17524 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 40.31 milliseconds.

• Fragmentomics profiling and quantification of plasma Epstein-Barr virus DNA enhance prediction of future nasopharyngeal carcinoma.

  This study evaluated the clinical utility of fragmentomics analysis of plasma Epstein-Barr virus (EBV) DNA in nasopharyngeal carcinoma (NPC) screening. The first-round EBV-positive blood samples from a two-round large-scale prospective NPC screening cohort were analyzed. The EBV DNA of subjects who developed NPC in the second round displayed a distinctive mononucleosomal size pattern, an NPC-associated end motif profile, and aberrations in methylation deduced by fragmentomics-based methylation analysis (FRAGMA). Subjects with these aberrant fragmentomics features and higher EBV DNA quantity showed a dramatically increased risk of NPC development, demonstrating the potential of plasma DNA fragmentomics in predicting future cancer risk.

  Study EGAS50000000395

• Cross-tissue transcriptomic analysis of human secondary lymphoid organ residing ILC3 reveals a default quiescent state in the absence of inflammation

  A cross tissue transcriptional comparison of human ILC3 isolated from non-inflamed lymph nodes (LN) and spleens, inflamed tonsils and the peripheral blood (PB). Using uniform gating and high-purity cell-sorting, ILC3 were sorted as Lineage(CD3,CD19,CD34,CD14,CD94)-CD45intCD127+CRTH2-CD117+. From LN, spleen, tonsils and PB, NKp44- ILC3 were isolated and, in addition, NKp44+ ILC3 were sorted from spleen and tonsils. RNA quality was measured on a RNA 6000 Pico Kit (Agilent Technologies) using a 2100 Bioanalyzer (Agilent Technologies). 100 pg high-quality RNA was isolated and cDNA was generated using the SMART-Seq (v3) Ultra Low Input RNA Kit (Clontech) with 15 cycles of amplification. Amplified and Covaris-fragmented cDNA was quality-checked on a High Sensitivity DNA chip (Agilent Technologies) and further processed according the TruSeq Nano DNA Library Preparation Kit (Illumina). Data was processed as follows: SMARTer adapters were trimmed with cutadapt and the resulting sequences were aligned to the human RefSeq transcriptome using 14 TopHat2 (Kim et al., 2013). Normalization and quantification was performed using Cufflinks (Trapnell et al., 2012). FPKM counts were determined per gene with HTSeq-count.

  Study EGAS00001002636

• Single-nuclei gene-expression analysis of pheochromocytoma and paraganglioma links tumor subtypes with tumor microenvironment

  This dataset contains raw sequencing reads in FASTQ format from single-nuclei (30 samples) and bulk tissue (40 samples) transcriptome sequencing of pheochromocytoma and paraganglioma tissue specimens. Additionally, data from single-nuclei sequencing of two normal adrenal medulla specimens is included.

  Dataset EGAD00001008403

• The evolution of ovarian high grade serous carcinoma from STIC lesions

  We performed Ampliseq on 11 samples on a targeted panel of 17 genes.

  Study EGAS50000000361

• Germline sequencing

  Detection of SNVs/indels in the germline of pediatric cancer patients with a focus on CHEK2 germline variants.

  Study EGAS00001006254

• Germline sequencing

  Detection of SNVs/ indels in the germline of pediatric cancer patients with a focus on CHEK2 germline variants

  Study EGAS00001006705

• Paired diagnostic and relapse medulloblastoma sequencing

  Whole exome and targeted panel sequencing in a cohort of paired diagnostic and relapse medulloblastoma samples.

  Study EGAS00001007120

• 1M-scBloodNL

  Here we present the 1M-scBloodNL study, in which we performed single-cell RNA-seq on 120 individuals of the Northern Netherlands population cohort Lifelines. For each individual peripheral blood mononuclear cells (PBMCs) were sequenced in an unstimulated condition, and after 3 and 24 hour in vitro stimulation with C. albicans (CA), M. tuberculosis (MTB) and P. aeruginosa (PA), totalling approximately 1.3 million cells. scRNA-seq was conducted with the 10X Genomics 3'-end v2 (72 libraries) and v3 (33 libraries) technology. In general, each library contains PBMCs from 8 donors and 2 different stimulation-timepoint combinations. Donors were demultiplexed using a combination of SoupOrCell (https://www.nature.com/articles/s41592-020-0820-1) and genotype information to assign the correct donor to a donor-specific cell cluster.

  Dataset EGAD00001007764

• Exome data from a high-density melanoma family

  This dataset contains whole-exome sequence data from four individuals in a high-density melanoma family. Sequences were aligned against human reference genome HG19 using BWA.

  Dataset EGAD50000002153

• The_identification_of_genetic_vulnerabilities_in_head_and_neck_cancers_for_the_development_of_novel_therapies

  CRISPR/Cas9 lethality screens in a set of Asian head and neck cancer cell lines to identify novel targets.

  Study EGAS00001002204

• 850k Methyome analysis of snap frozen or FFPE stored human MBM

  We performed a 850k infinium bead chip-based global methylome analysis of MBM.

  Study EGAS00001005975

• Bulk exome sequencing of primary GBM - SF 10360

  We performed bulk exome-seq on a primary GBM and a blood sample from SF10360

  Dataset EGAD00001002274

• TFL unique case study

  Whole exome sequencing of a normal sample, primary tumor sample, and relapse tumor sample of a transformed non-Hodgkins follicular lymphoma patient with extraordinary response to treatment.

  Dataset EGAD00001002707

• Single-cell RNA-sequencing of a multi-region pleural mesothelioma case

  Single-cell RNA-seq (Smart-Seq2) from 3 distant biopsies (costal, mediastinal, diaphragmatic) of a pleural mesothelioma case.

  Dataset EGAD00001015519

• RNAseq_of_ribosomal_footprints

  Cancer genes can affect ribosomal RNA processing and this can underlie their essentiality to cells, making them cell-essential in the same way as ribosomal genes themselves. We want to confirm this, in order to understand the results of our CRISPR drop-out screens.NOTE FROM BESPOKE TEAM: Run a single read 1 (forward read) of 30 bases, then an index 1 read as normal. This would fit a 50cycle kit

  Study EGAS00001001591

• Mutational profiling of LUAD in young never-smokers

  NSCLC has been recognized as a highly heterogeneous disease with phenotypic and genotypic diversity in each subgroup. In this study, we conducted whole genome sequencing (WGS) to characterize the genomic alterations of 36 never-smoker Chinese patients with lung adenocarcinomas (LUADs). Our study provides a detailed mutational portrait of LUADs occurring in young never-smokers and gives insights into the molecular pathogenesis of this NSCLC subgroup

  Study EGAS00001002773

• Genetic characterization patients affected by Cancer of Unknown Primary

  The genetic changes sustaining the development of human Cancers of Unknown Primary (CUP) remain elusive. Here we report the genomic profiling of 14 rigorously selected CUP samples. Although no specific recurring mutation in known driver genes was found, a comparison of the mutational landscape of CUPs with that of most other human tumor types revealed a consistent change in diverse genes belonging to the axon guidance KEGG pathway.

  Study EGAS00001006621

• 46 patients primary malignant glioma cohort in Chinese population

  We recruited 46 Chinese patients with primary malignant glioma. All the patients were analyzed with whole-exome sequencing (WES) and 27 of them were analyzed with RNA-seq. We compared the molecular features between patients in different WHO grades. We used six-month progression-free survival (PFS6) status to group glioblastoma (GBM) patients to a good and a poor survival compared two groups genomic profiles.

  Study EGAS00001005583

• Genomic Profiling of Sequentially Acquired Metastatic Sites from an "Exceptional Responder" Lung Adenocarcinoma Patient Reveals Extensive Genomic Heterogeneity and Novel Somatic Variants

  We employed next-generation sequencing to identify somatic alterations in multiple metastatic sites from an "exceptional responder" lung adenocarcinoma patient during his seven year course of ERBB2-directed therapies. The degree of heterogeneity was unprecedented, with ~1% similarity between somatic alterations of the lung and lymph nodes. One novel translocation, PLAG1-ACTA2, present in both sites, up-regulated ACTA2 expression. ERBB2, the predominant driver oncogene, was amplified in both sites, more pronounced in the lung, and harbored an L869R mutation in the lymph node. Functional studies demonstrated increased proliferation, migration, metastasis, and resistance to ERBB2-directed therapy due to L869R mutation and increased migration due to ACTA2 overexpression. Within the lung, a nonfunctional CDK12, due to a novel G879V mutation, correlated with down-regulation of DNA damage response genes, causing genomic instability, and sensitivity to chemotherapy. We propose a model whereby a sub-clone metastasized early from the primary site and evolved independently in lymph nodes.

  Study phs001159

• Mesenchymal inflammation drives genotoxic stress in hematopoietic stem cells and predicts disease evolution in human pre-leukemia

  Mesenchymal niche cells may drive tissue failure and malignant transformation in the hematopoietic system but the molecular mechanisms and their relevance to human disease remain poorly defined. We demonstrated that perturbation of mesenchymal cells in a mouse model of the preleukemic disorder Shwachman-Diamond syndrome induces mitochondrial dysfunction, oxidative stress and activation of DNA damage responses in hematopoietic stem and progenitor cells. In this study we demonstrate, through massive parallel RNA sequencing of highly purified mesenchymal cells in a range of human preleukemic syndromes, TP53-S100A8/9-TLR4 inflammatory signaling as a common driving mechanism of genotoxic stress, which could be attenuated by TLR4 blockade. S100A8/9 expression in mesenchymal cells predicted outcome in myelodysplastic syndromes, the principal human preleukemic condition, independent of known prognostic variables. Collectively, findings reveal a concept of mesenchymal niche-induced genotoxic stress in heterotypic stem and progenitor cells through inflammatory signaling as an actionable determinant of disease outcome in human preleukemia. The data further provide novel conceptual and mechanistic insights into the intimate link between inflammation and cancer.

  Study EGAS00001001926

• Integrated genomic, transcriptional and epigenomic analyses in germinal center-cell lymphomas link the mutation landscape with differential DNA methylation in Burkitt lymphoma

  Biologically and clinically diverse B-cell neoplasms, including Burkitt, follicular and diffuse large B-cell lymphoma, show features of germinal center (GC) B-cells. Here we present a comprehensive analysis of the epigenetic landscape of GC-B-cell lymphomas using whole genome bisulfite sequencing paired with genome and transcriptome sequencing from 29 primary tumor samples and four normal GC-B-cell samples. All lymphomas studied showed extensive genome-wide methylation losses as well as intragenic regions where DNA methylation levels were strongly correlated with expression of associated genes. Pathway analysis revealed that these intragenic regions were enriched in signaling networks differentially activated in Burkitt and follicular lymphomas and affected regulatory mechanisms deregulated by recurrent mutations in a large fraction of Burkitt lymphomas (including the ID3/TCF3 complex, the SWI/SNF remodeling complex and the inhibitory GI signaling pathway). Taken together, these results provide a global picture of Burkitt lymphoma pathomechanism and demonstrate a tight connection between epigenetic regulation and other levels of regulatory control in these tumors.

  Study EGAS00001001067

• CRISPRi/a of GATA2/NR4A2/SOX17 upon spontaneous iPSC differentiation

  Arrayed CRISPR screens, modulating the expression of key lineage TFs GATA2 (mesoderm), SOX17 (endoderm), and NR4A2 (neuroectoderm) in hiPSCs via CRISPR interference or activation over a time-course of spontaneous differentiation (days cultured in vitro: 0, 4, 12, and 18).

  Study EGAS50000000819

• Whole Exome Sequencing of Bipolar cases and matched controls performed at the Broad Institute on a cohort from Cardiff, UK (Owen)

  This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,105 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing CRAM files.

  Dataset EGAD50000001212

• Whole Exome Sequencing of Bipolar cases and matched controls performed at the Broad Institute on a cohort from Stockholm, Sweden (Pedersen)

  This research project was a collaboration between the Karolinska Institute BioBank and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 4,765 control samples from collaborators in Sweden. Genomic DNA from each samples was sequenced to a mean depth of 20x. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing CRAM files.

  Dataset EGAD50000001026

• Whole Exome Sequencing of Bipolar cases and matched controls performed at the Broad Institute on a cohort from the Netherlands (Ophoff)

  This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,965 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing CRAM files.

  Dataset EGAD50000000983

• Whole Exome Sequencing of Bipolar cases and matched controls performed at the Broad Institute on a cohort from London, UK

  This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 4,627 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing CRAM files.

  Dataset EGAD50000000950

• Whole Exome Sequencing of Bipolar cases and matched controls performed at the Broad Institute on a cohort from Cardiff, UK (O'Donovan)

  This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing CRAM files.

  Dataset EGAD50000000887

• A living biobank of patient-derived ductal carcinoma in situ Mouse-INtraDuctal xenografts identifies factors associated with risk of invasive progression

  Create a living biobank of patient-derived ductal carcinoma in situ (DCIS) Mouse-INtraDuctal (MIND) xenografts to find factors explaining invasive growth. Samples exist of both primary and pdx samples. Invasive growth was scored in the pdx.

  Study EGAS00001006554

• DNA-seq FASTQ files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq FASTQ files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). Each sample was multiplexed across flowcells and lanes, leading to a total number of 86 FASTQ files.

  Dataset EGAD00001005756

• Single Cell Genomic Analysis of Lymphoma

  Our study aimed to define the extent of heterogeneity between anatomically separated tumor manifestations in follicular lymphoma at single-cell resolution. We subjected single-cell suspensions derived from nodal, synchronously-acquired fine needle aspirations from two distinct tumor sites to high-throughput microfluidics-based single-cell RNA sequencing. By comparing the relative composition of the tumor subpopulations between the two tumor sites, we found that some patients can exhibit site-to-site differences. While the overall composition of the tumor microenvironment did not differ significantly between sites, we did detect a specific correlation between site-to-site tumor heterogeneity and T follicular helper cell abundance. Our study demonstrates the significant limitations of a solitary biopsy in defining the full scope of a patient's disease.

  Study phs002188

• Homozygous IL37 mutation leads to infantile inflammatory bowel disease

  Whole-exome sequencing of a trio (parents and offspring) reveals IL37 mutation leads to infantile IBD.

  Study phs002040

• Observational study on the immune responses acquired by COVID-19 convalescent individuals

  We performed whole exome sequencing and microarray genotyping analysis of rare disease A two patients. .....

  Study JGAS000563

• WTCCC2 Ischaemic Stroke study

  Genome-wide association study identifies a variant in HDAC9 associated with large vessel ischemic stroke

  Study EGAS00000000103

• CIRCLE-seq of PDAC PDO

  CIRCLE-seq was performed on a PDAC PDO to validate the presence and the structure of ecDNAs

  Study EGAS50000000194

• Maternally-Inherited SPTBN1 Mutation

  The dataset consists of exome sequencing data from a male patient with a maternally inherited SPTBN1 mutation. The clinical presentations include autism spectrum disorder, cognitive delay, feeding difficulties, gastrointestinal manifestations, and musculoskeletal abnormalities.

  Dataset EGAD50000001726

• Whole-genome data from a high-density melanoma family

  This dataset contains whole-genome sequence data from individuals in a high-density melanoma family. Sequences were aligned againt the human reference genome HG19 using BWA.

  Dataset EGAD50000002154

• TSG_knock_out_in_hiPSCs

  We will perform RNAseq to evaluate the effects of the loss of a list of TSGs on the transcriptome.

  Study EGAS00001002262

• Characterizing the tumor immune microenvironment of ependymomas using targeted gene expression profiles and RNA-sequencing the pros and cons

  RNA sequencing data of a collection of 6 pediatric ependymoma cases

  Study EGAS00001006535

• Bulk exome sequencing of primary GBM - SF 10282

  We performed bulk exome-seq on a primary GBM and a blood sample from SF10282

  Dataset EGAD00001002275

• Bulk exome sequencing of primary GBM - SF 10345

  We performed bulk exome-seq on a primary GBM and a blood sample from SF10345

  Dataset EGAD00001002273

• Germline DNMT3A mutation in familial acute myeloid leukemia

  Longitudinal and germline exome sequencing analysis of a mother and son pair who both developed adult-onset diploid AML identified a novel germline missense mutation DNMT3A p.P709S.

  Dataset EGAD00001006248

• WCDT Hi-C assays performed mCRPC biopsies - Part 2

  13 paired FASTQ files from a Hi-C assay performed on mCRPC tumors. Sequencing was performed using 150nt paired reads generated by a Novaseq 6000 instrument.

  Dataset EGAD00001009417

• A Model of Human Asthma Exacerbation Identifies Mechanisms That Drive Allergic Asthma

  In this study, we will enroll allergic adults to undergo bronchoscopic segmental allergen challenge, in order to identify differences in the airway immune response to allergen in those with asthma compared to those without asthma. After a discussion about the study and potential risks, subjects giving written informed consent will undergo two bronchoscopies. During the first procedure, samples will be collected from the left lung and allergen will be administered to a small segment of the right lung. The second procedure will be performed 24 hours later, with collection of samples from the allergen-challenged lung segment.

  Study phs003101

• McQuillin_Global_WES_Schizophrenia

  Whole Exome Sequencing of Schizophrenia cases and matched controls performed at the Broad Institute on a cohort from UCL, London, UK

  Study EGAS50000000901

• MBD4 targeted sequencing

  We sequenced a gene of interest, MBD4, in both germline (n=1099) and tumor (n=192) sample from Uveal Melanoma patients.

  Study EGAS00001005012

• Structural variants

  Structural variants assessed in 6 patient samples with varying phenotypes, through the use of sniffles2 with a support parameter of 1 and at a length of 30 bp

  Dataset EGAD50000000741

• KIT-dependent and -independent genomic heterogeneity of resistance in gastrointestinal stromal tumors - TORC1/2 inhibition as salvage strategy

  The mutational status of GIST analyzed with a broad sequencing approach (WES, RNAseq)

  Study EGAS00001003405

• ICGC Breast Cancer Project

  A comprehensive characterisation and analysis of human breast cancers through genome-wide approaches including genomics, transcriptomics and epigenomics.

  Study EGAS00001001195

• GermCellTumour

  DNA and RNA sequencing across a number of different germ cell tumours, included mixed components within the same tumour.

  Study EGAS00001003457

• checup

  Sequencing data from a phase II study of nivolumab and ipilimumab in recurrent or refractory cancer of unknown primary (CheCUP trial)

  Study EGAS00001007403

• Mosaic Colorectal Metastasis

  A comparison of the somatic variation present in a primary colorectal tumour and three different liver metastases from the same patient.

  Dataset EGAD00001000948

• Recurrent somatic JAK-STAT mutations within a RUNX1-mutated pedigree

  Whole-exome sequencing of a RUNX1-mutated pedigree, including samples from mother, father and four offsprings. Recurrent somatic JAK-STAT mutations were found among the diseased individuals.

  Dataset EGAD00001002240

• APCDR Uganda GWAS - High depth sequencing of a Baganda trio

  A family trio from Uganda (Baganda ethno-linguistic group) has been sequenced to high depth (ca. 30x) on the Illumina HiSeq 2500 platform.

  Dataset EGAD00001005346

• Targeted sequencing of HGS-EOC samples

  A 19-sample data set containing data from FFPE high grade serous ovarian cancer biopsies. The library was made with a custom hybridization kit (EZ-Cap, Roche) spanning 7 genes.

  Dataset EGAD00001006064

• Mutational Signatures of relapse in rectal cancer FFPE samples in the CR07 clinical trial

  The CRO7 clinical trial recruited patients with clinically operable rectal adenocarcinoma. Patients were randomized to either pre-operative short course surgery followed by chemo-radiotherapy only in those patients at high risk of local relapse. Patients in both arms the received standard %-FU based adjuvant chemotherapy as per local policy. We intend to use FFPE derived DNA from the primary tumours to identify patterns of mutations or copy number alterations that are predictive of local or distant relapse.

  Dataset EGAD00001000875

• Breast Cancer Family Registry Early-onset Breast Cancer GWAS

  In order to enhance our understanding of the genetic etiology of breast cancer, this study analyzed 1,265,548 Hapmap3 single-nucleotide polymorphisms (SNP) among a discovery set of 3,523 EOBC incident cases and 2,702 age-matched population control women, all of whom were age 50 or younger at enrollment. Subjects were recruited from the eight sites, some of which oversampled cases with a personal or family history of breast cancer.

  Study phs001589

• Whole-exome sequencing of Helicobacter pylori-uninfected normal gastric gland

  Recent studies showed that somatic mutations accumulate in normal tissues with age; however, mutation accumulation in the Helicobacter pylori-uninfected normal gastric mucosa has not been reported. A total of 18 biopsied gastric mucosa were obtained from nine subjects without Helicobacter pylori-infection or gastric cancer. Gastric epithelia were manually dissociated from the lamina propria. Subsequently, single glands were picked up under a stereomicroscope. Genomic DNA isolated from each gland was subjected to whole-exome sequencing.

  Study JGAS000313

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• DO NOT USE - Whole genome sequencing of SI-NETs from five patients

  Small intestine neuroendocrine tumor (SI-NET), the most common cancer of the small bowel, often displays a curious multifocal phenotype with several intestinal tumors centered around a regional lymph node metastasis, yet the typical path of evolution of these lesions remains unclear. Here, we determined the complete genome sequences of 37 tumors from 5 patients with multifocal SI-NET, allowing elucidation of phylogenetic relationships between multiple intestinal tumors and metastases in individual patients.

  Study EGAS00001004435

• A Comprehensive Catalogue of Somatic Mutations from a Human Cancer Genome

  A Comprehensive Catalogue of Somatic Mutations from a Human Cancer Genome

  Dataset EGAD00001000149

• Longitudinal multi-omics support immunotrhrombosis as the molecular force behind increased post-acute complication risk

  Whole blood transcriptome profiles in severe COVID-19 patients (n=81) across three timepoints: A) 1st day of hospital admission, B) one month (38.46 ± 12.89 days) post-hospitalization, and C) three months post-infection (96.29 ± 13.81 days post-hospitalization). 62 patients had blood collected at all three timepoints (19 patients have transcriptome data from two timepoints (acute phase (timepoint A) and recovery phase (timepoint B or C)), 224 blood transcriptomes in total.

  Study EGAS50000001430

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Spatial Heterogeneity in CLL

  A whole-genome/exome sequencing (WGS/WES) characterization of the spatial heterogeneity found in chronic lymphocytic leukemia (CLL) at diagnosis. Fifteen synchronous peripheral blood and lymph node samples were analyzed by WGS (n=2) or WES (n=13). Subtle differences in the global architecture of the tumor at peripheral blood and lymph node were observed only in a fraction of patients. Spatial heterogeneity was not found among the well-established CLL driver alterations.

  Study EGAS00001003803

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• Differentially methylated CpGs in response to growth hormone administration in children with idiopathic short stature

  Background: Recombinant human growth hormone (rhGH) has shown a great growth-promoting potential in children with idiopathic short stature (ISS). However, the response to rhGH differs across individuals, largely due to genetic and epigenetic heterogeneity. Since epigenetic marks on the methylome can be dynamically influenced by GH, we performed a comprehensive pharmaco-epigenomics analysis of DNA methylation changes associated with long-term rhGH administration in children with ISS. Results: We measured DNA methylation profiles before and after GH treatment (with a duration of ~18 months in average) on 47 healthy children using customized methylC-seq capture sequencing. Their changes were compared and associated with changes in plasma IGF1 by adjusting sex, age, treatment duration, and estimated blood proportions. We observed a considerable inter-individual heterogeneity of DNA methylation changes responding to GH treatment. We identified 267 response-associated differentially methylated cytosines (DMC) that were enriched in promoter regions, CpG islands and blood cell-type specific regulatory elements. Furthermore, the genes associated with these DMCs were enriched in the biology process of "cell development", "neuron differentiation" and "developmental growth", and in the TGF-beta signaling pathway, PPAR Alpha pathway, endoderm differentiation pathway, adipocytokine signaling pathway as well as PI3K-Akt signaling pathway, and cAMP signaling pathway. Conclusion: Our study provides a first insight in DNA methylation changes associated with rhGH administration, which may help understand mechanisms of epigenetic regulation on GH-responsive genes.

  Study EGAS00001006115

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• Long-read sequence data from two carriers of a predisposing structural variant

  This dataset contains PacBio long-read sequence data from two individuals with a chr9p.21 structural variant and two controls. Sequences were aligned againt the human reference genome HG38.

  Dataset EGAD50000002155

• Whole-genome sequencing (WGS) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  We used WGS (Complete Genomics) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  Dataset EGAD00001003120

• 160 WES and 25 WGS for HBV related HCC, and 15 WES for ICC belongs LICA-CN.

  160 WES and 25 WGS for HBV related HCC, and 15 WES for ICC belongs LICA-CN.

  Study EGAS00001002331

• ProstOmics - Bulk Transcriptomics

  Bulk transcriptomics data from 176 prostate tissue samples (37 patients, 27 with post-surgery relapse) that were acquired using the SENSE mRNA-Seq Library Prep Kit V2 and Illumina NextSeq 500 instrument. The raw transcriptomics data is single-read RNA-seq. The individual samples have information on patient origin and sample type (cancer, cancer-adjacent field-effect normal or normal sample far from cancer). Patient metadata include information of age at surgery, time (months) until reported relapse, pre-surgery PSA and post-surgery T-stage.

  Dataset EGAD50000000604

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001005757

• Comprehensive RNA repository of tissue and plasma from patients with esophageal cancer or precursor lesions

  A comprehensive RNA repository (both coding and non-coding) from 17 patients diagnosed with esophageal adenocarcinoma, high-grade dysplastic or non-dysplastic Barrett’s esophagus. Per patient, a blood plasma sample, and a healthy esophageal and disease tissue sample were collected. This dataset includes both mRNA and small RNA sequencing data (fastq.gz files) of all tissue and plasma samples. In total,102 RNA-seq libraries from 51 samples (17 plasma and 34 tissue samples) were sequenced (plasma mRNA libraries were sequenced twice).

  Dataset EGAD00001006857

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• The Oral Microbiome and Head and Neck Cancer

  Oral microbiota may influence head and neck squamous cell carcinoma (HNSCC) development, potentially related to carcinogen metabolism. The human oral cavity hosts a diverse microbiota, including bacteria and fungi. We performed shotgun sequencing and ITS1 sequencing on 236 HNSCC case participants who developed HNSCC during a mean follow-up of 5.1 years and 458 matched controls who remained HNSCC-free. Oral samples were obtained from a prospective nested case-control study within three epidemiological cohorts: the American Cancer Society Cancer Prevention Study II Nutrition Cohort (ACS CPS-II), the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial (PLCO), and the Southern Community Cohort Study (SCCS). Control participants were selected using 2:1 frequency matching based on cohort, age, sex, race and ethnicity, and time since oral sample collection.

  Study phs004018

• Germline Aberrations of PAX5 Cause Susceptibility to pre-B cell Acute Lymphoblastic Leukemia

  A novel heterozygous germline variant, c.547G>A (p.Gly183Ser), in the paired box protein encoding gene, PAX5, was found to segregate with disease in two unrelated kindreds with autosomal dominant pre-B cell acute lymphoblastic leukemia (ALL). Leukemic cells from both families exhibited 9p deletion, with loss-of-heterozygosity and retention of the mutant PAX5 allele at 9p13 . Two additional sporadic ALL cases with 9p loss demonstrated PAX5 Gly183 substitution in the leukemic cells. Functional analysis of the PAX5 germline variants demonstrated reduced transcriptional activity, as well as decreased interaction with Groucho-4. These data extend the role of PAX5 alterations in the pathogenesis of pre-B ALL, and implicate PAX5 in a novel syndrome of germline susceptibility to pre-B cell neoplasia.

  Study EGAS00001000447

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• dataset for esophageal cancer, 17 pairs for whole-genome sequencing and 71 pairs for whole-exome sequencing

  dataset for esophageal cancer, 17 pairs for whole-genome sequencing and 71 pairs for whole-exome sequencing

  Dataset EGAD00001000760

• B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

  B cells play a central role in the immune response to both SARS-CoV-2 infection and vaccination, but the development of the B cell receptor (BCR) repertoire in both contexts has not been defined nor compared. We analysed serial samples from 171 SARS-CoV-2-infected individuals with a range of disease severities together with 63 vaccine recipients, and found marked differences in the global BCR repertoire after natural infection compared to vaccination. Following infection, the proportion of BCRs bearing IgG1/3 and IgA1 isotypes increased, somatic hypermutation (SHM) was markedly decreased and, in patients with severe disease, expansion of IgM and IgA clones was observed. In contrast, after vaccination the proportion of BCRs bearing IgD/M isotypes increased, SHM was unchanged and expansion of IgG clones was prominent. Infection generated a broad distribution of SARS-CoV-2-specific clones predicted to target the spike protein whilst vaccination produced a more focused response mainly targeting the spike’s receptor-binding domain. These findings offer insights into how different immune exposure to SARS-CoV-2 impacts upon BCR repertoire development, potentially informing vaccine strategies.

  Study EGAS00001005816

• Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study

  The Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study (NCT: NCT04750109) was sponsored by The Christie NHS Foundation Trust and funded by Innovate UK. Data generated include: A) Whole genome sequencing* of paired germline blood and tumour tissue B) Whole genome sequencing *of germline blood only C) Next-generation sequencing of circulating tumour DNA (FoundationOne Liquid CDX) D) Next-generation sequencing of tumour tissue (FoudationOne CDX) *Whole genome sequencing - germline sample at 30x coverage and somatic sample at 75x coverage performed by Illumina NovaSeq 6000 instrument in the 150bp PE read mode.

  Study EGAS00001008239

• Cancer_Cell_Line_Exome_Sequencing_

  Genomic characterisation of a large series of cancer cell lines.

  Study EGAS00001000978

• Breast_cancer_topographs

  Breast cancer topography will be explored using a combination of multi-region whole geome sequencing and in-situ RNA sequencing of fixed tissue specimens.

  Study EGAS00001003698

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line WXS

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009758

• Clonal dynamics after allogeneic haematopoietic cell transplantation using genome-wide somatic mutations - WGS

  Allogeneic haematopoietic cell transplantation (HCT) replaces the stem cells responsible for blood production with those harvested from a donor, and is received by 40,000 patients worldwide each year. To quantify dynamics of long-term stem cell engraftment, we sequenced whole genomes of 2,824 single-cell-derived haematopoietic colonies from blood samples of 10 donor-recipient pairs taken 9-31 years after HLA-matched sibling HCT. With younger donors, 10,000-50,000 stem cells had engrafted and were still contributing to haematopoiesis at time of sampling, but estimates were 10-fold lower with older donors. Engrafted stem cells made multilineage contributions to myeloid, B-lymphoid and T-lymphoid populations, although individual clones often showed biases towards one or other mature cell type. Recipients had lower clonal diversity than matched donors, equivalent to ~10-15 years of additional ageing, arising from up to 25-fold greater expansion of stem cell clones. An HCT-related population bottleneck alone could not explain these differences: instead, phylogenetic trees evinced two distinct modes of HCT-specific selection. In 'pruning selection', cell divisions underpinning recipient-enriched clonal expansions had occurred in the donor, preceding transplant - their selective advantage derived from preferential mobilisation, harvest, survival ex vivo or initial homing. In 'growth selection', cell divisions underpinning clonal expansion occurred through proliferative advantage in the recipient's marrow after homing - clones with multiple driver mutations especially demonstrated this pattern. Uprooting stem cells from their native environment and transplanting them to foreign soil exaggerates selective pressures, distorting and accelerating the loss of clonal diversity compared to the unperturbed haematopoiesis of donors.

  Dataset EGAD00001010872

• Genomic Landscape of Human Skin at a Single-Cell Resolution

  Every cell in the human body has a unique set of somatic mutations, yet it remains difficult to comprehensively genotype an individual cell. Here, we developed solutions to overcome this obstacle in the context of normal human skin, thus offering the first glimpse into the genomic landscapes of melanocytes at single-cell resolution. We comprehensively genotyped 133 melanocytes from 19 sites across 6 donors. As expected, sun-shielded melanocytes had fewer mutations than sun-exposed melanocytes. However, within sun-exposed sites, melanocytes on chronically sun-exposed skin (e.g. the face) displayed a lower mutation burden than melanocytes on intermittently sun-exposed skin (e.g. the back). Melanocytes from donors with a history of skin cancer had higher mutation burdens than melanocytes from donors without skin cancer, implying that the mutation burden of normal skin can be harnessed to measure cumulative sun damage and skin cancer risk. Moreover, melanocytes from healthy skin commonly harbor pathogenic mutations, likely explaining the origins of the melanomas that arise in the absence of a pre-existing nevus. Phylogenetic analyses identified groups of related melanocytes, suggesting that melanocytes spread throughout skin as fields of clonally related cells, invisible to the naked eye. Overall, our study offers an unprecedented view into the genomic landscapes of individual melanocytes, revealing key insights into the causes and origins of melanoma.

  Study phs001979

• A comprehensive DNA methylation landscape of human and mouse cell lines derived from hematological malignancies

  Human cancer cell lines constitute useful models to study the primary disease and many relevant findings in tumor biology have been originated from them since the first immortalized cell line (HeLa) was obtained. The easy experimental intervention, the purity of the transformed cells and their versatility to undergo high-throughput screenings represent advantageous features of the established cancer cell lines. In recent years, major efforts have characterized in detail the multiomics make-up of hundreds of cancer cell lines and studied their association with sensitivity to anticancer drugs. Most of these studies have been genetic-centric and have not characterized in detail the epigenetic profiles underlying the characteristics of these cells or their impact on the efficacy of antitumoral compounds. In this regard, a past version of a DNA methylation microarray or a less accessible and more time-consuming such as reduced representation bisulfite sequencing have been used in those attempts to interrogate the epigenetic setting. Herein, we have obtained the DNA methylation profiles of 210 cell lines derived from hematological malignancies utilizing comprehensive DNA methylation microarrays that interrogates more than 850,000 and 285,000 CpG sites from human and mouse genomes, respectively. Importantly, we also provide a pharmacoepigenetic example of the potential use of this resource by showing how DNA methylation can predict response to nucleoside analogues.

  Study EGAS50000000627

• BipEx_Timpson_Bristol

  "BipEx_EGAS00001006274_Timpson_Bristol Controls Exomes. This research project was a collaboration between University of Bristol, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,981 Control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000144

• Massively Multiplex Single-Cell Hi-C of HeLa Cells

  In this study, we developed a massively multiplexed, single-cell Hi-C protocol to study the chromosomal architecture of single HeLa cells.

  Study phs001269