17300 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 34.47 milliseconds.

• Genomic Translation for ALS Care (GTAC) - WGS

  To look for genetic correlates of disease progression, the GTAC study recruited patients with motor neuron disease from 13 academic medical center clinics and followed them longitudinally for up to 5 years. Participants were regularly assessed for changes in respiratory function, the ALS Functional Rating Scale, and the ALS Cognitive Behavioral Scale. Participants underwent PCR-free whole genome sequencing on the Illumina NovaSeq, as well as repeat-prime PCR assessment of the C9ORF72 repeat expansion. Participants had PBMCs and whole blood RNA banked for future correlative studies.

  Study phs002973

• DNA Methylation-based diagnostic biomarkers for ESCC in Han Chinese population

  DNA methylation-based biomarkers were suggested to be promising for early cancer diagnosis. However, DNA methylation-based biomarkers for esophageal squamous cell carcinoma (ESCC), especially in Chinese Han populations have not been identified and evaluated quantitatively. To identify the candidate DNA-methylation based biomarkers for ESCC diagnosis, we performed the targeted bisulfite sequencing analysis in this study. Based on these 94 pairs of ESCC tumors and adjacent normal tissues, we found out that ADHFE1, EOMES, SALL1 and TFPI2 could be an effective methylation-based assay for ESCC diagnosis.

  Study EGAS00001003158

• Clonal dynamics of normal haematopoiesis across the human lifespan

  Age-related loss of function in the human haematopoietic system is well documented, manifesting as reduced regenerative capacity, age-related cytopenias and immune dysfunction. However, the cellular and population level changes that underpin both this functional decline and the increased risk of clonal haematopoiesis and blood cancer in the elderly remain elusive. Here we performed whole genome sequencing on >3350 single haematopoietic stem cell / multipotent progenitors (HSC/MPP) derived colonies across 10 haematologically normal subjects aged 0 to 81. We found that HSC/MPPs accumulated 17 single nucleotide variants per year post birth and had a reduction in telomere length of 50bp per year throughout young adult life. We reconstructed phylogenies of the sampled HSC/MPPs to interrogate changes in clonal dynamics through life. Haematopoiesis in adults aged less than 65 was predominantly polyclonal, with few known driver mutations. In contrast, individuals aged over 75 displayed a profound change in clonal structure, with frequent clonal expansions, many unexplained by known driver mutations. The ratio of non-synonymous to synonymous mutations revealed widespread positive selection, estimating around 1000 driver mutations in the dataset (10-fold more than the number of known drivers). We identified novel genes ZNF318 and HIST2H3D as being under positive selection, despite not being enriched in myeloid malignancies. Our data show that HSC clonal dynamics is more complex than previously thought. One implication is that by old age, the majority of HSCs carry at least one of a number of largely undescribed driver mutations, which may underlie aspects of their functional decline.

  Dataset EGAD00001007851

• Cancer_Cell_Line_Exome_Sequencing_

  Genomic characterisation of a large series of cancer cell lines.

  Study EGAS00001000978

• Breast_cancer_topographs

  Breast cancer topography will be explored using a combination of multi-region whole geome sequencing and in-situ RNA sequencing of fixed tissue specimens.

  Study EGAS00001003698

• WGS and RNA-Seq data from a GBM patient PT-AB6372

  WGS and RNA-Seq data from a GBM patient PT-AB6372

  Dataset EGAD00001004222

• WGS and RNA-Seq data from a GBM patient PT-PR5617

  WGS and RNA-Seq data from a GBM patient PT-PR5617

  Dataset EGAD00001008525

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line RNA-Seq

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009759

• WGS and RNA-Seq data from a GBM patient PT-DM9089

  WGS and RNA-Seq data from a GBM patient PT-DM9089

  Dataset EGAD00001008518

• WGS and RNA-Seq data from a GBM patient PT-CM3220

  WGS and RNA-Seq data from a GBM patient PT-CM3220

  Dataset EGAD00001008517

• Genome and transcriptome sequence data from a pre-B all (2nd relapse in CNS) tumor patient

  Genome and transcriptome sequence data from a pre-B all (2nd relapse in CNS) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015291

• WGS and RNA-Seq data from a GBM patient PT-CM1209

  WGS and RNA-Seq data from a GBM patient PT-CM1209

  Dataset EGAD00001004231

• WXS files for MATCH paper

  WXS files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015484

• RNASeq files for Stewart-MATCH

  RNASeq files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015475

• Project for Development of Innovative Research on Cancer Therapeutics; Identifiying the predictive factors for response to chemoherapy in ovarian cancer

  To identify novel predictive biomarkers of response to chemotherapy for clear cell carcinoma of the ovary

  Study JGAS000076

• Count table for POPLAR (GO28753)

  This dataset contains counts for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008630

• CPM table for OAK (GO28915)

  This dataset contains counts per million for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008629

• Count table for OAK (GO28915)

  This dataset contains counts for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008628

• CPM table for POPLAR (GO28953)

  This dataset contains counts per million for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008631

• 160 WES and 25 WGS for HBV related HCC, and 15 WES for ICC belongs LICA-CN

  160 WES and 25 WGS for HBV related HCC, and 15 WES for ICC belongs LICA-CN

  Dataset EGAD00001003205

• Epigenetic profiles of neuroblastoma PDXs

  This dataset contains bam files for ChIP-seq experiments for 6 neuroblastoma PDXs (Patient Derived Xenograft). It includes the bam files for the H3K27ac mark as well as the bam files of the corresponding input DNA for each sample.

  Dataset EGAD00001003394

• Differentially methylated CpGs in response to growth hormone administration in children with idiopathic short stature

  Background: Recombinant human growth hormone (rhGH) has shown a great growth-promoting potential in children with idiopathic short stature (ISS). However, the response to rhGH differs across individuals, largely due to genetic and epigenetic heterogeneity. Since epigenetic marks on the methylome can be dynamically influenced by GH, we performed a comprehensive pharmaco-epigenomics analysis of DNA methylation changes associated with long-term rhGH administration in children with ISS. Results: We measured DNA methylation profiles before and after GH treatment (with a duration of ~18 months in average) on 47 healthy children using customized methylC-seq capture sequencing. Their changes were compared and associated with changes in plasma IGF1 by adjusting sex, age, treatment duration, and estimated blood proportions. We observed a considerable inter-individual heterogeneity of DNA methylation changes responding to GH treatment. We identified 267 response-associated differentially methylated cytosines (DMC) that were enriched in promoter regions, CpG islands and blood cell-type specific regulatory elements. Furthermore, the genes associated with these DMCs were enriched in the biology process of "cell development", "neuron differentiation" and "developmental growth", and in the TGF-beta signaling pathway, PPAR Alpha pathway, endoderm differentiation pathway, adipocytokine signaling pathway as well as PI3K-Akt signaling pathway, and cAMP signaling pathway. Conclusion: Our study provides a first insight in DNA methylation changes associated with rhGH administration, which may help understand mechanisms of epigenetic regulation on GH-responsive genes.

  Study EGAS00001006115

• High-resolution analysis for urinary DNA jagged ends

  High-resolution analysis for urinary DNA jagged ends

  Study EGAS00001005603

• The Oral Microbiome and Head and Neck Cancer

  Oral microbiota may influence head and neck squamous cell carcinoma (HNSCC) development, potentially related to carcinogen metabolism. The human oral cavity hosts a diverse microbiota, including bacteria and fungi. We performed shotgun sequencing and ITS1 sequencing on 236 HNSCC case participants who developed HNSCC during a mean follow-up of 5.1 years and 458 matched controls who remained HNSCC-free. Oral samples were obtained from a prospective nested case-control study within three epidemiological cohorts: the American Cancer Society Cancer Prevention Study II Nutrition Cohort (ACS CPS-II), the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial (PLCO), and the Southern Community Cohort Study (SCCS). Control participants were selected using 2:1 frequency matching based on cohort, age, sex, race and ethnicity, and time since oral sample collection.

  Study phs004018

• Germline Aberrations of PAX5 Cause Susceptibility to pre-B cell Acute Lymphoblastic Leukemia

  A novel heterozygous germline variant, c.547G>A (p.Gly183Ser), in the paired box protein encoding gene, PAX5, was found to segregate with disease in two unrelated kindreds with autosomal dominant pre-B cell acute lymphoblastic leukemia (ALL). Leukemic cells from both families exhibited 9p deletion, with loss-of-heterozygosity and retention of the mutant PAX5 allele at 9p13 . Two additional sporadic ALL cases with 9p loss demonstrated PAX5 Gly183 substitution in the leukemic cells. Functional analysis of the PAX5 germline variants demonstrated reduced transcriptional activity, as well as decreased interaction with Groucho-4. These data extend the role of PAX5 alterations in the pathogenesis of pre-B ALL, and implicate PAX5 in a novel syndrome of germline susceptibility to pre-B cell neoplasia.

  Study EGAS00001000447

• NFE2 and PF4 as Translational Biomarkers for BET Inhibition-Induced Thrombocytopenia in Preclinical and Clinical Studies

  Blood samples from patients treated with BMS-986158 were investigated for association with thrombocytopenia following BET inhibition. Hypotheses of translational biomarkers for early prediction of thrombocytopenia associated with BET inhibition were explored.

  Study EGAS50000001162

• DAC_RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Data access committee for RNA-seq of murine osteosarcoma cell line genetically modified for CYR61

  Dac EGAC50000000352

• Intellectual Disability cases with parents (trios) or affected sibs (sibpairs)

  Samples from ID cases negative for CNV through array-CGH were submitted to exome sequencing. Families with one affected individual underwent trio exome sequencing for identification of de novo variants. Families with more than one affected child underwent sibpair sequencing for identificatio of shared recessive or x-linked variants.

  Study EGAS00001003968

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of γδ T cells FACS sorted from peripheral blood of two Merkel cell carcinoma patients

  Dataset EGAD50000000137

• BipEx_Timpson_Bristol

  "BipEx_EGAS00001006274_Timpson_Bristol Controls Exomes. This research project was a collaboration between University of Bristol, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,981 Control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000144

• Massively Multiplex Single-Cell Hi-C of HeLa Cells

  In this study, we developed a massively multiplexed, single-cell Hi-C protocol to study the chromosomal architecture of single HeLa cells.

  Study phs001269

• Fungal infection in neural tissue from Amyotrophic Lateral Sclerosis

  The study shows that fungus infection, isolated from neural tissue, can be a risk factor to develop Amyothophic lateral sclerosis (ALS).

  Study EGAS00001002473

• Whole-exome sequencing of Fanconi anemia

  We performed whole-exome sequencing of two Fanconi anemia patients without mutation of known FA genes, and identified a novel FA gene FANCT.

  Study EGAS00001001103

• Benchmarking DIA-type Proteomics Using Large-Scale Inter-Patient Heterogeneity Dataset

  Benchmarking Proteomics Quantitation in DIA-type data using real patient material to create a benchmark dataset comprising inter-patient heterogeneity

  Study EGAS00001005589

• WGS and RNA-Seq data from a GBM patient PT-MB9777

  WGS and RNA-Seq data from a GBM patient PT-MB9777

  Dataset EGAD00001004253

• WGS and RNA-Seq data from a GBM patient PT-SS3647

  WGS and RNA-Seq data from a GBM patient PT-SS3647

  Dataset EGAD00001008530

• WGS and RNA-Seq data from a GBM patient PT-SJ5453

  WGS and RNA-Seq data from a GBM patient PT-SJ5453

  Dataset EGAD00001008529

• Clinical cancer panel sequencing (UCSF500) analysis of TERT promoter duplication in GBM.

  Dataset contains paired-end clinical cancer panel sequencing (UCSF500) data from 2 samples of an initial tumor and one sample of a recurrence from one GBM patient and one sample from a second GBM patient.

  Dataset EGAD00001009286

• Single-cell mRNA-sequencing to generate a transcriptomic atlas of RMS

  Single-cell mRNA-sequencing to generate a transcriptomic atlas of soft tissue sarcoma tumors

  Dataset EGAD00001009385

• RNA-seq data from the tumor samples of a head and neck cancer patient

  This dataset contains paired-end RNA sequencing data (2x50 bp) from the three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006654

• Bolleboom-Gao peri-tumoral snRNA-seq glioblastoma dataset 2022/A

  Bolleboom-Gao peri-tumoral snRNA-seq glioblastoma dataset 2022/A

  Dataset EGAD00001009964

• Single Cell Sperm from fathers of Autistic Children

  Single cell sequencing of fathers who have had children with autism and fathers who have had multiple children, but no children with autism. The data was process on a 10X Chromium and sequenced on a NextSeq

  Dataset EGAD00001006292

• DAC Recurrent resistance mutations to lirafugratinib delineate treatment sequences for FGFR2-driven tumors

  DAC for Recurrent resistance mutations to lirafugratinib delineate treatment sequences for FGFR2-driven tumors

  Dac EGAC50000000699

• Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study

  The Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study (NCT: NCT04750109) was sponsored by The Christie NHS Foundation Trust and funded by Innovate UK. Data generated include: A) Whole genome sequencing* of paired germline blood and tumour tissue B) Whole genome sequencing *of germline blood only C) Next-generation sequencing of circulating tumour DNA (FoundationOne Liquid CDX) D) Next-generation sequencing of tumour tissue (FoudationOne CDX) *Whole genome sequencing - germline sample at 30x coverage and somatic sample at 75x coverage performed by Illumina NovaSeq 6000 instrument in the 150bp PE read mode.

  Study EGAS00001008239

• B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

  B cells play a central role in the immune response to both SARS-CoV-2 infection and vaccination, but the development of the B cell receptor (BCR) repertoire in both contexts has not been defined nor compared. We analysed serial samples from 171 SARS-CoV-2-infected individuals with a range of disease severities together with 63 vaccine recipients, and found marked differences in the global BCR repertoire after natural infection compared to vaccination. Following infection, the proportion of BCRs bearing IgG1/3 and IgA1 isotypes increased, somatic hypermutation (SHM) was markedly decreased and, in patients with severe disease, expansion of IgM and IgA clones was observed. In contrast, after vaccination the proportion of BCRs bearing IgD/M isotypes increased, SHM was unchanged and expansion of IgG clones was prominent. Infection generated a broad distribution of SARS-CoV-2-specific clones predicted to target the spike protein whilst vaccination produced a more focused response mainly targeting the spike’s receptor-binding domain. These findings offer insights into how different immune exposure to SARS-CoV-2 impacts upon BCR repertoire development, potentially informing vaccine strategies.

  Study EGAS00001005816

• Single-nuclei gene-expression analysis of pheochromocytoma and paraganglioma links tumor subtypes with tumor microenvironment

  This dataset contains raw sequencing reads in FASTQ format from single-nuclei (30 samples) and bulk tissue (40 samples) transcriptome sequencing of pheochromocytoma and paraganglioma tissue specimens. Additionally, data from single-nuclei sequencing of two normal adrenal medulla specimens is included.

  Dataset EGAD00001008403

• Pancreatic Cancer Sequencing Initiative OICR

  Pancreatic Cancer Sequencing Initiative for the International Cancer Genome Consortium at the Ontario Institute for Cancer Research.

  Study EGAS00001000395

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Dataset for the manuscript of Scywalker: scalable end-to-end data analysis workflow for nanopore single-cell transcriptome sequencing

  Dataset for the manuscript Scywalker: scalable end-to-end data analysis workflow for nanopore single-cell transcriptome sequencing. Contains fastq files for 4 brain samples obtained from short-read NovaSeq 6000 v1.5 Illumina and long-read Oxford Nanopore PromethION sequencing. Single-cell suspensions were generated using 10x Genomics Chromium Next GEM Single Cell 3'Kit v3.1

  Dataset EGAD50000000768

• WGS data for MMML for Study EGAS00001002198

  Whole genome sequencing data for MMML (28 tumor/control pairs)

  Dataset EGAD00001003207

• WGS data for MMML for Study EGAS00001002198

  Whole genome sequencing data for MMML (cell_line)

  Dataset EGAD00001003210

• 1M-scBloodNL

  Here we present the 1M-scBloodNL study, in which we performed single-cell RNA-seq on 120 individuals of the Northern Netherlands population cohort Lifelines. For each individual peripheral blood mononuclear cells (PBMCs) were sequenced in an unstimulated condition, and after 3 and 24 hour in vitro stimulation with C. albicans (CA), M. tuberculosis (MTB) and P. aeruginosa (PA), totalling approximately 1.3 million cells. scRNA-seq was conducted with the 10X Genomics 3'-end v2 (72 libraries) and v3 (33 libraries) technology. In general, each library contains PBMCs from 8 donors and 2 different stimulation-timepoint combinations. Donors were demultiplexed using a combination of SoupOrCell (https://www.nature.com/articles/s41592-020-0820-1) and genotype information to assign the correct donor to a donor-specific cell cluster.

  Dataset EGAD00001007764

• WGS data for MMML for Study EGAS00001002198

  Whole genome sequencing data for MMML (healthy cell_line)

  Dataset EGAD00001003283

• Whole genome sequencing

  This dataset contains whole genome sequencing data from 22 samples of FACS-purified bone marrow CD34+ haematopoietic stem and progenitor cells and matched hair follicle controls collected from individuals undergoing hip replacement surgery. Additionally, it contains whole genome sequencing data from unseparated bone marrow mononuclear cells, CD3-CD34- bone marrow mononuclear cells, and peripheral blood granulocytes of the same 14 samples. Haematopoietic samples were sequenced to a target coverage of 90-120x; 19 of them were re-sequenced to a total target coverage of 270x. Hair follicle controls were sequenced to a target coverage of 30x.

  Dataset EGAD00001015178

• cfDNA dataset for cfDNA cohort

  Cell free DNA sequencing data for 233 samples across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000104

• BLUEPRINT EpiVar ChIP-seq for naive CD4+ T-cells

  BLUEPRINT EpiVar ChIP-seq for naive CD4+ T-cells

  Study EGAS00001000753

• RNASeq files for Roussel-MBPRG

  RNASeq files for Roussel-MPBRG paper titled "Combination of ribociclib and gemcitabine for the treatment of medulloblastoma"

  Dataset EGAD00001008824

• Dataset for whole exome sequencing of 49 tumor-blood pairs and transcriptome sequencing of 44 tumors for adrenocortical tumors

  Dataset for whole exome sequencing of 49 tumor-blood pairs and transcriptome sequencing of 44 tumors for adrenocortical tumors

  Dataset EGAD00001000810

• Genomic Landscape of Human Skin at a Single-Cell Resolution

  Every cell in the human body has a unique set of somatic mutations, yet it remains difficult to comprehensively genotype an individual cell. Here, we developed solutions to overcome this obstacle in the context of normal human skin, thus offering the first glimpse into the genomic landscapes of melanocytes at single-cell resolution. We comprehensively genotyped 133 melanocytes from 19 sites across 6 donors. As expected, sun-shielded melanocytes had fewer mutations than sun-exposed melanocytes. However, within sun-exposed sites, melanocytes on chronically sun-exposed skin (e.g. the face) displayed a lower mutation burden than melanocytes on intermittently sun-exposed skin (e.g. the back). Melanocytes from donors with a history of skin cancer had higher mutation burdens than melanocytes from donors without skin cancer, implying that the mutation burden of normal skin can be harnessed to measure cumulative sun damage and skin cancer risk. Moreover, melanocytes from healthy skin commonly harbor pathogenic mutations, likely explaining the origins of the melanomas that arise in the absence of a pre-existing nevus. Phylogenetic analyses identified groups of related melanocytes, suggesting that melanocytes spread throughout skin as fields of clonally related cells, invisible to the naked eye. Overall, our study offers an unprecedented view into the genomic landscapes of individual melanocytes, revealing key insights into the causes and origins of melanoma.

  Study phs001979

• A comprehensive DNA methylation landscape of human and mouse cell lines derived from hematological malignancies

  Human cancer cell lines constitute useful models to study the primary disease and many relevant findings in tumor biology have been originated from them since the first immortalized cell line (HeLa) was obtained. The easy experimental intervention, the purity of the transformed cells and their versatility to undergo high-throughput screenings represent advantageous features of the established cancer cell lines. In recent years, major efforts have characterized in detail the multiomics make-up of hundreds of cancer cell lines and studied their association with sensitivity to anticancer drugs. Most of these studies have been genetic-centric and have not characterized in detail the epigenetic profiles underlying the characteristics of these cells or their impact on the efficacy of antitumoral compounds. In this regard, a past version of a DNA methylation microarray or a less accessible and more time-consuming such as reduced representation bisulfite sequencing have been used in those attempts to interrogate the epigenetic setting. Herein, we have obtained the DNA methylation profiles of 210 cell lines derived from hematological malignancies utilizing comprehensive DNA methylation microarrays that interrogates more than 850,000 and 285,000 CpG sites from human and mouse genomes, respectively. Importantly, we also provide a pharmacoepigenetic example of the potential use of this resource by showing how DNA methylation can predict response to nucleoside analogues.

  Study EGAS50000000627

• The Mexican-American Coronary Artery Disease Study (MACAD)

  The MACAD Study, funded by NHLBI, was designed to explore genetic contributions to coronary artery disease and glucose homeostasis traits among Hispanics using a family-based design. The baseline examination of the cohort included the euglycemic hyperinsulinemic clamp test from which the two key phenotypes were obtained: insulin sensitivity (M) and metabolic clearance rate of insulin (MCRI). Genome-wide genotyping was obtained under separate funding by NIDDK as a part of the GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.

  Study phs001397

• NCI Laboratory of Translational Genomics (LTG) Human Pancreas QTL study

  We created a human histologically normal pancreas eQTL resource using 91 fresh frozen tissue samples from patients diagnosed with pancreatic cancer (Mayo Clinic and Memorial Sloan Kettering Cancer Center) or from organ donors without a history of pancreatic cancer (Penn State University) by RNA-Sequencing. Genome wide genotyping was done using blood derived DNA samples or normal derived tissue samples. An average of ~369,4 million reads (paired end, stranded, 101 bp) and 724981 genotypes (per sample) were generated.

  Study phs001776

• The Hypertension-Insulin Resistance Family Study (HTN-IR)

  The HTN-IR Study, funded by NHLBI, was designed to explore genetic contributions to hypertension and glucose homeostasis traits among Hispanics using a family-based design. The baseline examination of the cohort included the euglycemic hyperinsulinemic clamp test from which the two key phenotypes were obtained: insulin sensitivity (M) and metabolic clearance rate of insulin (MCRI). Genome-wide genotyping was obtained under separate funding by NIDDK as a part of the GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium.

  Study phs001394

• The Genetics of Lung Cancer Susceptibility in Smokers

  Over 85% of all patients diagnosed with lung cancer report a history of tobacco use, though only 10% of tobacco smokers eventually develop lung cancer. Epidemiologic studies have shown that family members of patients with lung cancer have a higher risk of developing lung cancer than controls. In an effort to identify variants associated with tobacco induced lung cancer, we have sequenced germline DNA from affected and unaffected members of families with strong histories of tobacco related lung cancer.

  Study phs000728

• PRADO trial - Personalized response-directed surgery and adjuvant therapy after neoadjuvant ipilimumab plus nivolumab in stage III melanoma

  The PRADO trial tested a personalized response-directed treatment approach based on the pathologic response after neoadjuvant ipilimumab plus nivolumab in stage III melanoma patients. In patients achieving a major pathologic response, in their index lymph node (the largest lymph node metastasis at baseline), therapeutic lymph node dissection (TLND) and adjuvant therapy were omitted. Patients with partial response underwent TLND only, whereas patients with pathologic non-response underwent TLND and adjuvant systemic therapy ± synchronous radiotherapy.

  Study EGAS50000000268

• Transcriptome sequencing of fibroblast-dependent alveolar organoids derived from patient-specific iPS cells with SFTPC^Y104H variant and their gene-corrected (monoallelic wild type SFTPC) ones.

  A disease-specific iPS cell line derived from a pulmonary fibrosis patient with SFTPC^Y104H and its gene-corrected (monoallelic wild type SFTPC) one were established. Then lung progenitor cells were differentiated from each cell line and co-cultured with human fetal lung fibroblasts to generate alveolar organoids, respectively. Alveolar epithelial cells and fibroblasts were isolated by fluorescence-activated cell sorting and each RNA was extracted. We performed transcriptome analysis of those samples by RNA-sequencing.

  Study JGAS000617

• Comprehensive single-cell genome analysis at nucleotide resolution using the PTA Analysis Toolbox

  We developed a comprehensive bioinformatic workflow, called the PTA Analysis Toolbox (PTATO), to accurately detect single base substitutions, insertions-deletions (indels) and structural variants in PTA-based WGS data. PTATO includes a machine learning approach and filtering based on recurrency to distinguish PTA-artefacts from true mutations with high sensitivity (up to 90%), outperforming existing bioinformatic approaches. Our results show that PTATO enables studying somatic mutagenesis in the genomes of single cells with unprecedented sensitivity and accuracy.

  Study EGAS00001007288

• WES sequencing of malignant peripheral nerve sheath tumours

  Investigate the genomic landscape of MPNST tumours. Cases where a diagnosis of MPNST had been considered in the differential diagnosis with a variable degree of confidence was included. The diagnosis of MPNST was excluded in 12/51 (49 cases had WES data) of the sequenced tumours following review of the pathology, new IHC, molecular tests and clinical information. Article: Lyskjær et al, 2020, J Pathol, "H3K27me3 expression and methylation status in histological variants of malignant peripheral nerve sheath tumours".

  Study EGAS00001004527

• Mutational Landscape of Plasmablastic Lymphoma

  Plasmablastic lymphoma (PBL) represents a clinically heterogeneous subtype of aggressive B-cell non-Hodgkin lymphoma. Although targeted sequencing studies and a single center whole exome sequencing (WES) study in HIV+ patients recently revealed several genes, associated with PBL pathogenesis, the global mutational landscape and transcriptional profile of PBL remain elusive. To inform on disease-associated mutational drivers, mutational patterns and perturbed pathways in HIV+ and HIV- PBL we performed WES and RNA-sequencing (RNA-seq) of 34 PBL tumors.

  Study EGAS00001004906

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Gene expression profiles of matched primary and recurrent fresh frozen tumor tissues from 66 HGSOC patients were obtained by RNA sequencing. RNA libraries were created using the Illumina TruSeq RNA sample preparation kit V2 according to the manufacturer’s instructions and sequenced on a HiSeq2000 (Illumina, California, USA) using a V3 flowcell generating 1 x 50 bp reads. Raw sequencing reads were mapped to the transcriptome and the human reference genome (NCBI37/hg19) using TopHat 2.0 and Bowtie 2.0.

  Study EGAS00001002660

• Sequencing of an adolescent patient with germline RET mutant alveolar rhabdomyosarcoma

  An adolescent patient presented with an alveolar rhabdomyosarcoma made more unique by the presence of a germline RET mutation ordinarily associated with and a known driver of multiple endocrine neoplasia type 2A (MEN2A) cancer. To better understand the role of this germline RET mutation in the genetics and phenotypic response of this unique alveolar rhabdomyosarcoma, we performed DNA and RNA sequencing of the patients in addition to functional studies on patient-derived cultures and genetically similar similar cell models.

  Study EGAS00001004359

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151