19370 results for "Cheap fc 26 coins Buyfc26coins.com is official EA Sports partner for FC 26 coins That was the fastest delivery ever..fxB4"

in 60.26 milliseconds.

• ICGC PCAWG Dataset: RECA-EU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: RECA-EU.

  Dataset EGAD00001002131

• ICGC PCAWG Dataset: PACA-AU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PACA-AU.

  Dataset EGAD00001002132

• ICGC PCAWG Dataset: LIRI-JP_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: LIRI-JP.

  Dataset EGAD00001002155

• ICGC PCAWG Dataset: ESAD-UK_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: ESAD-UK.

  Dataset EGAD00001002156

• ICGC PCAWG Dataset: PAEN-IT_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PAEN-IT.

  Dataset EGAD00001002153

• ICGC PCAWG Dataset: PAEN-AU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: PAEN-AU.

  Dataset EGAD00001002154

• ICGC PCAWG Dataset: MELA-AU_PCAWG_WGS_BWA

  ICGC PCAWG Dataset for WGS BAM aligned using BWA MEM. Project: MELA-AU.

  Dataset EGAD00001002157

• RNAseq data

  Bulk RNAseq of sigmoid colon biopsies from healthy volunteers and ulcerative colitis patients. Subjects were treated with Placebo or IL-22Fc at different doses, and biopsies were collected at day 0 and day 30 post treatment and prepared for RNA sequencing.

  Dataset EGAD00001008816

• Fecal 16S UC sequencing data

  Fecal 16S-V4 rRNA gene sequence data from NCT02749630 ulcerative colitis patients. Stool samples were collected at screening as well as on days 29, 43, 64, 85, and 134 processed for 16SV4 rRNA gene sequencing

  Dataset EGAD00001008818

• Fecal 16S HV sequencing data

  Fecal 16S-V4 rRNA gene sequence data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, 64, 85, and 134 processed for 16SV4 rRNA gene sequencing

  Dataset EGAD00001008840

• Fecal WMS HV sequencing data

  Fecal WMS data from NCT02749630 healthy volunteers. Stool samples were collected at screening as well as on days 29, 43, and 64 and prepared for whole metagenomic sequencing.

  Dataset EGAD00001008841

• cfMethyl-Seq

  cfMethyl-Seq libraries were generated for 479 cfDNA samples and were sequenced with 150 bp paired-end reads.

  Dataset EGAD00001009003

• BC Cancer, part of the Provincial Health Services Authority, Technology Development Office, Data Access Committee (PHSA TDO DAC)

  Access to data generated by BCCA is made available by completing the data access agreement for review by the data access committee and will be granted to qualified investigators for appropriate use.

  Dac EGAC00000000011

• The Cleveland Clinic Foundation's (CCF) Lone Atrial Fibrillation (AFIB) GWAS Study

  Blood samples were taken from patients who have lone atrial fibrillation. DNA samples were processed with Illumina Hap550 and Hap 610 chips.

  Study phs000820

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• RNA isoform diversity, splicing variants, and switching in single cells of the Alzheimer’s disease brain

  Paired 10X 3' single-nucleus RNA sequencing with PacBio Kinnex long-read sequencing in 7 control and 8 Alzheimer's disease human frontal cortex samples.

  Dataset EGAD50000002124

• RNA-Sequencing of whole blood collected from RNU4ATAC/RNU6ATC patients and controls

  RNA-Sequencing of whole blood collected from patients with biallelic RNU4ATAC/RNU6ATAC variants, parents who carry the variants, healthy controls and type 1 diabetes controls.

  Dataset EGAD50000002242

• Dual RNA-seq data of chlamydia infected M2 macrophages

  This dataset contains 8 unpaired fastq files sequenced with Ilumina NextSeq 2000. The files contain transcriptome data of host and pathogen from infected and uninfected samples from extracted total RNA at 30 hours post infection.

  Dataset EGAD50000001398

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from healthy donors

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of three healthy controls.

  Dataset EGAD50000001232

• Cell subtypes subsets from subcortical MS snRNA-seq atlas

  Curated subsetting of cell subtypes derived from the 9 principal cell types within our subcortical Multiple Sclerosis (MS) lesions snRNA-seq atlas.

  Dataset EGAD50000000522

• CRC cell line MPRA

  Massively Parallel Reporter Assays (MPRA) of colorectal cell lines HCEC-1CT (normal colon) and HT29 and SW403 (MSS cancer). Probes identified using the CRC GWAS.

  Dataset EGAD50000000596

• Single-cell RNA and TCR-sequencing of treatment-refractive immune-mediated arthritis

  Single-cell RNA and TCR-sequencing of three patients with treatment-refractive immune-mediated arthritis. The dataset consists of synovial tissue CD4+ and CD8+ T cells and peripheral blood CD45+ leukocytes.

  Dataset EGAD50000000749

• CSF and PBMC scRNAseq RRMS patients at diagnostic n=5

  To get insights about immune cells infiltrating cells the CSF of RRMS patients (n=5), we proceed to 10X scRNAseq of paired CSF and blood circulating cells (about 20000 cells each) sampled at diagnostic.

  Dataset EGAD50000000445

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• thraruk-G-1

  Resolving the Genetic Architecture of Aseptic Loosening After Total Hip Replacement

  Dataset EGAD00010001289

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• To determine the genomic profile of Triple Negative Breast Cancer patient-derived xenografts (PDX cohort)

  Specific BRCA and immune configurations determine optimal response to platinum-based chemotherapy in triple negative breast and ovarian carcinomas (PDX_WGS)

  Study EGAS00001005995

• RNA-Seq data of VDH15 cells with and without deletion of NSUN3

  paired RNA-Seq data of VDH15 cells with and without deletion of NSUN3. The 11 samples were sequenced on HiSeq 4000 and prepared with SmarTer low input RNA and Chip NEBNext kit.

  Dataset EGAD00001006560

• Whole Genome Sequencing of 18 sequential samples from 3 CLL patients

  Whole Genome Sequencing to track subclonal heterogeneity in 18 samples from 3 Chronic Lymphocytic Leukemia patients subjected to repeated cycles of therapy. NOTE: There are only 12 BAM files available to download. The other 6 files are missing.

  Dataset EGAD00001000972

• PMBCL sequencing - bam analysis

  Files associated with the dataset: HS1626.bam, HS1484.bam, HS1483.bam, HS1482.bam, HS1481.bam, HS1480.bam, HS1479.bam, HS1478.bam, A13805.bam, A13800.bam, A13799.bam, A05253.bam, A05252.bam, A13806.bam

  Dataset EGAD00001000692

• Uveal melanoma whole genome sequencing, SNP arrays and RNA-seq

  We conducted whole genome sequencing and DNA SNP array of 12 uveal melanoma genomes and their matched DNA from blood. We also conducted RNA-seq of the 12 tumour samples.

  Dataset EGAD00001000372

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• TONIC study Whole Exome Sequencing

  Paired-end whole exome sequencing of 50 TNBC breast cancer metastasis samples and matched normal samples obtained from 50 unique patients assayed at study baseline (directly after patient randomization). The included raw sequencing data (fastq-format) were generated using Illumina HiSeq2500 instruments.

  Dataset EGAD00001004857

• cHCC-ICC RNAseq

  The RNA-seq data of 97 tumor samples from 77 cHCC-ICC cases, data of two other HCC tumor samples were also included.

  Dataset EGAD00001005182

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Transcriptome analysis of Treg cells from blood, fat, liver and skin

  Tcells were isolated fom Tissues and FACS sorted. In total 43 samples were processed in 5 replicates with the Takara SmartSeq Stranded kit. Single end fastq-files are supplied.

  Dataset EGAD00001007664

• Single RNA-Seq of fCAB treated tRNAs from VDH01

  Single RNA-seq of fCAB treated tRNAs from vdh01 samples (5 replicates). tRNAs were extracted using Mirvana° Invitrogen kit. The samples were prepped with Il TruSeq Small RNA and sequenced on Illumina NextSeq550.

  Dataset EGAD00001008743

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• Whole-genome-seqeuncing IMFT

  Whole-genome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007804

• Human tumor bulk RNA-seq

  We profiled 9 high-grade gliomas patient tumor samples by bulk RNA-seq. The raw fastqs are provided.

  Dataset EGAD00001008348

• 17 skin and oral epithelial bulk samples from 2 donors

  Aligned BAM files with removed duplicate reads of targeted sequencing data (exomes of a panel of 153 genes) from 12 skin and 5 oral epithelial bulk samples from 2 donors. Sequences generated by the BGI DNB-SEQ platform.

  Dataset EGAD00001008956

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  234 BAM files containing capture data of MCL tumours and constitutive DNA

  Dataset EGAD00001008975

• Exome Sequencing of 44 subjects with very severe or fatal COVID-19

  In this study, the DNA of 44 subjects with severe COVID-19 have been sequenced in order to explore rare genetic variants.

  Dataset EGAD00001008993

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• Mutation analysis of 77 genes in cfDNA from metastatic CRC patients

  Aligned NGS data (BAM) of 77 frequently mutated genes in cancer using the AVENIO Expanded platform.

  Dataset EGAD00001010294

• Targeted sequencing data on sequential liquid biopsy samples from mCRPC patients receiving cabazitaxel

  Sequencing data from mCRPC patients receiving cabazitaxel. Targeted sequencing data of prostate cancer relevant genes using the PCF-SELECT capture panel. cfDNA from baseline, on-treatment and progression samples taken on cabazitaxel were sequenced as well as patient match WBC DNA

  Dataset EGAD50000001840

• Single cell multi modal dataset of bone marrow samples from follicular lymphoma patients at diagnosis et one year post treatment

  This dataset contains transcriptome, BCR, TCR and HTO data at the single cell level from follicular lymphoma bone marrow samples at diagnosis (n=19) and one year post rituximab therapy (n=16).

  Dataset EGAD50000001843

• Human embryonic stem cells dopaminergic neurons scRNA-seq

  The dataset includes 2 samples of Single cell RNA-seq (10X Genomics) from Human Embryonic stem cells. 2 samples with 2 replicates of timepoints 17 and 28 of dopaminergic neuron differentiation.

  Dataset EGAD50000001592

• Melanoma transcriptomic data from patients undergoing immunotherapy

  This dataset contains raw RNA sequencing data from melanoma patient tumor samples collected before and during immunotherapy. The data support investigation of treatment-related changes in tumor cell populations. Samples were analyzed as part of a study exploring cellular responses to immune-based therapies.

  Dataset EGAD50000001569

• RNAseq dataset of ovarian cancer patients

  Dataset of transcriptomics data from a cohort of individuals diagnosed with ovarian cancer. This dataset includes RNAseq sequencing data from 68 individuals. A total of 109 tumor samples were sequenced. Samples were prepared with the Illumina TruSeq Stranded RNA library. Sequencing data are paired end.

  Dataset EGAD50000001556

• Single cell RNAseq, TCRseq, BCRseq and CITE-seq of deep cervical lymph nodes from Multiple sclerosis patients

  These raw sequencing dataset includes 10x Genomics 5' scRNA-seq, TCR-seq, BCR-seq, and CITE-seq profiles of cells isolated from the deep cervical lymph nodes of six Multiple sclerosis (MS) patients.

  Dataset EGAD50000001233

• High-grade serous ovarian carcinoma tumour whole genome sequencing variants

  Tumour somatic variants (in VCF format) called from paired tumour-germline whole genome sequencing (using IDT library preparation system followed by sequencing on Illumina NovaSeq platform) of three high-grade serous ovarian tumour samples. The dataset comprises three VCF variant files.

  Dataset EGAD50000001131

• Whole Exome Sequencing Data of 34 indolent primary renal B-Cell lymphoma cases

  Here, 34 iNHL samples were sequenced using whole exome sequencing to describe the mutational landscape of indolent primary renal B-Cell lymphomas. Mutational profiles were compared to other Marginal Zone Lymphomas.

  Dataset EGAD50000001136

• Exome - Uveal Melanomas

  Whole exome sequencing on 11 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the SureSelectXT2 Clinical Research Exome V2 kit (Agilent, 5190-9500 and G9621B). Paired-end libraries (2 x 100 bp) were sequenced on HiSeq 2000/2500 or NovaSeq 6000 instruments (Illumina).

  Dataset EGAD50000000767

• Spatial transcriptomics of hepatoblastoma

  10X Genomics Visium Spatial transcriptomics analysis of hepatoblastoma and adjacent normal liver. Spatial data of normal liver and PT2 (fastq files), and and PT13, PT14 and PT16 (bam files) using the Visium Spatial Gene Expression Solution. All samples, except PT13, were collected post-chemotherapy.

  Dataset EGAD50000000797

• Whole Exome Sequencing Data of prDLBCL

  We used sequenced 34 prDLBCL samples using whole exome sequencing (WES) data to evaluate possible mutational signatures and driver mutations associated with the patient’s clinical and cytogenetic characteristics.

  Dataset EGAD50000000591

• Variants Derived From Kids Heart BioBank TOF Probands (Australia)

  Short variants identified in 245 TOF probands enrolled through the Kids Heart BioBank (Australia).

  Dataset EGAD50000000839

• Variants Derived From CONCOR Biobank TOF Probands (Netherlands)

  Short variants identified in 125 TOF probands enrolled through the CONCOR Biobank (Netherlands).

  Dataset EGAD50000000837

• Paired whole genome sequencing of tumor-control pairs of Thymic epithelial tumors -Additional Dataset

  Paired whole genome and exome sequencing of tumor-control pairs of Thymic epithelial tumors, additional samples with paired fastq files, sequenced on Illumina-HiSeq_X_Ten and using the Illumina_TruSeq_Nano_DNA kit.

  Dataset EGAD50000000325

• Longitudinal WES data from MEMORI trial

  70 bam files generated from deep whole exome sequencing from samples from oesophageal adenocarcinoma from 17 patients. 17 bam files generated from deep whole exome sequencing from matching blood (germline control) from patients with oesophageal adenocarcinoma. Samples were collected within the clinical MEMORI trial.

  Dataset EGAD50000000355

• EBNA2 ChIP-Re-ChIP in primary B-cells infected with EBV virus

  EBNA2 ChIP-Re-ChIP in primary bulk B cells 4 days post EBV-infection with B95-8. DNA binding elements of the viral master regulator EBNA2, EBNA2-CBF transcription factor complex or EBNA2-EBF1 transcription factor complex were analyzed to identify virally targeted genes.

  Dataset EGAD50000000301

• Single-cell TCR sequencing data of patients with T follicular helper cell lymphomas

  This dataset contains single-cell TCR sequencing data generated by the Cellranger pipeline (v3.1.0, 10X Genomics) from 9 LN and 16 PB samples of 14 patients with T follicular helper cell lymphomas (TFHLs) as well as 7 homeostatic LN (HLN) samples.

  Dataset EGAD50000000403

• Single-cell RNA sequencing data of patients with T follicular helper cell lymphomas

  This dataset contains single-cell count data generated by the Cellranger pipeline (v3.1.0, 10X Genomics) from 9 LN and 16 PB samples of 14 patients with T follicular helper cell lymphomas (TFHLs) as well as 7 homeostatic LN (HLN) samples.

  Dataset EGAD50000000402

• Single-cell BCR sequencing data of patients with T follicular helper cell lymphomas

  This dataset contains single-cell BCR sequencing data generated by the Cellranger pipeline (v3.1.0, 10X Genomics) from 5 LN and 1 PB samples of 5 patients with T follicular helper cell lymphomas (TFHLs) as well as 7 homeostatic LN (HLN) samples.

  Dataset EGAD50000000400

• Illumina Infinium MethylationEPIC Array IDAT files generated from 11 glioma patient samples

  This dataset includes IDAT files from 6 IDH-mutant, 5 IDH-wild-type glioma patient samples of unmatched initial and recurrent timepoints profiled using the Illumina Infinium MethylationEPIC Array.

  Dataset EGAD00010002157

• LITS

  Difference in gene expression values between case and control, log2 values. Blood transcriptome from women participating in the Norwegian Women and Cancer study (NOWAC) Post-genome Cohort taken up to eight years before brest cancer diagnosis. Illumina HumanWG-6 version 3 or Illumina HumanHT-12 expression bead chip, combined on identical nucleotide universal identifiers.

  Dataset EGAD00010001400

• Genomics analysis of mucinous tumours of the ovary and related neoplasms

  To perform genetic and gene expression analyses on mucinous ovarian tumours to determine a progression model, cell of origin and novel therapeutic targets.

  Study EGAS00001003545

• Whole genome sequence data from Illumina HiSeqX instruments

  This dataset includes bam files from 120 samples. These samples were sequenced using 2x150bp reads on an Illumina HiSeqX sequencer and aligned using the Isaac aligner. All samples were processed with TruSeq DNA PCR-free sample preparation.

  Dataset EGAD00001003562

• Genome-wide data of Erasmus Rucphen Family (ERF) Study

  The data consists of 678189 genome-wide polymorphic variants of 3658 individuals from ERF/GRIP region in a variant call format (vcf) file. ERF has been genotyped with different genotyping platform: Illumina 318 k, 350 k, 610 k and Affymetrics 200 k.

  Dataset EGAD00001003571

• Whole Exome Sequencing of a Melanoma Patient with Acquired Resistance to MEK plus CDK4/6 Inhibition

  Longitudinal biopsies from a melanoma patient who initially responded to MEK plus CDK4/6 inhibitor therapy were whole exome sequenced to identify potential resistance mutations. The biopsies included normal tissue, pre-treatment, on-treatment, and several post-resistance timepoints.

  Dataset EGAD00001003989

• ChIPseq of neuroblastoma

  This dataset contains 4 samples (2x input and 2x H3K27ac ChIPseq) in the IC-pPDXC-63 cell line.

  Dataset EGAD00001006557

• Exome sequencing in patients with Oliver McFarlane Syndrome

  In this work, using exome sequencing, we identified biallelic PNLPA6 mutations in patients with childhood blindness due to severe photoreceptor death and clinical features of Leber congenital amaurosis (LCA) and, interestingly, also of the rare Oliver McFarlane Syndrome

  Dataset EGAD00001001042

• BASIS BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001337

• Genomic Landscape of Radiation Induced Meningiomas

  EGAS00001002317 - Whole exome sequencing of data of 18 RIMs with matched bloods. Median depth of 112x (range of 110-120). Performed on Illumina HiSeq Platform. EGAS00001002318 - RNA sequencing data of 18 RIMs on the Illumina HiSeq Platform.

  Dataset EGAD00001004358

• Transcriptomic origins of mpMRI visibility

  We profiled the transcriptomes (RNA-sequencing) of 40 clinically significant invisible and visible tumors, all with ISUP Grade 2 disease and treated by radical prostatectomy. Twenty tumors were mpMRI invisible (PI-RADSv2: 1-2), while 20 tumors were visible (PI-RADsv2: 5).

  Dataset EGAD00001004397

• Somatic genetic basis of Wilms’ tumour

  We investigated the somatic genetic basis of Wilms’ tumour and found complex phylogenetic relations between tumours.

  Dataset EGAD00001004774

• Human tumour and matched-normal single-cell RNAseq

  We profiled 16 high-grade gliomas patient tumour samples by single-cell and single-nuclei RNA-seq and 3 normal-matched single-cell RNA-seq using 10X Chromium 3'. The fastq files are provided.

  Dataset EGAD00001006097

• single-cell RNA sequencing data of BALF and blood cells obtained from COPD patients and control donors

  The dataset consists of FASTQ files from Seq-Well and some Chromium (10x Genomics) libraries from 10 control donors and 10 COPD GOLD2 patients.

  Dataset EGAD00001006069

• CONTAGIOUS trial - COVID-19 16S dataset

  16S amplicon data of nasopharyngeal swabs in a COVID-19 cohort recruited at UZ Leuven. The dataset contains a single experiment, comprising 150 runs corresponding to 125 unique samples. Runs comprise paired fastq files (2*250 bases) obtained from an Illumina MiSeq instrument.

  Dataset EGAD00001006864

• Evaluation of capture and amplicon-based targeted sequencing methods on formalin-fixed tumours

  Three capture (Agilent’s SureSelectXT HS, Illumina’s Nextera Rapid Capture Custom, and New England Biolabs’ Next Direct Custom) and one amplicon-based (Qiagen’s Human Breast Cancer Panel) targeted sequencing methods on 6-8 paired blood and FFPE from the Malaysian Breast Cancer Cohort.

  Dataset EGAD00001006879

• RNA-Seq data on multiple myeloma CD138positive bone marrow plasma cells

  RNA-Seq data on multiple myeloma CD138positive bone marrow plasma cells, 11 samples, sequenced on HiSeq 4000 and HiSeq X-Ten, using mostly the TruSeq stranded mRNA Kit.

  Dataset EGAD00001008619

• miRNA and mRNA transcriptome data

  This dataset contains 278 miRNA and 20 mRNA transcriptomes generated as part of the study "miR-374a-5p regulates inflammatory genes and monocyte function in inflammatory bowel disease."

  Dataset EGAD00001008683

• SmartSeq2 index cultures

  SmartSeq2 read out of index cultured cell sorted with the classification and erythroid-myeloid panel developed in main Figure 6.

  Dataset EGAD00001008187

• Whole-exome sequencing of IMFT tumor samples f

  Whole-exome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007803

• A molecular atlas of the human postmenopausal fallopian tube and ovary from single-cell ATAC sequencing

  This datasets contains raw sequencing fastq data of14 samples from 5 donors of single cell ATAC using10x genome technology of human postmenopausal fallopian tube and ovary tissues.

  Dataset EGAD00001010077

• sWGS data of Pap test smears and tumor tissues

  Shallow whole-genome sequencing data divided into three groups: - sWGS data from Pap smears of patients with confirmed high grade serous ovarian cancer - sWGS data from matched tumor tissue (at diagnosis) from the same patients - sWGS data from Pap tests smears of healthy women

  Dataset EGAD00001010141

• Genome and transcriptome sequence data from a neuroblastoma tumor patient

  Genome and transcriptome sequence data from a neuroblastoma patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015264

• Genome and transcriptome sequence data from a neuroblastoma tumor patient

  Genome and transcriptome sequence data from a neuroblastoma patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015265

• Genome and transcriptome sequence data from a neuroblastoma tumor patient

  Genome and transcriptome sequence data from a neuroblastoma patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015267

• HCA Organoid | Colon - a cohort-scale multi-omic atlas of human colon organoids and matched primary tissue biopsies.

  Single-nucleus multiome sequencing data (snRNA-seq + snATAC-seq) from healthy tissue of 81 donors with colorectal cancer (71 matched organoid and primary tissue; 10 with one sample type only), generated as part of the Human Cell Atlas Organoid Project.

  Dataset EGAD00001016153

• Aerobiology, Immunology, and Mycobacterium Tuberculosis Transmission

  We submit data from the TB Aerobiology, Immunology and Transmission (TBAIT) study examining clinical and transcriptomic characteristics associated with Tuberculosis cough aerosolization. From a prospective longitudinal cohort of 142 participants with previously untreated pulmonary Mycobacterium tuberculosis (Mtb) infection, we assessed presence of culturable Mtb aerosols using a cough aerosol sampling system (CASS), as well as other clinical, microbiologic, and immunologic characteristics. We performed whole blood transcriptional profiling (submitted here) on a convenience subset of 29 cough aerosol culture (CAC) positive participants and 29 CAC negative participants, using Illumina NextSeq RNA Sequencing (RNA-Seq).

  Study phs003727

• Acute lymphoblastic leukemia in children produces endogenous T-cells targeting tumor associated antigens and neoantigens in peripheral blood

  In this study we investigated the presence of endogenous T-cells recognizing private tumor-associated antigens and predicted neoantigens. To this end, HLA-I and HLA-II restricted tumor associated antigens (TAAs) and neoantigens were respectively identified and predicted from matched tumor and germline (PBMCs) in three acute lymphoblastic leukemia patients. Circulating T-cells targeting both Mass spectrometry (MS)-identified TAAs and predicted neoantigens were identified in virtually all pediatric BCP-ALL patients, extending up to two years on remission.

  Study EGAS50000000925

• Nurminen et al ("GP2Men") Study Primary and Metastatic Prostate Cancer Whole Genome Sequence Data

  We used novel processing techniques to obtain whole genome data together with 3D anatomic and histomorphologic analysis in two men (GP5 and GP12) with high risk PrCa undergoing radical prostatectomy. A total of 22 whole genome-sequenced sites (16 primary cancer foci and 6 lymph node metastatic) were analyzed using evolutionary reconstruction tools and spatio-evolutionary models. Probability models were used to trace spatial and chronological origins of the primary tumor and metastases, chart their genetic drivers, and distinguish metastatic and non-metastatic subclones.

  Study EGAS50000000005

• ATAC sequencing of Treg cell subsets

  Within the investigator-initiated clinical trial Charact-IL-2 (ClinicalTrials.gov Identifier: NCT03312335), we treated 12 female systemic lupus erythematosus patients with low-dose interleukin-2. From this study we identified four distinct interleukin-2-driven regulatory T (Treg) cell subsets. This study aimed at defining chromatin accessability and predict transcriptional regulation of HLA-DR– CD38– Treg cells, HLA-DR+ CD38– Treg cells, HLA-DR– CD38+ Treg cells, and HLA-DR+ CD38+ Treg cells. Treg cell subsets were isolated from 500ml blood pooled from four healthy donors by flow cytometry sorting.

  Study EGAS50000000457

• Somatic Histone H3 Mutations in Diffuse Intrinsic Pontine Gliomas and Non-Brainstem Paediatric Glioblastomas

  To identify somatic mutations in paediatric diffuse intrinsic pontine gliomas (DIPGs), we performed whole genome sequencing of 7 DIPGs and matched germline DNA, and targeted sequencing of an additional 43 DIPGs and 36 non-brainstem paediatric glioblastomas (non-BS-PGs). 78% of DIPGs and 22% of non-BS-PGs contained K27M mutation in H3F3A, encoding histone H3.3, or the related HIST1H3B, encoding histone H3.1. An additional 14% of non-BS-PGs had somatic G34R H3F3A mutations.

  Study EGAS00001000192