA-seq after drug perturbation of primary lymphoma samples

  3'-end low-depth RNA sequencing data from 108 patients with chronic lymphocytic leukemia and 8 patients with lymphoma. Each primary patient sample was treated in vitro with DMSO as a control and with up to ten small-molecule inhibitors (ibrutinib, duvelisib, everolimus, trametinib, nutlin-3a, I-BET762, MK2206, selinexor, compound 26, and a combination of ibrutinib and compound 26). Sequencing was performed on the Illumina HiSeq4000. The dataset contains FASTQ files.

  Dataset EGAD50000002166

• WES sequencing data from 8 classical Hodgkin Lymphoma tumors and 8 corresponding normal samples

  To delineate the mutational landscape of classical Hodgkin Lymphoma Whole Exome sequencing (WES) was performed on HRS cells isolated from classical Hodgkin Lymphoma tumors and corresponding normal samples (n=8)

  Dataset EGAD50000002164

• Targeted capture sequencing data from 107 classical Hodgkin Lymphoma tumors and 25 corresponding normal samples.

  To delineate the mutational landscape of classical Hodgkin Lymphoma targeted sequencing using a capture panel ("medistinal lymphoma panel") targeting 217 genes was performed on HRS cells isolated from classical Hodgkin Lymphoma tumors (n=107) and corresponding normal samples (n=25)

  Dataset EGAD50000002163

• RNA-seq from B-ALL patients treated on the ALLG ALL09 study

  Dataset contains RNA-sequencing data (fastq files) from 46 patients treated on the Australasian Leukaemia and Lymphoma Group (ALLG) ALL09 study (ACTRN12618001734257). All patients were diagnosed with CD19 positive B-cell acute lymphoblastic leukaemia and were negative for Philadelphia chromosome positive disease. Patient samples (bone marrow or peripheral blood) were taken at diagnosis. mRNA was extracted from lymphoblasts and underwent paired-end sequencing using either the illumina NextSeq (75 bp PE) or MGI DNABSEQ-G400 (100bp PE) platforms. Transcriptomic data was used for identification of genomic drivers of acute lymphoblastic leukaemia (ALL).

  Dataset EGAD50000001603

• Whole-genome sequencing data of poorly differentiated thyroid carcinomas and matched blood from six patients

  This dataset contains raw sequencing reads in FASTQ format from 12 samples, comprising paired tumour and matched blood DNA from six patients diagnosed with poorly differentiated thyroid carcinoma (PDTC). Genomic DNA was extracted from fresh-frozen tumour tissue and peripheral blood using standard protocols. Whole-genome sequencing was performed on the Illumina HiSeq X Ten platform, generating paired-end reads at an average depth of approximately 20X. These data support investigations into the somatic mutational landscape and genomic alterations associated with PDTC.

  Dataset EGAD50000001628

• scRNAseq dataset of myeloid cells from secondary lymphoid organs from lymphoma patients and controls

  This dataset contains fastq files from scRNAseq dataset of myeloid cells from secondary lymphoid organs (lymph nodes and tonsil) from lymphoma patients (3 FL and 3 DLBCL) and controls (3 reactive tonsils and 3 reactive lymph nodes). For HTO libraries, demultiplexing barcodes are available in samples descriptions.

  Dataset EGAD50000001629

• Survival and safety of laser interstitial thermal therapy and adjuvant pembrolizumab in recurrent high-grade astrocytoma: a Phase 1/randomized Phase 2b trial

  This dataset is the immune profiling of the trial patients. Cryopreserved PBMCs obtained from the patients at different time points were processed to single-cell transcriptomic or TCR libraries using 10x next GEM single Cell 5' v2 kit. We also performed whole exome sequencing (WES) of the tumor to identify the mutation burden. The WES data was generated by sequencing company Novogene. There are total of 69 of single cell libraires, 69 of single cell TCR libraries, and 13 of tumor WES data being generated from 18 trial patients recruited at University of Florida.

  Dataset EGAD50000001639

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• WGS dataset for Multimodal antigenic escape to GPRC5D-targeted T-cell engagers in multiple myeloma

  We analyzed the genome of plasma cells collected from bone marrow samples or plasmocytoma from patients prior to (when available) and progression on anti-GPRC5D T cell engagers. Dataset includes tumor and matched normal WGS data aligned to GRCh38.p14 in bam format, as well as tumor small variant and CNV calls.

  Dataset EGAD50000001643

• Sequenced IDH wildtype, untreated, human glioblastoma samples (GB-UK cohort)

  BAM files for 42 IDH wildtype, untreated, human glioblastoma samples from the GB-UK cohort, published in Noorani & Haughey et al. Cancer Discovery (2025).

  Dataset EGAD50000001649

• SCANDARE HNSCC DNA targeted panel sequencing

  SCANDARE (NCT03017573) is a multicentric biobanking study, enrolling adult patients with newly diagnosed head and neck squamous cell carcinoma (HNSCC), triple negative breast cancer (TNBC), ovarian and cervical cancer. Tumor tissue and blood samples are collected at several time points during patient's journey, including at diagnosis, post-neoadjuvant chemotherapy in case of neoadjuvant treatment, at surgery, at recurrence and at disease progression following treatment initiated at recurrence. Since its launch in 2017 at Institut Curie, SCANDARE has enabled the longitudinal collection and preservation of samples for in-depth analyses. Here, we describe molecular alterations in 232 FFPE samples at baseline from 83 HNSCC patients using DNA targeted panel sequencing, with FASTQ files deposited in the dataset.

  Dataset EGAD50000001654

• SCANDARE HNSCC 3' Tag RNA-seq

  SCANDARE (NCT03017573) is a multicentric biobanking study, enrolling adult patients with newly diagnosed head and neck squamous cell carcinoma (HNSCC), triple negative breast cancer (TNBC), ovarian and cervical cancer. Tumor tissue and blood samples are collected at several time points during patient's journey, including at diagnosis, post-neoadjuvant chemotherapy in case of neoadjuvant treatment, at surgery, at recurrence and at disease progression following treatment initiated at recurrence. Since its launch in 2017 at Institut Curie, SCANDARE has enabled the longitudinal collection and preservation of samples for in-depth analyses. Here, we describe molecular alterations in 264 FFPE samples at baseline from 90 HNSCC patients using 3'-tag RNA-seq technology, with FASTQ files deposited in the dataset.

  Dataset EGAD50000001655

• SCANDARE ovarian WES data

  SCANDARE (NCT03017573) is a multicentric biobanking study, enrolling adult patients with newly diagnosed head and neck squamous cell carcinoma (HNSCC), triple negative breast cancer (TNBC), ovarian and cervical cancer. Tumor tissue and blood samples are collected at several time points during patient's journey, including at diagnosis, post-neoadjuvant chemotherapy in case of neoadjuvant treatment, at surgery, at recurrence and at disease progression following treatment initiated at recurrence. Since its launch in 2017 at Institut Curie, SCANDARE has enabled the longitudinal collection and preservation of samples for in-depth analyses. Here, we describe molecular alterations in 91 frozen samples (n = 53 at baseline, n = 31 Post-NAC, n= 7 Recurrence, and n = 62 germline DNA) from 64 ovarian cancer patients using WES technology, with FASTQ files deposited in the dataset.

  Dataset EGAD50000001658

• SCANDARE TNBC WES data

  SCANDARE (NCT03017573) is a multicentric biobanking study, enrolling adult patients with newly diagnosed head and neck squamous cell carcinoma (HNSCC), triple negative breast cancer (TNBC), ovarian and cervical cancer. Tumor tissue and blood samples are collected at several time points during patient's journey, including at diagnosis, post-neoadjuvant chemotherapy in case of neoadjuvant treatment, at surgery, at recurrence and at disease progression following treatment initiated at recurrence. Since its launch in 2017 at Institut Curie, SCANDARE has enabled the longitudinal collection and preservation of samples for in-depth analyses. Here, we describe molecular alterations in 247 frozen samples at baseline and 138 germline DNA from 139 TNBC patients using WES technology, with FASTQ files deposited in the dataset.

  Dataset EGAD50000001661

• SCANDARE TNBC WGS data

  SCANDARE (NCT03017573) is a multicentric biobanking study, enrolling adult patients with newly diagnosed head and neck squamous cell carcinoma (HNSCC), triple negative breast cancer (TNBC), ovarian and cervical cancer. Tumor tissue and blood samples are collected at several time points during patient's journey, including at diagnosis, post-neoadjuvant chemotherapy in case of neoadjuvant treatment, at surgery, at recurrence and at disease progression following treatment initiated at recurrence. Since its launch in 2017 at Institut Curie, SCANDARE has enabled the longitudinal collection and preservation of samples for in-depth analyses. Here, we describe molecular alterations in 108 FFPE samples at baseline and 108 germline DNA from 108 TNBC patients using WGS technology, with FASTQ files deposited in the dataset.

  Dataset EGAD50000001662

• RNA-Seq dataset for malignant pleural and peritoneal mesothelioma

  This dataset contains RNA sequencing data of pleural and peritoneal mesothelioma. The number of samples is 18. Sequencing was performed on Illumina NovaSeq 6000 and Illumina NovaSeqXPlus. The sequencing was always paired.

  Dataset EGAD50000001342

• WGS dataset for malignant pleural and peritoneal mesothelioma

  This dataset contains Whole Genome sequencing data of pleural and peritoneal mesothelioma. The number of samples is 40. Sequencing was performed on Illumina NovaSeq 6000 and Illumina NovaSeqXPlus. The sequencing was always paired.

  Dataset EGAD50000001343

• Linked-read data of glioma samples

  Linked-read whole genome sequencing data of 31 glioma samples from 20 patients, including 7 matched blood samples

  Dataset EGAD50000001391

• Raw RNA sequencing of hepatoblastoma PDX cell line HB-303-LEF

  This dataset contains raw RNA sequencing data for hepatoblastoma PDX cell line HB-303-LEF

  Dataset EGAD50000001358

• Exomes from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Whole exome sequencing from 51 samples from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study.

  Dataset EGAD50000001363

• Targeted capture sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Targeted capture sequencing for 366 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study and 29 samples from a previously uploaded dataset.

  Dataset EGAD50000001364

• RNA sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  RNA-seq for 26 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study, and 32 samples from a previously uploaded dataset.

  Dataset EGAD50000001365

• Whole genome sequencing from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Whole genome sequencing for 10 newly added samples in High-grade B-cell lymphoma, not otherwise specified: an LLMPP study, and 6 samples from a previously uploaded dataset.

  Dataset EGAD50000001366

• Low pass WGS from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Low pass whole genome sequencing from 46 samples from High-grade B-cell lymphoma, not otherwise specified: an LLMPP study

  Dataset EGAD50000001367

• Bulk RNA sequencing data of high-grade serous ovarian cancer samples (set 7-17)

  The dataset contains RNA sequencing data of 272 high-grade serous carcinoma (HGSC) patients sequenced with Novoseq 6000, MGISEQ or Hiseq X Ten. The 814 samples are fresh frozen tissue samples that have been collected from different tissues and time points before and during treatment. The files provided are paired fastq files.

  Dataset EGAD50000001370

• 10x Single Cell Gene Expression Library SCRNA10X_CS_CHIP0187_002

  10x Single Cell Gene Expression library SCRNA10X_CS_CHIP0167_003 for Diffuse large B-cell lymphoma patient sample TFRIPAIR10

  Dataset EGAD50000001372

• 10x Genomics BCR Sequencing

  BCR sequencing done with 10x Genomics V(D)J kit + platform for the paper: Integrated single cell analysis reveals co-evolution of malignant B cells and tumor micro-environment in transformed follicular lymphoma. Dataset contains paired FASTQ files for 35 samples, each was processed with the 10x Genomics V(D)J kit to obtain the sequence of the B-cell receptor sequence.

  Dataset EGAD50000001373

• scRNA-seq for 4 reactive lymph node and 12 high grade B cell lymphoma samples

  Dataset includes count matrices, barcode tsvs, and features tsv for each sample, generated using Cell Ranger.

  Dataset EGAD50000001386

• Nanopore whole-genome sequencing of human bone and soft-tissue sarcomas

  We performed single and multi-region nanopore whole-genome sequencing on human bone and soft-tissue sarcoma samples. We also performed nanopore whole-genome sequencing on matched whole blood samples.

  Dataset EGAD50000001392

• (RNA-seq) Shifted assembly and function of mSWI/SNF family subcomplexes underlie targetable dependencies in endometriod carcinomas

  Raw and processed RNA-seq data from a patient-derived xenograft (yielding 18 samples) and the VOA1066 undifferentiated endometrial carcinoma cell-line (yielding 15 samples). PDX samples were treater with either compound-14, dBRD9, or were untreated. VOA1066 samples were treated with either compound-12, dBRD9, or were untreated. Samples were sequenced on an Illumina NextSeq 500 using 37-bp single-end sequencing. Raw fastq files and gene count tables are included for each sample.

  Dataset EGAD50000001471

• (ATAC-seq) Shifted assembly and function of mSWI/SNF family subcomplexes underlie targetable dependencies in endometriod carcinomas

  Raw and processed ATAC-seq data from the VOA1066 undifferentiated endometrial carcinoma cell-line (10 samples). Samples were treated with DMSO, dBRD9, or compound 12, without doxycycline; some samples instead received doxycycline-induced ARID1A treatment, or doxycycline alone. Samples were sequenced on Illumina NextSeq 500 using 37 bp paired-end sequencing parameters. Raw fastq fastq files, bigwig files giving normalized genomic coverage per region, and called broad peaks are included for each sample.

  Dataset EGAD50000001472

• (ChIP-seq) Shifted assembly and function of mSWI/SNF family subcomplexes underlie targetable dependencies in endometriod carcinomas

  ChIP-seq data of 18 samples from the VOA1066 undifferentiated endometrial carcinoma cell-line with various pulldowns: BRG1 (abcam, ab110642, GR3255117-11), BRD9 (CST, E4Q3F, Lot 1), ARID1A (CST, D2A8U, Lot 4), SS18 (CST, D6I4Z, Lot 1), PBRM1 (CST, D3F70, Lot 3), GLTSCR1 (CST, E6I3A, Lot 1), H3K27ac (CST, C36B11, Lot 16), or none. Sample were either untreated or received doxycycline-induced ARID1A treatment. Samples were sequenced on Illumina NextSeq 500 using 37 bp single-end sequencing parameters. Raw fastq files, along with processed bigwig files containing normalized genomic coverage, and called narrow peaks, are included for each sample.

  Dataset EGAD50000001473

• Common origin and somatic mutation patterns of composite lymphomas and leukemias

  The dataset contains six composite lymphomas and leukemias cases (four composite B-cell lymphomas (case 1-4), and two combinations of B-cell and T-cell lymphoma (case 5+6)). Two tumor and one non-tumor (NTC) sample were sequenced from each case after library prep with NEBNext Ultra DNA Library Prep Kit, Exome capturing was done with NimbleGen SeqCap EZ Choice kit, and sequenced on a Illumina HiSeq 2000 HO and given as fastq files. WGA (Qiagen REPLI-g kit) was used for case 2 and 3. Case 1-4 were microdisected, case 5+6 were flow-sorted.

  Dataset EGAD50000001486

• Single cell atlas of large B-cell lymphoma

  The dataset comprises multi-omics profiles from 232 biopsies, including 217 from patients with large B-cell lymphoma (114 newly diagnosed and 103 relapsed/refractory) and 15 benign control samples. Specifically: single-nucleus RNA sequencing (snRNA-seq) was performed on all 232 biopsies; single-nucleus ATAC sequencing was conducted on 96 biopsies; bulk RNA sequencing was generated for 208 biopsies; whole-exome sequencing (WES) was performed on 174 tumor biopsies with 118 matched germline samples; Low-pass whole-genome sequencing (lpWGS) was performed on 174 tumor biopsies with 41 matched germline samples. All raw data files are provided in FASTQ format.

  Dataset EGAD50000001491

• shallow whole genome sequencing BAM files aligned to the human reference genome GRCh38

  We profiled large B-cell lymphoma (LBCL) patient plasma samples with ultra-low-pass (shallow) whole genome sequencing. The DNA sequencing was performed on pre-capture genomic libraries, with an intended mean coverage of at least 0.1X, FASTQ files were cleaned by fastp and mapped to the reference human genome (GRCh38) with bwa.

  Dataset EGAD50000001497

• Human glioblastoma single cell RNA-seq from two patient, sampled at different positions within as well as outside tumor

  We performed deep single-cell RNA sequencing of two rare glioblastoma cases where tissue could be sampled from tumor core to macroscopically normal cortex. We processed two to three replicates per sample with the 10X Genomics V3.1 kits. Deep sequencing was performed to about 100,000 reads per cell on the Illumina NovaSeq 6000 platform, resulting in a total of 37 BAM files.

  Dataset EGAD50000001500

• Visium Spatial transcriptomics

  This study consists of the spatial transcriptomics data generated by : Visium CytAssist Spatial Gene Expression for FFPE (10x) for steatotic liver disease-associated hepatocellular carcinoma (SLD-HCC) (n=7) and non-SLD-HCC (n=5) The goal of this data is to compare SLD-HCC vs non-SLD-HCC as well as response to immunotherapy

  Dataset EGAD50000001506

• singel cell RNAseq dataset for the study "Composition and functional status of T and NK cells in Extramedullary myeloma tumor microenvironment""

  Dataset contains all newly generated single cell RNAseq data generated for the study. It includes 5 EMM soft tissue samples, 5 EMM bone marrow samples (EMM_BM) and 6 RRMM BM samples without EMM (RRMM_BM). Samples that are sequenced twice are marked by _1 or _2 in the sample name. The sample name mentioned corresponds to the sample name used in the publication. The rest of the EMM single cell RNAseq samples mentioned int the publication, EMM_03_1, EMM_11, EMM_14_1, EMM_14_2, EMM_16, and EMM_15_1 are already uploaded in EGA archive – dataset id EGAD50000000053.

  Dataset EGAD50000001511

• Single-cell G&T sequencing - Genomic data

  Single-cell G&T seq from an untreated PDX mouse with neuroblastoma (MYCN amplified).

  Dataset EGAD50000001513

• Single-cell G&T sequencing - Transcriptomic data

  Single-cell G&T seq from an untreated PDX mouse with neuroblastoma (MYCN amplified).

  Dataset EGAD50000001514

• Single Cell Multiome ATAC + Gene Expression sequencing

  The SHH medulloblastoma tumor 7316-178 was received through the Childhood Brain Tumor Network (CBTN). From the patient tumor, disassociated cryopreserved cells stored in 10% DMSO/FBS were used. At least 50 mg of tissue (1 M cells) was used for both samples. Disassociated cells were prepared for Single Cell Multiome ATAC + Gene Expression sequencing (10× Genomics) according to the manufacturer’s instructions. Sequencing was performed on an Illumina NovaSeq S4 200 to a depth of at least 250 M reads for snATAC-seq and 200 M reads for snRNA-seq.

  Dataset EGAD50000001515

• Whole exome sequencing of Human High-Grade-B-Cell-Lymphomas, classified according to IGH status

  HGBCL-DH-BCL2(-BCL6) lymphoma cases, classified according to IGH status in IGH+ or IGH-undetectable

  Dataset EGAD50000001527

• Whole genome sequencing of metachronous FL-High-Grade-B-Cell-Lymphomas, classified according to IGH status

  FL-HGBCL-DH-BCL2(-BCL6) metachronous lymphoma pairs, classified according to IGH status in IGH+ or IGH-undetectable

  Dataset EGAD50000001528

• T cell and Antibody Responses in Rituximab-Treated Lymphoma Patients After SARS-CoV-2 Vaccination

  This dataset contains T cell receptor (TCR) sequencing data from 51 RNA samples, each processed into three independent libraries (tot 153 FASTQ files). Sequencing was performed on an Illumina NextSeq 500 platform using the NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles), generating paired-end FASTQ files with dual 10 bp barcodes and 5% PhiX as internal control. Libraries were quantified with the Qubit HS dsDNA kit and assessed for fragment size distribution using the Agilent Tapestation D1000 system before isochoric pooling to 4 nM and sequencing in two independent runs. The resulting dataset enables analysis of TCR β-chain CDR3 sequences for clonal expansion and diversity studies.

  Dataset EGAD50000001714

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• The dataset for "ctDNA residual disease analyses during perioperative nivolumab or nivolumab plus ipilimumab in resectable diffuse pleural mesothelioma”

  The dataset for the study “ctDNA residual disease analyses during perioperative nivolumab or nivolumab plus ipilimumab in resectable diffuse pleural mesothelioma” includes 169 bam files from whole genome sequencing on the Illumina NovaSeq6000 platform. The samples analyzed include tumor (n=28) and normal (n=28) DNA samples, and serial plasma cfDNA (n=113) samples from 28 individuals with resectable diffuse pleural mesothelioma, treated with nivolumab or nivolumab plus ipilimumab on the NCT03918252 trial.

  Dataset EGAD50000001701

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• De novo modeling of chromoplectic Ewing sarcoma tumors from patient-derived mesenchymal stem cells

  Ewing sarcoma is characterized by pathognomonic translocations fusing most frequently EWSR1 with FLI1 (EF1). In addition, Ewing sarcoma can also display alterations in STAG2, TP53 and CDKN2A (SPC). Starting from Ewing sarcoma derived human mesenchymal stem cells (MSCpat), we recapitulated this translocation and SPC alterations using a CRISPR/cas9 approach and generated a bona fide Ewing sarcoma model (EWIma1) displaying transcriptomic (RNA-seq) and epigenetic (ChIP-seq) hallmarks of EwS.

  Dataset EGAD50000001673

• Whole genome sequencing of UM with MSI

  Illumina platform sequencing of whole genome libraries prepared from paired tumour/normal samples from 1 case of melanoma uveal with MSI

  Dataset EGAD50000001337

• WGBS of melanoma patients

  This dataset contains WGBS of seven melanoma patients and one cultured primary melanocyte sample.

  Dataset EGAD50000001319

• WGBS of patients from six tumor types

  This dataset contains healthy and tumor samples from patients covering breast adenocarcinoma, colon adenocarcinoma, kidney renal clear cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma and pancreas adenocarcinoma.

  Dataset EGAD50000001318

• WGBS of stepwise-edited melanoma model

  This dataset contains WGBS of a stepwise-edited, human melanoma model including in vitro samples and corresponding xenografts.

  Dataset EGAD50000001317

• Targeted panel DNA sequencing of melanomas, nevi and melanocytic tumors

  This dataset was derived from 360 formalin-fixed paraffin-embedded (FFPE) samples distributed across (i) 118 primary melanomas, (ii) 132 nevi and (iii) 110 melanocytic tumors. Next generation sequencing (NGS) libraries were prepared following the FFPE DNA Archer VariantPlex Somatic Protocol for Illumina. Input DNA was determined by the PreSeq DNA QC assay, with 100 ng of DNA used for samples with high quality scores, 200 ng for low quality scores and 300 ng for samples with bad quality scores as defined by the PreSeq DNA QC assay. NGS libraries were quantified using the KAPA Library Quantification Kit for Illumina (KK4824) and sequencing performed on the Nextseq 500/2000 without custom primers using paired-end sequencing (151bp for Read 1 and Read 2) with index reads (8bp for Index Read 1 and Index Read 2). For each sample, resulting paired-end fastq files are available as part of this dataset. Prefix for each sample name is associated with the the type of sample: NAE: nevi samples. MEL: Melanoma samples. BL: melanocytic tumor.

  Dataset EGAD50000001297

• Tumor Profiler Project - OV scDNA data additional samples

  The dataset contains 10x Chromium single-cell DNA sequencing data from 6 samples from 5 different patients with ovarian cancer. 4 samples were collected from the tumor, and 2 samples from ascites. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format. This dataset contains additional samples from patients not classified as having high-grade serous adenocarcinoma.

  Dataset EGAD50000001294

• Tumor Profiler Project - OV scRNA data additional samples

  The dataset contains 10x Chromium single-cell transcriptomics data from 6 samples from 4 different patients with ovarian cancer. 3 samples were collected from the tumor, 3 samples from ascites. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format. This dataset contains additional samples from patients not classified as having high-grade serous adenocarcinoma.

  Dataset EGAD50000001293

• Sequencing data for filanesib-treated hepatoblastoma samples

  This dataset contains RNA sequencing data of two hepatoblastoma PDX cell models. Cells were either treated with KSP inhibitor filanesib or with DMSO (controls).

  Dataset EGAD50000001314

• Spatial transcriptomics reveals immune and tissue remodeling, highlighting diverse host responses across mycobacterial granuloma types

  Granulomas are the hallmark of Mycobacterium infections, forming structured immune environments that drive disease persistence. However, their spatial and functional organization remains unclear. Using spatial RNA sequencing on 33 patient explants, we try to reveal the detailed gene expression and cell composition landscape of granulomas.

  Dataset EGAD50000001462

• Fragmentomics profiling and quantification of plasma Epstein-Barr virus DNA enhance prediction of future nasopharyngeal carcinoma.

  This dataset included human plasma EBV DNA target-capture sequencing data. The capture probes were designed to cover the entire EBV genome and selected human autosomal regions. After enrichment, the products were sequenced on the NextSeq500 System (Illumina) and aligned to the EBV genome (AJ507799.2) and the human genome (hg19) in BAM format. A total of 558 cases were analyzed, including seven subjects who developed NPC in the second-round screening, 431 non-NPC subjects with first-round transiently positive EBV, and 120 non-NPC subjects with first-round persistently positive EBV.

  Dataset EGAD50000001449

• Whole-exome and RNA sequencing data from a uveal melanoma patient with multi-regional sampling

  This dataset includes whole-exome sequencing (WES) and RNA sequencing (RNA-seq) data from a uveal melanoma patient. Tumor samples were obtained from three distinct regions, each with matched RNA-seq and WES data. Additionally, WES data from the patient’s peripheral blood mononuclear cells (PBMCs) is provided as a germline reference.

  Dataset EGAD50000001422

• Multi-omics profiling identifies two epithelioid sarcoma molecular subtypes with distinct signaling and immune characteristics

  Bulk RNA Sequencing of 33 epithelioid sarcomas (EpS) and 3 extracranial extra-renal rhabdoid tumors (EERT) Whole-exome sequencing of 30 EpS and 3 EERT Single-cell RNA Sequencing of 8 EpS Visium Spatial Transcriptomics of 3 EpS

  Dataset EGAD50000001419

• SCANDARE TNBC transcriptomics data

  SCANDARE (NCT03017573) is a multicentric biobanking study, enrolling adult patients with newly diagnosed head and neck squamous cell carcinoma (HNSCC), triple negative breast cancer (TNBC), ovarian and cervical cancer. Tumor tissue and blood samples are collected at several time points during patient's journey, including at diagnosis, post-neoadjuvant chemotherapy in case of neoadjuvant treatment, at surgery, at recurrence and at disease progression following treatment initiated at recurrence. Since its launch in 2017 at Institut Curie, SCANDARE has enabled the longitudinal collection and preservation of samples for in-depth analyses. Here, we describe molecular alterations in 124 frozen samples (n=84 at baseline and n=40 paired at post-NAC surgery) from 91 TNBC patients using total RNAseq technology, with FASTQ files deposited in the dataset.

  Dataset EGAD50000001416

• Tumor Profiler Project - OV cell-free DNA data additional samples

  The dataset contains amplicon sequencing data from 7 samples from 7 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format. These samples are from patients not classified as having high-grade serous adenocarcinoma.

  Dataset EGAD50000001412

• Tumor Profiler Project - OV bulk transcriptomics data additional samples

  The dataset contains bulk transcriptomics data from 4 samples from 3 different patients with ovarian cancer. 3 samples were collected from the tumor, 1 sample from ascites. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format. These samples are from patients not classified as as having high-grade serous adenocarcinoma.

  Dataset EGAD50000001411

• PCR-Free Shallow Whole Genome Sequencing for Chromosomal Copy Number Detection

  Archival peripheral blood or bone marrow plasma samples from non small-cell lung cancer, B-cell lymphoma and acute myeloid leukemia patients, and healthy donors. Shallow whole genome sequencing of 100 Samples by two distinct library preparation methods (PCR = 45, PCR-Free = 55). sWGS done for Chromosomal CN detection.

  Dataset EGAD50000001404

• Spatial transcriptomic analysis of renal cell carcinoma

  Spatial transcriptomic analysis of two Japanese ELOC-mutated renal cell carcinoma

  Dataset EGAD50000001400

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• Targeted sequencing data of cfDNA, archival tissue, and WBC from 226 patients with mUC

  Targeted tissue (n=210), cfDNA (n=402), and WBC (n=245) Illumina sequencing of metastatic urothelial carcinoma patients. All cfDNA is collected in the metastatic setting, while archival tissue is from across the disease course. White blood cell (WBC) samples are used as patient matched germline samples. All files are in paired-end fastq format.

  Dataset EGAD50000001571

• Whole genome sequencing data of cfDNA and WBC from 5 patients with mUC

  Whole genome Illunima sequencing of cfDNA of 5 metastatic urothelial carcinoma patients. White blood cell (WBC) samples are used as patient matched germline samples (n=5). All files are in paired-end fastq format.

  Dataset EGAD50000001570

• Melanoma transcriptomic data from patients undergoing immunotherapy

  This dataset contains raw RNA sequencing data from melanoma patient tumor samples collected before and during immunotherapy. The data support investigation of treatment-related changes in tumor cell populations. Samples were analyzed as part of a study exploring cellular responses to immune-based therapies.

  Dataset EGAD50000001569

• Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant

  Hybrid Capture of PyBKV integration in Urothelial Carcinoma from Kidney Transplant. The Panel was designed using Agilent SureDesign on SureSelect XTHS Hybrid Capture Panel. Sequencing was done on Illumina NovaSeq 6000

  Dataset EGAD50000001548

• WGS Sequencing of Urothelial Carcinoma from Taiwan

  Normal and Tumor paired WGS sequencing of UC Tissues

  Dataset EGAD50000001547

• Datasets of RNA-seq of tumor samples from clear cell renal cell carcinoma patients included in the Translational Program of the NIVOREN GETUG-AFU-26 trial

  RNA-seq analyses were performed on tumor tissue samples of 115 advanced clear cell renal cell carcinoma patients who participated in the NIVOREN GETUG-AFU-26 trial. The samples were obtained prior to treatment initiation. RNA-seq was performed to evaluate previously published gene expression signatures. These included: the IMmotion T effector (CD8A, EOMES, PRF1, IFNG and CD274) and the IMmotion Myeloid (IL-6, CXCL1, CXCL2, CXCL3, CXCL8, and PTGS2) gene signatures represent gene expression patterns associated with T effector cells and myeloid cells, respectively, while JAVELIN Renal 101 Immuno (T-cell receptor signaling: CD3G, CD3E, CD8B, THEMIS, TRAT1, GRAP2, CD247; T-cell activation, proliferation, and differentiation: CD2, CD96, PRF1, CD6, IL7R, ITK, GPR18, EOMES, SIT1, NLRC3; Natural killer cell mediated cytotoxicity: D2, CD96, PRF1, CD244, KLRD1, SH2D1A; Chemokine: CCL5, XCL2; and Other immune response genes: CST7, GFI1, KCNA3, PSTPIP1) represents gene expression patterns associated with both innate and adaptive immune response.

  Dataset EGAD50000001541

• Clinical Outcomes for 344 Diffuse Large B-Cell Lymphoma Patients

  This dataset contains clinical outcomes for 344 Diffuse Large B-Cell Lymphoma patients. For each subject we have recorded AGE (binarized: > 60, <= 60), SEX (male or female), LDH (serum lactate dehydrogenase), ECOG (Performance status 3 or 4), STAGE (Disease stage III or IV according to the Ann Arbor staging system), EXBM (Two or more extranodal sites of disease (outside of a lymph node), BSYMP (Presence of B symptoms), and BM (Bone marrow involvement). All data are delivered as a single XLSX file with one row per patient.

  Dataset EGAD50000001536

• Visium CytAssist Spatial Gene Expression analysis for glioblastoma

  The glioblastoma spatial transcriptomics dataset was generated from 4 FFPE fixed adult glioblastoma samples, using the 10x Genomics Visium platform, producing raw FASTQ files, spatial feature matrices (.h5, .mtx, .tsv), and paired histology images (.tif). Spot-level transcript counts were aligned to tissue architecture and processed in Seurat, with results stored as .rds objects. Data visualization was performed using SpatialFeaturePlot, and quantitative analyses were supported by custom Matlab scripts. The dataset provides both raw and processed files, offering reproducible spatially resolved transcriptomic profiles of glioblastoma tissue sections

  Dataset EGAD50000001767

• SIA Subtyping RNA Sequencing

  Associated with Molecular classification of small intestinal adenocarcinomas. RNA sequencing generated 849 .fastq files from 137 primary and recurrent small intestine adenocarcinoma samples from 135 patients.

  Dataset EGAD50000001762

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing (part 2)

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38). This dataset contains the remaining file of this study.

  Dataset EGAD50000001757

• Targeted panel sequencing of two patient-derived melanoma cell lines

  Targeted panel sequencing was conducted on patient-derived cell lines: Mel-DCC-11 (the parental line, sensitive to the BRAF inhibitor) and Mel-DCC-11-R (resistant to the BRAF inhibitor). The parental cell line was generated from disseminated cancer cells (DCCs) obtained from a lymph node sample of a melanoma patient. The resistant cell line was generated from the parental one through exposure to Vemurafenib. Normal peripheral blood lymphocytes from the same patient served as the control for comparison. Sequencing on NovaSeq6000. Fastq files.

  Dataset EGAD50000001745

• Patient-derived organoids cohort raw FASTQ from SGMedical

  Raw FASTQ files for a glioblastoma multiforme organoid study, including exome sequencing and RNA-seq. 29 runs (paired-end), 58 FASTQ.c4gh files (R1/R2). Short-read Illumina; library strategies include exome capture and stranded total RNA-seq (see Experiment records for kit/instrument details). No processed results are included; access is controlled under the selected Policy.

  Dataset EGAD50000001741

• Shallow Whole Genome Sequencing (sWGS) of pancreatic ductal adenocarcinoma

  Associated with CNA differences between RNA-based subtypes of PDAC. Shallow Whole Genome Sequencing (sWGS) generated 47 .bam files from 37 patients. sWGS was used for Copy number aberrations (CNA) determination.

  Dataset EGAD50000001732

• WES dataset of a TIL-ACT metastatic melanoma cohort

  Whole-exome sequencing (WES) data from 13 patients with metastatic melanoma in a TIL-ACT cohort, generated to characterize tumor genomics and neoantigen landscapes relevant to adoptive T cell therapy.

  Dataset EGAD50000001731

• Five Mantle Cell Lymphoma Patients Before and After Failure of Standard Chemotherapy

  MCL cells were isolated from different tissues of five patients with MCL at diagnosis, and at the time of the first clinical relapse after failure of standard immunochemotherapy based on alternation of R(ituximab)-CHOP and R-high-dose-araC. All patients signed informed consent according to the Declaration of Helsinki. Four patients were diagnosed with classical nodal aggressive MCL, and all these patients experienced early relapse (i.e., progression of disease POD < 12 months). One patient was diagnosed with indolent non-nodal MCL and relapsed 9 years after initial MCL diagnosis. The dataset presents single cell RNA sequencing data as well as whole exome sequencing data for these five patients.

  Dataset EGAD50000001213

• Exome-sequencing on early oral squamous cell carcinoma with clear margins

  Whole exome sequencing (WES) on early oral squamous cell carcinoma (OSCC) with clear margins, and on resection margins, 86 patients with a median follow-up of 58 months (range 30.4-83 months). Raw data (fastq format).

  Dataset EGAD50000001209

• Single-cell RNA-sequencing on malignant and benign tissue samples

  Single-cell RNA-sequencing on malignant and benign tissue samples from untreated donors with colorectal adenocarcinoma and liver metastasis was performed in order to deduce tissue adaptive expression patterns of the disease. Matching tissue from five donors with untreated CRC and liver metastasis were sampled.

  Dataset EGAD50000001203

• Whole Exome Sequencing of paired gDNAs and PPGL tumor DNA from patients with cyanotic congenital heart disease

  Fastq files from Whole Exome Sequencing of 12 paired germline DNA (from blood/saliva) and 14 PPGL tumor DNA (from formalin-fixed paraffin-embedded (FFPE) blocks from surgery) from patients with cyanotic congenital heart disease (CCHD) and pheochromocytoma and paraganglioma (PPGL). Sequencing was performed using the Illumina HiSeq4000.

  Dataset EGAD50000001201

• Single-Cell and Bulk RNA Sequencing of Oncolytic Measles Virus Treatment in Pediatric Medulloblastoma and ATRT

  This dataset includes single-cell RNA sequencing profiles from five mice bearing Group 3 medulloblastoma (CSCG) treated with oncolytic measles virus (MV-NIS) and three mice treated with MV-NIS combined with anti-PD1 therapy. Additionally, bulk RNA sequencing data were generated from 12 samples across PBS control, heat-inactivated (HI) control, MV mid-treatment, and treatment resistance conditions. Pediatric patient data were collected from the PNOC005 trial, which enrolled patients into three strata: Stratum A (focal recurrence, local MV-NIS administration post-surgical resection), Stratum B (disseminated recurrence, single MV-NIS dose via lumbar puncture), and Stratum C (disseminated recurrence, two consecutive MV-NIS doses via lumbar puncture on Day 0 and Day 7). Whole blood and PBMC samples were collected from 17 patients across all strata, generating 72 bulk RNA-seq datasets at multiple time points. All datasets are provided as raw sequencing data in FASTQ format.

  Dataset EGAD50000001197

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• Shallow dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. shallow Whole Genome Sequencing (sWGS) of 63 samples. sWGS was done to analyze copy number aberration.

  Dataset EGAD50000001165

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• Refractory Classic Hodgkins Lymphoma (cHL) sWGS

  Associated with the study: Blood-based Monitoring of Relapsed/Refractory Hodgkin Lymphoma Patients Predict Responses to Anti-PD-1 Treatment. 26 ctDNA Samples from 4 patients followed longitudinally. sWGS performed for copy number aberration (CNA) analysis.

  Dataset EGAD50000001163