19371 results for "Cheap fc 26 coins Buyfc26coins.com is official EA Sports partner for FC 26 coins That was the fastest delivery ever..fxB4"

in 369.63 milliseconds.

• The University of Hong Kong Intestinal Metaplasia Organoids Study scCNV Data

  Single cell encapsulation and DNA libraries were prepared by Chromium™ Single Cell DNA Reagent Kits and Chromium™ Single Cell C and D Chip Kits.

  Dataset EGAD00001015423

• Genetic architecture of male infertility in India

  The dataset consists of whole exome and genome sequencing data from infertile males and his parent(s) and/or sibling(s)

  Dataset EGAD00001015606

• GBM-Space: Joint Transcriptome and Chromatin Accessibility Profiling of Glioblastoma (10x Genomics - Multiome)

  GBM-Space: Joint Transcriptome and Chromatin Accessibility Profiling of Glioblastoma (10x Genomics - Multiome). Note: 60 new samples were added to the dataset on 2026-05-20.

  Dataset EGAD00001015526

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• RNA Sequencing of Control and Myotonic Dystrophy Type 1 Cells During Myogenic Differentiation

  Immortalized control, patient-derived and CRISPR/Cas9-edited patient-derived myoblasts (known in the literature as C25, DM11, and DM11_1E6 cells, respectively) were grown confluent and were fused to myotubes in differentiation medium. Samples were collected at day -2 before initiation of differentiation (i.e. proliferation stage), at day 1 and at day 5 of differentiation in lysis buffer and stored at -70 degrees until all samples were collected.

  Study EGAS50000001152

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Testing the feasibility of genome scale sequencing in routinely collected FFPE cancer specimens versus matched fresh frozen samples

  Testing the feasibility of genome scale sequencing in routinely collected FFPE cancer specimens versus matched fresh frozen samples

  Dataset EGAD00001000255

• Functional analysis of GATA2 synonymous mutations

  Germline mutations in SAMD9 and SAMD9L (SAMD9/9L) genes predispose to myelodysplastic syndromes (MDS) and show high prevalence in pediatric MDS with monosomy 7. Here, we studied an international cohort of children with primary MDS to assess the prevalence, hematological features, genetics, clonal evolution and clinical outcome in patients with germline SAMD9/9L mutations compared to pediatric MDS with either germline GATA2 mutations or pediatric MDS with wildtype status in SAMD9/9L and GATA2 genes

  Study EGAS00001003817

• Colorctal cancer WES/WGS analysis in Dr. Liu’s group in Sun Yat-sen University Cancer Center.

  The samples include paired tumor and normal tissues from 106 patients . High-coverage WES sequencing or whole genome sequencing of DNA samples were performed on the Illumina HiSeq 2000 system

  Dataset EGAD00001003551

• Genome-wide analysis of H3K27me3 occupancy and DNA methlytion in pediatric high-grade glioma

  Genome-wide analysis of H3K27me3 occupancy and DNA methylation in K27M-mutant and H3.3-WT primary pediatric high-grade gliomas (pHGGs) as well as pediatric pHGG cell lines. The study aims to elucidate the connection between K27M-induced H3K27me3 reduction and changes in DNA methylation as well as gene expression.

  Dataset EGAD00001000677

• Myeloproliferative Neoplasms (MPN) Targeted Gene Screen

  Pulldown experiments will be performed on a number of patients with Myeloproliferative Neoplasms (MPN). The pulldown will be a bespoke design targeting known mutations, this pulldown will be sequenced and analysed to inform prevalence of mutations and to inform to the possibility of use as a diagnostic tool.

  Dataset EGAD00001000652

• Matched Pair Cell Line Tumour RNAseq

  In this study we will sequence the transcriptome of Verified Matched Pair Cancer Cell line tumour samples. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000630

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  We investigated 10 female and 14 male SARS-CoV-2 positive children (age range: 0.8 to 18 years). Based on the WHO guidelines, 15 patients were classified as having mild COVID-19, while 7 children were classified as moderate COVID-19 cases. Two children were asymptomatic. 8 female and 10 male SARS-CoV-2 negative children were included as controls (age range: 4 to 16). 12 SARS-CoV-2 positive female and 9 male adults were included ( age range: 27 - 76) together with 13 female and 10 male SARS-CoV-2 negative adult controls (age: 24 - 77). 10 adult COVID-19 patients had mild disease, while 12 had moderate COVID-19. We performed single-cell RNA sequencing experiments.

  Dataset EGAD00001007969

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - structural variation vcf files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - structural variation vcf files (Mutographs)

  Dataset EGAD00001015389

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - copy number variants (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - copy number variants (Mutographs)

  Dataset EGAD00001015390

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - sequence data (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - sequence data (Mutographs)

  Dataset EGAD00001015386

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - patient metadata files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - patient metadata files (Mutographs)

  Dataset EGAD00001015387

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - filtered vcf files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - filtered vcf files (Mutographs)

  Dataset EGAD00001015388

• De novo metastatic prostate cancer cohort

  Fastq files from RNA sequencing of normal and tumor samples from 16 patients from the de novo metastatic prostate cancer cohort.

  Dataset EGAD50000002381

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Enzymatic methylation sequencing of intestinal metaplasia

  We perform genome-wide EM-seq of 14 patients with concurrent matched normal, dysplasia and early gastric samples from South Korea. The dataset contains cram files from 38 samples.

  Dataset EGAD50000001538

• Single cell transcriptomes from vascularized human retinal organoids

  Both control and vascularized organoids were processed using the 10x Chromium 3' RNA method. Sequencing reads were aligned with STARsolo.

  Dataset EGAD50000001216

• FOCUS study

  Shallow whole genome sequencing of adavanced colorectal tumors from patients included in the FOCUS clinical trial. Performed to calculate assocations of irinotecan with copy-number alterations. Copy number aberration analysis of 349 enroled patients.

  Dataset EGAD50000001007

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• H3K27me3 Cut&Tag on beta cells

  H3K27me3 Cut&Tag datasets in human pancreatic islets and the EndoC-bH1 cell line

  Dataset EGAD50000000463

• H3Africa SIREN GWAS Stroke

  3421 Samples from Nigeria and Ghana, genotyped with the Illumina NestSeq 500

  Dataset EGAD00010002551

• RP3_Freeze_1

  Freeze 1 of the RP3 project

  Dataset EGAD00010000887

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• EGAD00000000057

  WTCCC project samples from the Parkinson's disase cohort

  Dataset EGAD00000000057

• Long-read sequence data from two carriers of a predisposing structural variant

  This dataset contains PacBio long-read sequence data from two individuals with a chr9p.21 structural variant and two controls. Sequences were aligned againt the human reference genome HG38.

  Dataset EGAD50000002155

• HIPO blastemal Wilms (nephroblastoma) CHIP sequencing samples

  HIPO blastemal Wilms (nephroblastoma) characterisation of tumor driving events caused by differential SIX1 binding of the SIX1 Q177R mutatns

  Dataset EGAD00001000992

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• Whole exome sequencing of Finnish hereditary breast cancer families

  Dataset contains Whole Exome Sequencing(WES) data from 37 individuals as aligned bam-files. The reads have been aligned using bowtie2 to human genome hg19 build.

  Dataset EGAD00001002133

• cHCC-ICC WES

  The whole exome sequencing data of 291 tumor/normal samples from 121 cHCC-ICC cases.

  Dataset EGAD00001005183

• WES data from optic atrophy study

  The dataset includes Fastq files from WES experiments performed on a proband presenting with syndromic optic atrophy and his healthy parents. Exons were captured by hybridization and sequenced on an Illumina platform

  Dataset EGAD00001005321

• Human normal brain bulk RNA-seq

  We profiled 43 normal human adult brain and 11 normal human fetal brain specimens by bulk RNA-seq. The raw fastqs are provided.

  Dataset EGAD00001005130

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Whole genome sequencing of the healthy breast

  Whole genome sequencing of 29 donors of healthy mammary tissue. BAM files of stromal and epithelial DNA are included.

  Dataset EGAD00001006402

• postcovid19

  contain the raw data from scRNA, scATAC, genotyping.

  Dataset EGAD00001008122

• Germline WES data of parents whose children have germline CHEK2 mutations

  This data set includes bam files (aligned to hg38) from the germline of parents whose children have CHEK2 germline mutations.

  Dataset EGAD00001009516

• Germline WES data of children with pathogenic mutations in cancer predisposing genes

  This data set includes bam files (aligned to hg38) from the germline of children who have pathogenic mutations in cancer predisposing genes

  Dataset EGAD00001009854

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• The University of Hong Kong Intestinal Metaplasia Organoids Study scRNASeq Data

  Single cell encapsulation and cDNA libraries were prepared by Chromium™ Single Cell 5’ Reagent Kits and Chromium™ Single Cell A Chip Kit.

  Dataset EGAD00001015422

• Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the palate patient

  Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the palate patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003065

• Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient

  Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003702

• Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient

  Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003716

• Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003723

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003725

• Genome and transcriptome sequence data from a spindle cell carcinoma of the left parotid patient

  Genome and transcriptome sequence data from a spindle cell carcinoma of the left parotid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003734

• Genome and transcriptome sequence data from an adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from an adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003742

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• PacBio HiFi whole-genome sequencing of two microsatellite instability (MSI) gastric cancer

  We generated long-read whole-genome sequencing (WGS) data using PacBio HiFi from two human gastric cancer cell lines exhibiting microsatellite instability (MSI). The dataset contains aligned bam (hg38) files.

  Dataset EGAD50000002300

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Long-read RNA-seq from 5 patients with stereotyped subset CLL

  Oxford Nanopore Technologies based long-read RNA sequencing data from 5 patients with stereotyped subset CLL. The BAM files were aligned against hg19 reference genome.

  Dataset EGAD50000000755

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Methylation profiling of sarcoma and TFCP2-rearranged rhadomyosarcoma samples

  Methylation profiling of 345 sarcoma and TFCP2-rearranged rhadomyosarcoma samples, using the approach described "Genomic, transcriptomic, functional, and mechanistic characterization of rhabdomyosarcoma with FUS-TFCP2 or EWSR1-TFCP2 fusions"

  Dataset EGAD00010002451

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• The temporal mutational and immune tumour microenvironment remodelling of HER2-negative primary breast cancers

  WES and clonality characterization of different timepoints in HER2-negative primary breast cancers receiving neoadjuvant eribulin therapy.

  Study EGAS00001004953

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• Deep Sequencing of somatic cancer mutations

  We enriched a panel of cancer associated genes using the Custom Sure Select Target Enrichment Kit. Identified mutations were validated with deep sequencing in order to assess mutated allele frequencies more accurately.

  Dataset EGAD00001001313

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• Human tumour and normal-matched WES

  We profiled 23 high-grade gliomas patient tumor samples and 4 normal-matched patient samples by whole exome sequencing. The raw fastq files are provided.

  Dataset EGAD00001006099

• Clinical phenotype data

  Clinical data corresponding to the patients with ovarian cancer studied using scRNA-seq and bulk RNA-seq. Variables include molecular subtype, predicted immune phenotype, reviewing pathologist comment, final immune phenotype, histology characterization, and tumor stage.

  Dataset EGAD00001006973

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• HSP90 inhibitor resistant K562 cells

  K562 cell line has been treated with two different HSP90 inhibtors. After resistance clones emerged, they have been genetically characterized using WES in comparison to the parental K562 cell line.

  Dataset EGAD00001009051

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• The University of Hong Kong Gastric Cancer XClone Study Single Cell CNV Data

  Single cell encapsulation and DNA libraries were prepared by Chromium™ Single Cell DNA Reagent Kits and Chromium™ Single Cell C and D Chip Kits.

  Dataset EGAD00001015383

• DAC: LUMC NeuroD AON off target analysis

  In this study, we used three different splice-switching AONs targeting three different human transcripts to study their transcriptome-wide, hybridization-dependent off-target effects with short read RNAseq. Using the computational tools rMATS and Whippet, in control human induced pluripotent stem cells

  Dac EGAC50000000726

• DNA sequencing of sgRNAs enriched from the CRISPR-Cas9 screened HCC organoids

  Project aims to find enriched or depleted sgRNAs to identify functional genes in HCC progression and lenvatinib resistance

  Study EGAS50000000848

• RNAseq of samples from CLL patients treated with idelalisib in vivo

  The dataset contains RNA sequencing data from 18 paired samples of 9 CLL patients treated with idelalisib in vivo (median time on therapy 4 weeks; range 2-5 weeks).

  Dataset EGAD50000000878

• Transcriptome - Uveal Melanomas

  Total RNA sequencing on 9 uveal melanomas. Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Gold (Illumina, 20020599). Paired-end libraries (2 x 100 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000763

• 200PT : CNA vcf files

  200PT : CNA vcf files. Copy Number Abberation calls generated using TITAN and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004073

• MP-WGS and WES from CCND1-negative MCL

  BAM files from 5 CCND1-negative MCL cases. 4 BAM files corresponded to long insert size Mate Pair-WGS and 3 to WES. In 2 of the cases both technologies were performed.

  Dataset EGAD00001004161

• To determine the transcriptional profiles of Ovarian carcinomas (UW cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (UW_OvCa_RNAseq)

  Study EGAS00001006012

• COLORS in IBD: Whole exome sequencing of early onset IBD patients

  Exome sequence analysis of individuals with severe early onset inflammatory bowel disease, and their families. Individuals are ascertained through the COLORS in IBD study, which includes centres throughout UK and Europe.

  Dataset EGAD00001001316

• Her2 BC WGS dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001334

• BAM files

  DNA sequencing reads of human adult stem cell cultures from liver, colon and small intestine. Including biopsy or blood samples of the donors.

  Dataset EGAD00001001900

• Triple Negative Breast Cancer RNA Sequencing

  We propose to definitively characterise the somatic genetics of triple negative breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000390

• Next Generation Sequencing in an IBD Pedigree Exome Data

  We perform whole exome sequencing on samples from a large IBD pedigree. The selected samples are from more distantly related family members (healthy and with IBD) and a set of matched population (Ashkenazy Jewish ancestry) samples.

  Dataset EGAD00001000422

• An Interim Report on the Investigator-initiated Phase 2 Study of Pembrolizumab Immunological Response Evaluation (INSPIRE)

  Whole exome sequencing BAM files of 50 metastatic solid tumour and matched blood germline DNA prior to pembrolizumab treatment.

  Dataset EGAD00001004873

• Whole genome sequence of Primary-recurrent HCC study

  This dataset contains whole genome sequence data from 24 samples, including 16 tumors and 8 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005451

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models: validation cohort

  Total RNA sequencing (SMARTer Stranded Total RNA-Seq Kit v2) data of extracellular RNA (exRNA) from liquid biopsies of the validation PDX/CDX cohort

  Dataset EGAD00001009413

• Human tumor bulk RNA-seq

  We profiled 7 patient neuroblastoma-FOXR2 tumor samples by bulk RNA-seq. The raw fastqs are provided.

  Dataset EGAD00001010901

• WGS of a Li-Fraumeni patient's HSPCs

  WGS data of clonally expanded HSPCs from a Li-Fraumeni patient at the time of second cancer (Burkitt lymphoma and <5% t-MN) after primary osteosarcoma diagnosis and a reference MSC bulk.

  Dataset EGAD00001011257

• BIOCLOCK Phenotype Information Dataset

  This dataset contains phenotypic metadata from participants in the BIOCLOCK endurance exercise intervention and epigenetic aging study. It includes intervention status, cardiorespiratory fitness (VO2 max), body composition, estimated leukocyte proportions, and other relevant traits linked to epigenetic aging outcomes.

  Dataset EGAD00001015799

• Extensive and differential platinum chemotherapy mutagenesis in livers of children - Whole genome NanoSeq

  Whole genome NanoSeq of a cohort predominantly consisting of paired blood, normal liver and liver tumour from children with liver cancer. The cohort includes platinum-exposed and platinum naïve samples.

  Dataset EGAD00001016142

• The Pathogenesis and Genetics of Disseminated Coccidioidomycosis

  Whole exome sequencing on patients > 2 years of age with confirmed disseminated coccidioidomycosis, not undergoing active immunosuppressive therapy, negative HIV status. 

  Study phs002881

• NHLBI TOPMed: Characterizing the Response to a Leukotriene Receptor Antagonist and an Inhaled Corticosteroid (CLIC)

  Within-subject clinical responses to either inhaled corticosteroids or Montelukast were compared in 126 children with mild to moderate asthma.

  Study phs001729