15070 results for "cancer studies using rna-seq"

in 199.60 milliseconds.

• Single-cell multi-omics reveals clonal evolution and T-cell dynamics underlying differential responses to ibrutinib in Waldenström macroglobulinemia.

  To elucidate the molecular basis underlying differential response and resistance to ibrutinib in Waldenström’s macroglobulinemia (WM), we conducted a prospective phase II trial (NCT02604511) of ibrutinib monotherapy in treatment-naïve patients. Seventy-four sequential bone marrow (BM) aspirates from 17 patients, collected from baseline through 48 treatment cycles, were profiled using single-cell RNA and V(D)J sequencing.

  Study EGAS50000001596

• Capture Hi-C on Hodgkin lymphoma cell line L-428

  In situ promoter capture Hi-C on Hodgkin lymphoma cell line L-428 in experimental triplicates. Hi-C libraries were prepared as previously described (Orlando et al., 2018, https://currentprotocols.onlinelibrary.wiley.com/doi/pdf/10.1002/cphg.63). Promoter capture was based on 32,313 biotinylated 120-mer RNA baits (Agilent). Hi-C libraries were sequenced using Illumina HiSeq 2000 technology. The files are in FASTQ format.

  Study EGAS00001003032

• Development and Use of Network Infrastructure for High-Throughput GWA Studies

  The "Development and Use of Network Infrastructure for High-Throughput GWA Studies" project is collaboration between Group Health Cooperative (GH), the University of Washington (UW), and the Fred Hutchinson Cancer Research Center (FHCRC). It is one of 5 sites participating in The Electronic Medical Records and Genomics (eMERGE) Network funded by the National Human Genome Research Institute (NHGRI) with additional funding from the National Institute of General Medical Sciences (NIGMS). The overall eMERGE project is designed to assess whether linking biorepositories of patients in healthcare delivery systems with electronic medical records (EMRs) is an efficient strategy for high-throughput genome wide association (GWA) studies and whether information can be pooled across sites. The primary phenotype in the Group Health/UW Aging and Dementia eMERGE study project is dementia. Phenotyped participants originated from four population-based sources. Seattle-area members of GH (a large integrated health care system in Washington State) consented and enrolled in 1) the University of Washington Alzheimer's Disease Patient Registry (ADPR) and 2) the Adult Changes in Thought (ACT) study, 3) Marshfield Clinic Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults, 4) Vanderbilt's BioVU, a de-identified DNA biobank. The ADPR (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is a population-based registry of incident dementia cases designed to identify all new dementia cases within GH from 1987 to 1996. Potential dementia cases were identified through referrals from primary care physicians, mental health services, and neurologists, as well as review of CT scans, neurology, emergency room, geriatrician, and mental health clinic logs, and hospital discharge diagnoses. Medical history, physical, laboratory testing, and neuropsychological testing were performed on all consenting potential cases. These data were reviewed by a consensus conference including a neuropsychologist, study physicians, and an epidemiologist. After discussion of the case, dementia status is assigned using DSM-III-R criteria. Alzheimer's disease status was assigned using the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria. The study base of the ADPR population was stable with an attrition rate of less than 1%/year. The ACT study (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is an ongoing community-based cohort study designed to determine the incidence of Alzheimer's Disease (AD), other types of dementia, and cognitive impairment and to determine risk factors for these conditions. The original cohort of 2,581 was enrolled in 1994-1996. An expansion cohort of 811 was enrolled in 2000-2002. Continuous enrollment to keep 2,000 persons enrolled and at-risk for dementia outcomes was begun in 2005. To date the study has accrued more than 4,000 participants. Dementia-free participants are enrolled in this cohort and evaluated every two years by study personnel with many evaluations including an assessment of cognitive functioning using the Cognitive Abilities Screening Instrument (CASI), which is an extended version of the Mini-Mental State Examination that has been widely used in epidemiological studies of the elderly. Persons with CASI scores lower than 86 or in whom interviewers suspect unusual cognitive decline are followed up with dementia diagnostic evaluations which include physical and neurological examinations and neuropsychological tests. Medical records are reviewed, and laboratory tests and neuroimaging are obtained if not available. The dementia diagnoses and dementia subtypes are determined during a consensus conference attended by the examining clinicians and other study physicians, a neuropsychologist, and research nurse. After discussion of the case, dementia status is assigned using DSM-IV criteria. Alzheimer's disease status was assigned using NINCDS-ADRDA criteria. Individuals diagnosed with dementia are seen again one year following diagnosis using the same procedures. Individuals not diagnosed with dementia are returned to the pool of at-risk individuals and are seen at their next routinely scheduled biennial visit. The ACT sub-sample is stable; for the original cohort, median enrollment in GH was 19 years prior to joining the ACT study, and 85% of the cohort has ≥ 10 years of GH enrollment. DNA for the ADPR participants were obtained through a companion study, Genetic Differences in Cases and Controls (PI: Walter Kukull; NIH/NIA R01 AG007584). DNA obtained through both studies were extracted from blood using Gentra Systems Puregene methods. DNA concentration is determined by UV optical density. All samples are checked for quality by OD 260/280 ratio. For long-term storage, samples are aliquoted and stored at -70°C. The Marshfield study, Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults. PMRP was started in 2002 as a 3 Phase project. Completed in April 2004, the objectives of Phase I were to build and develop a large population-based biobank with DNA, plasma and serum samples to facilitate genomics research. Phase 1 was also to educate, inform and consult with the Marshfield Epidemiologic Study Area population and communities concerning potential studies, create the DNA foundation of the personalized medicine database and build the bioinformatics tools to store securely and analyze genotypic and phenotypic data. Phase I tasks included operation of the ethics and security advisory board, scientific advisory board and community advisory group. More than 18,000 residents aged 18 and above from 19 different zip codes surrounding Marshfield, WI were invited to participate in Phase I. After providing written informed consent, participants completed brief questionnaires that included questions about demographics, some environmental exposures, family history of disease, and adverse drug reactions, as well as family members living in the area. Participants provided 50ml of blood from which DNA was extracted and plasma and serum samples were stored. The informed consent process allowed access to electronic medical records and included language about non-disclosure of personal research results. A tick-off box was included so that participants could either allow or decline subsequent recontact for future research studied. The objectives of Phase II are to create the phenotypic database, establish the scientific and administrative infrastructure to support genetic mapping of the DNA and the initial discovery projects and genotype a sufficient portion of the genetic material to support these discovery projects. The objectives of Phase III are to expand the discovery projects, complete the genotyping of the genetic database and expand physician/health care provider education and community consultation. The Vanderbilt BioVU model uses discarded blood leftover from clinical care and de-identified clinical information, both of which are tracked with a Research Unique Identifier that is permanently disconnected from the medical record number used to generate it. The Vanderbilt IRB determined that the project does not qualify as "human subject" research under §46.102(f)(1)(2). The program has been reviewed by OHRP twice (the latest immediately prior to launch), and the determination of the Vanderbilt IRB that the project is consistent with the 8/10/2004 guidance has been validated. The model includes a simple opt out mechanism developed for patients who do not wish to have their samples included. Planning (including community involvement, ethics and IRB discussions, focus groups, development of operating procedures and pilot studies to assess them) began in May 2004, and the resource commenced sample collection in February 2007 and as of May 2009 contains approximately 56,000 samples. The current resource will be available to all Vanderbilt investigators who sign a Data Use Agreement. The resource represents Vanderbilt's broad patient population and thus provides a potential resource for research in a range of common and rare diseases as well as drug response or medication safety. BioVU patient protection model: There has been extensive involvement by the ethics community and the IRB to put in place procedures to provide privacy protection. The overall protection plan is multifaceted and includes a combination of technology and policy: (1) creation of the SD described above; (2) return of only the specific clinical data items requested by investigators (rather than the complete de-identified chart); (3) submission of any specific proposed project to the IRB and to a separate protocol review committee, both of which must approve; (4) implementing a Data Use Agreement that permits only approved queries and data analyses, specifically prohibits attempts at re-identification (at the risk of institutional sanctions), and mandates redeposit of all genetic information generated in a research study back into a genomic database; and (5) tracking and auditing all use.

  Study phs000234

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• Long read mRNA sequencing of human neural retinal samples - Usher syndrome transcript landscape

  Long-read (PacBio) RNA sequencing dataset of three neural retinal samples. Three PacBio libraries were prepared according the 'standard workflow' optimized for sequencing transcripts centered around 2kb. Additionally one Library (input HNR_S2) was prepared according an optimized 'long workflow' to enrich for larger transcripts up to >10kb. To further enhance the capture of full-length transcripts for USH2A and ADGRV1 (USH2C) genes, we also employed a targeted enrichment approach using the Samplix Xdrop System, followed by PacBio long-read sequencing. USH2A and ADGRV1 enrichment was performed by targeting '5- mid and 3' targets of the respective genes. Finally, we also added ONT (Oxford Nanopore technology) long-read mRNA sequencing of three independent neural retina samples. These data were used for the validation of events observed from the Iso-Seq and Samplix data. The ONT datasets contain sequencing data of the Usher-associated genes. Files are raw BAM, and CRAM format files generated by a Sequel II machine. Additionally, the ccs3 BAM format files are included.

  Dataset EGAD50000000720

• A comprehensive assessment of somatic mutation detection in cancer using whole genome sequencing

  As whole genome sequencing for cancer genome analysis becomes a clinical tool, a full understanding of the variables affecting sequencing analysis output is required. Using tumor-normal sample pairs from two different types of cancer, chronic lymphocytic leukemia and medulloblastoma, we conducted a benchmarking exercise within the context of the International Cancer Genome Consortium. We compare sequencing methods, analysis pipelines, and even validation methods. Here we show that using PCR-free methods and increasing sequencing depth to ~100x showed benefits, as long as the tumor:control coverage ratio remains balanced. We observe widely varying mutation call rates and low concordance among analysis pipelines, reflecting the artifact-prone nature of the raw data and lack of standards for dealing with the artifacts. However, armed with the benchmark mutation set we have created, we show that many issues are in fact easy to remedy and have an immediate positive impact on mutation detection accuracy.

  Study EGAS00001001539

• Germline and Somatic Genetic Landscape of Pediatric Rhabdomyosarcoma

  Dynamic approaches that integrate population-based research and molecular biology are needed to explain the mechanisms underlying pediatric rhabdomyosarcoma (RMS) and to determine novel prevention strategies. RMS, the most common soft-tissue sarcoma in children and adolescents, has one of the poorest 5-year survival rates among all pediatric cancers (less than 65%). One of the strongest risk factors for RMS is having a cancer predisposition syndrome. The syndromes that are most commonly seen among those with RMS are Li-Fraumeni, neurofibromatosis type 1, Costello, Noonan, and DICER1. Based on smaller clinic-based studies, only about 7% of RMS cases are thought to be associated with the genes responsible for these syndromes. However, there have been no population-based assessments to support this estimate. Even in the most recent large-scale evaluations of germline mutations in predisposition genes among children with cancer, very few RMS cases were included (43 cases). Furthermore, no distinctions were made between the major histologic subtypes of RMS: embryonal (eRMS) and alveolar (aRMS), which display differences in terms of age distribution, incidence, and cytogenetics. For instance, nearly 80% of alveolar cases are driven by a chromosomal translocation between either PAX3 or PAX7 and FOXO1, whereas these fusions are not seen in embryonal cases. In fact, RMS research is shifting from categorization based on histology to fusion status (eRMS is overwhelmingly fusion-negative). Another limitation in previous studies has been the inability to evaluate the frequency of de novo germline mutations (DNMs) in cancer predisposition genes due to the absence of any well-characterized cohorts of RMS case-parent trios. Therefore, a major gap in our understanding of the role of cancer predisposition in pediatric RMS that limit translational impact is there have been no population-based assessments to determine the true impact of these mutations on pediatric RMS, which limits clinical sequencing guidelines and surveillance protocols in these children.Overall Project Strategy: The objective of this project is to advance our understanding of the relationship between cancer predisposition genes and pediatric RMS. Our central hypotheses are: 1) mutations in cancer predisposition genes are more common than expected in children with RMS; and 2) children with fusion-negative tumors have a higher burden of germline mutations than those with fusion-positive tumors. The framework for this study relies on >600 well annotated samples collected from newly diagnosed RMS patients and stored in the Children’s Oncology Group (COG) Biopathology Center.

  Study phs002304

• Genomic data used in "ACT-Discover: identifying karyotype heterogeneity in pancreatic cancer evolution using ctDNA"

  Genomic data used in "ACT-Discover: identifying karyotype heterogeneity in pancreatic cancer evolution using ctDNA"

  Dataset EGAD00001010250

• Identification of responsible genes and development of standardized medicine for familial breast cancer by genetic analysis with NGS technology

  Aims: To clarify risk of germline variants of known causal genes for Hereditary Breast Ovarian Cancer Syndrome in Japan by combinatorial analysis of somatic and germline variants in the breast cancer tissue. Methods: Target caputure analysis by using Illumina HiSeq 2000; the panel genes are 119 genes including 30 HBOC known causal genes. Participants/Materials: 108 whole blood and 124 primary tumor samples from familial breast cancer patients.

  Study JGAS000224

• Whole-Exome Sequencing analyses in tamoxifen-associated endometrial cancer

  An increased incidence of endometrial cancer has been described for patients that have received tamoxifen to treat breast cancer. Using samples from endometrial tumors, isolated from surgivcal specimens of patients who previously received tamoxifen treatment for breast cancer, we aimed to identify whether there are specific somatic mutations enriched in this population, relative to endometrial tumors from the general population. For this, WES was performed on matched endometrial tumors and healthy tissue (n=21).

  Study EGAS00001006453

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• ADAGESIII: Contribution of genotype to glaucoma phenotype in African Americans

  Glaucoma results in vision loss due to damage of the optic nerve that is irreversible if undetected or untreated. The most common form of glaucoma is primary open angle glaucoma (POAG). While glaucoma affects all races, persons of African descent are disproportionately affected; studies show African-Americans (AAs) are about four to five times more likely than Caucasian Americans to develop the disease. Glaucoma is the leading cause of irreversible blindness in Americans of African descent, and the second leading cause in all Americans. The lack of understanding about the etiology of POAG impedes our ability to identify and treat it early in its development. Evidence of genetic contribution in the pathogenesis of POAG is well established. Since POAG tends to run in families, it is critical to identify the genetic basis of the disease in order to develop effective therapies for early intervention. While genome wide association studies (GWAS) for glaucoma have been completed for Caucasian populations, evidence from other studies suggests that a GWAS of glaucoma specific genes to the African-American population will yield unique and important findings for both this population and for glaucoma in general. A better understanding of the relationship among the stage of disease, the rate of change, ancestry, and other important risk factors being tracked in the ongoing African Descent and Glaucoma Study (ADAGES) will allow us to evaluate the relationship between genetics, visual loss and structural damage in this high-risk cohort. The scientific plan for this new study focuses on glaucoma in ∼2058 African-Americans by detailed phenotyping of new subjects, acquisition of samples from both new and established previously phenotyped study subjects for a repository, establishment of a data coordinating center, and genome wide association studies. The recruitment, enrollment, and phenotyping of both established and new subjects occurs at five clinical centers, University of California (UCSD), New York Eye and Ear Infirmary (Mt Sinai) and Columbia University Medical Center, a private practice in the Atlanta area, the University of Alabama at Birmingham, and the Robert Cizik Eye Clinic in Houston, TX. UCSD is also the location for the Data Coordinating Center and the Repository with Robert N. Weinreb as Principal Investigator. LA BioMed at Harbor-UCLA did the genotyping with a GWAS panel of ∼1 million single nucleotide polymorphisms (SNPs) using the Illumina MEGA array under the direction of Jerome Rotter, Ida Chen, and Kent Taylor.

  Study phs001673

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Modulation of Lung Immune Responses to Viral Infection-Microbiome Interactions with Respiratory Organoids

  Here, we colonized bronchial epithelial air-liquid interface tissue cultures with 58 different individual microbes. Following 18 and 48 hours of colonization, we performed bulk RNA-seq of the host epithelial cells (n=3). Overall, we found significant microbial species-level and strain-level variation in host gene expression changes for innate immunity and epithelial barrier genes. Of particular interest, we found significant heterogeneity in stimulation of host interferon and antiviral interferon-stimulated genes.Study registered in ImmPort under accession # SDY2281.

  Study phs003627

• Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application

  We established hypoimmunogenic human induced pluripotent stem cells (iPSCs) to minimize the immune rejection caused by mismatches of HLA type. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified.

  Study EGAS50000001194

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, various peripheral blood immune cell subsets from 136 systemic lupus erythematosus (SLE) and 89 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA, Naive_CD8, Naive_B, SM_B, USM_B, DN_B, Plasmablast, NK, CD16p_Mono, CL_Mono, Neu, mDC, pDC, TEMRA_CD8, CM_CD8, EM_CD8, NC_Mono, Int_Mono, LDG). RNA-seq was performed with each cell subset samples.

  Study JGAS000627

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, 24 peripheral blood immune cell subsets from 50 Systemic Sclerosis and 48 Healthy Controls were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono, Int_Mono, NC_Mono, mDC, pDC). RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000296

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 89 healthy volunteers and 136 systemic lupus erhythematosus (SLE) donors were collected (Naive_CD4, Mem_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, NK, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, Neu, LDG). 22 SLE donors were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000486

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• Paired exome analysis in urothelial carcinoma

  In this study we characterized genomic alterations in two to five metachronous tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth), Ultra deep targeted sequencing (~6,809x mean read depth) and whole transcriptome RNA-seq was performed for all samples. In addition multiregional WES was performed on 8 adjacent regions from a single tumor.

  Study EGAS00001001686

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Genomic alterations in MM - CEL

  RNA from the same tumor sample (n=98) was also processed using the 3' IVT kit (Affymetrix) and hybridized to U133 Plus 2.0 arrays (Affymetrix).

  Dataset EGAD00010001577

• Single-cell RNA-sequencing of H3-K27M diffuse midline glioma.

  Fastq files are deposited for single-cell transcriptomes of patient H3-K27M diffuse midline gliomas, generated using the SMART-seq2 method.

  Dataset EGAD00001011339

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• Title: Divergent levels of CD112 and INKA1 define a distinct subset of human long-term hematopoietic stem cells

  The data provided here was critical in establishing that human long-term hematopoietic stem cells (LT-HSC), previously described as the most primitive HSC population, is actually composed of distinct subsets that can be prospectively isolated. Via mechanistic studies centering around the Rho-GTPase effector kinase PAK4 and its inhibitor INKA1, we identified the immune checkpoint ligand CD112 as a marker for hematopoietic stem and progenitor cells, that is highest expressed on LT-HSC. More importantly, CD112 can be used to stratify functionally distinct subsets within LT-HSC: In response to regeneration-mediated stress, the CD112low subset exhibits a transient restraint (termed latency) before contributing to hematopoietic reconstitution, while the CD112high subset is primed to respond rapidly. High resolution RNA-seq of the CD112 surface expression spectrum within rare LT-HSC subsets (human umbilical cord blood) demonstrated that more genes are differentially upregulated in the deeper quiescent and less metabolic active subset. Genes enriched in this subset centre around cell adhesion and Rho-GTPase signaling. This is in agreement with the scRNAseq data from human G-CSF mobilized peripheral blood (mPB) generated here that was used as an model of in vivo activation/priming revealing via RNA-velocity and pseudo-time analysis that INKA1high versus PAK4high, CDK6high and CD112high enrichment are either detected early or late in diffusion pseudotime indicative of quiescent versus primed cell status, respectively. RNAseq following INKA1 overexpression in LT-HSC and ST-HSC revealed by GSEA an overall stemness preserving phenotype and particularly in LT-HSC, but not in short-term HSC (ST-HSC), suppression of transcriptional programs linked to activation. Collectively, our data decipher the molecular intricacies underlying HSC heterogeneity and self-renewal regulation and point to latency as an orchestrated physiological response that integrates quiescence control with HSC fate choices to preserve a stem cell reservoir.

  Dataset EGAD00001006541

• 5' Single cell RNA sequencing of pre-treatment tissues from lung cancer patients receiving immunotherapy

  Study EGAS00001006188

• Fresh vs. frozen cell preparations of colorectal cancer single-cell RNA sequencing

  Study EGAS00001003769

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• A spatiotemporal organ-wide gene expression and cell atlas of the developing human heart

  The process of cardiac morphogenesis in humans is incompletely understood. Its full characterization requires a deep exploration of the organ-wide orchestration of gene expression with a single-cell spatial resolution. Here, we present a molecular approach that reveals the comprehensive transcriptional landscape of cell types populating the embryonic heart at three developmental stages, and which maps cell type-specific gene expression to specific anatomical domains. Spatial Transcriptomics identified unique gene profiles corresponding to distinct anatomical regions in each developmental stage. Human embryonic cardiac cell types identified by single-cell RNA-sequencing confirmed and enriched the spatial annotation of embryonic cardiac gene expression. In situ sequencing was then used to refine these results and create spatial subcellular map for the three developmental phases. Finally, we generated a publicly available web resource of the human developing heart to facilitate future studies on human cardiogenesis.

  Study EGAS00001003996

• The Acquisition of Molecular Drivers in Pediatric Therapy-Related Myeloid Neoplasms

  Pediatric therapy-related myeloid neoplasms (tMN) occur in children after exposure to cytotoxic therapy and have a dismal prognosis1-4. The somatic and germline genomic alterations that drive these myeloid neoplasms in children and how they arise have yet to be comprehensively described. We use whole exome, whole genome, and/or RNA sequencing to characterize the genomic profile of 85 pediatric tMN cases (tMDS: n=29, tAML: n=56). Our data show that Ras/MAPK pathway mutations, alterations in RUNX1 or TP53, and KMT2A rearrangements are frequent somatic drivers, and we identify cases with aberrant MECOM expression secondary to enhancer hijacking. Unlike adults with tMN5-7, we find no evidence of pre-existing minor tMN clones (including those with TP53 mutations), but rather the majority of cases were unrelated clones arising as a consequence of cytotoxic therapy. These studies also uncover rare cases of lineage switch disease rather than true secondary neoplasms.

  Study EGAS00001004850

• A microRNA-signature that correlates with cognition and is a target against cognitive decline

  While some individuals age without pathological memory impairments, others develop age-associated cognitive diseases. Since changes in cognitive function develop slowly over time in these patients, they are often diagnosed at an advanced stage of molecular pathology, a time point when causative treatments fail. Thus, there is great need for the identification of inexpensive and minimal invasive approaches that could be used for screening with the aim to to identify individuals at risk for cognitive decline that can then undergo further diagnostics and eventually stratified therapies. In this study we use an integrative approach combining the analysis of human data and mechanistic studies in model systems to identify a circulating 3-microRNA signature that reflect key processes linked to neural homeostasis and informs about cognitive status. We furthermore provide evidence that expression changes of this signature represent multiple mechanisms de-regulated in the aging and diseased brain and are a suitable target for RNA therapeutics.

  Study EGAS00001005627

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• EED inhibition of organoid development

  Transcriptomics and epigenomics after chemical inhibition of EED during early human brain organoid development. To investigate the role of H3K27me3 inhibition during neuroectoderm induction, we treated brain organoids with 3 concentrations of EED inhibitor (and control) during the transition of pluripotency to neuroepithelium. At the neuroepithelium stage, we profiled the organoids using scRNA-seq (transcriptome) and bulk Cut&Tag (H3K27me3, H3K27ac). Library preparation for scRNA-seq was carried out with the 10x genomics platform.

  Dataset EGAD50000000224

• DNA-seq FASTQ files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq FASTQ files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). Each sample was multiplexed across flowcells and lanes, leading to a total number of 86 FASTQ files.

  Dataset EGAD00001005756