17300 results for "fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins They are definitely a top seller..rG5l"

in 49.06 milliseconds.

• GermCellTumour

  DNA and RNA sequencing across a number of different germ cell tumours, included mixed components within the same tumour.

  Study EGAS00001003457

• checup

  Sequencing data from a phase II study of nivolumab and ipilimumab in recurrent or refractory cancer of unknown primary (CheCUP trial)

  Study EGAS00001007403

• WGS and RNA-Seq data from a GBM patient PT-HO0394

  WGS and RNA-Seq data from a GBM patient PT-HO0394

  Dataset EGAD00001004243

• WGS and RNA-Seq data from a GBM patient PT-CA2271

  WGS and RNA-Seq data from a GBM patient PT-CA2271

  Dataset EGAD00001004230

• WGS and RNA-Seq data from a GBM patient PT-TM5196

  WGS and RNA-Seq data from a GBM patient PT-TM5196

  Dataset EGAD00001004262

• WGS and RNA-Seq data from a GBM patient PT-BM8772

  WGS and RNA-Seq data from a GBM patient PT-BM8772

  Dataset EGAD00001008516

• WGS and RNA-Seq data from a GBM patient PT-WR7927

  WGS and RNA-Seq data from a GBM patient PT-WR7927

  Dataset EGAD00001008531

• Targeted sequencing of HGS-EOC samples

  A 19-sample data set containing data from FFPE high grade serous ovarian cancer biopsies. The library was made with a custom hybridization kit (EZ-Cap, Roche) spanning 7 genes.

  Dataset EGAD00001006064

• WGS and RNA-Seq data from a GBM patient PT-GE7528

  WGS and RNA-Seq data from a GBM patient PT-GE7528

  Dataset EGAD00001008519

• WGS and RNA-Seq data from a GBM patient PT-RV2286

  WGS and RNA-Seq data from a GBM patient PT-RV2286

  Dataset EGAD00001008527

• Genome and transcriptome sequence data from a diffuse intrinsic pontine glioma tumor patient

  Genome and transcriptome sequence data from a diffuse Intrinsic Pontine Glioma patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015284

• Recurrent somatic JAK-STAT mutations within a RUNX1-mutated pedigree

  Whole-exome sequencing of a RUNX1-mutated pedigree, including samples from mother, father and four offsprings. Recurrent somatic JAK-STAT mutations were found among the diseased individuals.

  Dataset EGAD00001002240

• WGS and RNA-Seq data from a GBM patient PT-GI2070

  WGS and RNA-Seq data from a GBM patient PT-GI2070

  Dataset EGAD00001008520

• WGS and RNA-Seq data from a GBM patient PT-JR9883

  WGS and RNA-Seq data from a GBM patient PT-JR9883

  Dataset EGAD00001008521

• WGS and RNA-Seq data from a GBM patient PT-ML9537

  WGS and RNA-Seq data from a GBM patient PT-ML9537

  Dataset EGAD00001008523

• Genome and transcriptome sequence data from a gliomatosis cerebri anaplastic astrocytoma tumor patient

  Genome and transcriptome sequence data from a gliomatosis cerebri anaplastic astrocytoma patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015292

• WGS and RNA-Seq data from a GBM patient PT-VO7089

  WGS and RNA-Seq data from a GBM patient PT-VO7089

  Dataset EGAD00001004263

• WGS and RNA-Seq data from a GBM patient PT-MD9088

  WGS and RNA-Seq data from a GBM patient PT-MD9088

  Dataset EGAD00001004254

• WGS and RNA-Seq data from a GBM patient PT-JE6375

  WGS and RNA-Seq data from a GBM patient PT-JE6375

  Dataset EGAD00001004246

• APCDR Uganda GWAS - High depth sequencing of a Baganda trio

  A family trio from Uganda (Baganda ethno-linguistic group) has been sequenced to high depth (ca. 30x) on the Illumina HiSeq 2500 platform.

  Dataset EGAD00001005346

• WGS and RNA-Seq data from a GBM patient PT-GC1519

  WGS and RNA-Seq data from a GBM patient PT-GC1519

  Dataset EGAD00001004239

• WGS and RNA-Seq data from a GBM patient PT-WT4796

  WGS and RNA-Seq data from a GBM patient PT-WT4796

  Dataset EGAD00001008532

• WGS and RNA-Seq data from a GBM patient PT-RD1291

  WGS and RNA-Seq data from a GBM patient PT-RD1291

  Dataset EGAD00001004256

• Genome and transcriptome sequence data from a GBM (H3 K27M mutant) tumor patient

  Genome and transcriptome sequence data from a GBM (H3 K27M mutant) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015328

• Genome and transcriptome sequence data from a high-grade glioma, glioblastoma tumor patient

  Genome and transcriptome sequence data from a high-grade glioma, glioblastoma patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015336

• Genome and transcriptome sequence data from a neurofibromatosis type 1 (NF1) tumor patient

  Genome and transcriptome sequence data from a neurofibromatosis type 1 (NF1) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015266

• Genome and transcriptome sequence data from a NHL large B cell tumor patient

  Genome and transcriptome sequence data from a NHL large B Cell patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015274

• Genome and transcriptome sequence data from a malignant granular cell tumor tumor patient

  Genome and transcriptome sequence data from a malignant granular cell tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015275

• Genome and transcriptome sequence data from a progressive facial plexiform neurofibroma tumor patient

  Genome and transcriptome sequence data from a progressive facial plexiform neurofibroma patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015282

• Genomic Profiling of Sequentially Acquired Metastatic Sites from an "Exceptional Responder" Lung Adenocarcinoma Patient Reveals Extensive Genomic Heterogeneity and Novel Somatic Variants

  We employed next-generation sequencing to identify somatic alterations in multiple metastatic sites from an "exceptional responder" lung adenocarcinoma patient during his seven year course of ERBB2-directed therapies. The degree of heterogeneity was unprecedented, with ~1% similarity between somatic alterations of the lung and lymph nodes. One novel translocation, PLAG1-ACTA2, present in both sites, up-regulated ACTA2 expression. ERBB2, the predominant driver oncogene, was amplified in both sites, more pronounced in the lung, and harbored an L869R mutation in the lymph node. Functional studies demonstrated increased proliferation, migration, metastasis, and resistance to ERBB2-directed therapy due to L869R mutation and increased migration due to ACTA2 overexpression. Within the lung, a nonfunctional CDK12, due to a novel G879V mutation, correlated with down-regulation of DNA damage response genes, causing genomic instability, and sensitivity to chemotherapy. We propose a model whereby a sub-clone metastasized early from the primary site and evolved independently in lymph nodes.

  Study phs001159

• Mesenchymal inflammation drives genotoxic stress in hematopoietic stem cells and predicts disease evolution in human pre-leukemia

  Mesenchymal niche cells may drive tissue failure and malignant transformation in the hematopoietic system but the molecular mechanisms and their relevance to human disease remain poorly defined. We demonstrated that perturbation of mesenchymal cells in a mouse model of the preleukemic disorder Shwachman-Diamond syndrome induces mitochondrial dysfunction, oxidative stress and activation of DNA damage responses in hematopoietic stem and progenitor cells. In this study we demonstrate, through massive parallel RNA sequencing of highly purified mesenchymal cells in a range of human preleukemic syndromes, TP53-S100A8/9-TLR4 inflammatory signaling as a common driving mechanism of genotoxic stress, which could be attenuated by TLR4 blockade. S100A8/9 expression in mesenchymal cells predicted outcome in myelodysplastic syndromes, the principal human preleukemic condition, independent of known prognostic variables. Collectively, findings reveal a concept of mesenchymal niche-induced genotoxic stress in heterotypic stem and progenitor cells through inflammatory signaling as an actionable determinant of disease outcome in human preleukemia. The data further provide novel conceptual and mechanistic insights into the intimate link between inflammation and cancer.

  Study EGAS00001001926

• Integrated genomic, transcriptional and epigenomic analyses in germinal center-cell lymphomas link the mutation landscape with differential DNA methylation in Burkitt lymphoma

  Biologically and clinically diverse B-cell neoplasms, including Burkitt, follicular and diffuse large B-cell lymphoma, show features of germinal center (GC) B-cells. Here we present a comprehensive analysis of the epigenetic landscape of GC-B-cell lymphomas using whole genome bisulfite sequencing paired with genome and transcriptome sequencing from 29 primary tumor samples and four normal GC-B-cell samples. All lymphomas studied showed extensive genome-wide methylation losses as well as intragenic regions where DNA methylation levels were strongly correlated with expression of associated genes. Pathway analysis revealed that these intragenic regions were enriched in signaling networks differentially activated in Burkitt and follicular lymphomas and affected regulatory mechanisms deregulated by recurrent mutations in a large fraction of Burkitt lymphomas (including the ID3/TCF3 complex, the SWI/SNF remodeling complex and the inhibitory GI signaling pathway). Taken together, these results provide a global picture of Burkitt lymphoma pathomechanism and demonstrate a tight connection between epigenetic regulation and other levels of regulatory control in these tumors.

  Study EGAS00001001067

• Pancreatic Cancer Sequencing Initiative

  Pancreatic Cancer Sequencing Initiative for the International Cancer Genome Consortium at the Ontario Institute for Cancer Research.

  Study EGAS00001000343

• Single Cell Genomic Analysis of Lymphoma

  Our study aimed to define the extent of heterogeneity between anatomically separated tumor manifestations in follicular lymphoma at single-cell resolution. We subjected single-cell suspensions derived from nodal, synchronously-acquired fine needle aspirations from two distinct tumor sites to high-throughput microfluidics-based single-cell RNA sequencing. By comparing the relative composition of the tumor subpopulations between the two tumor sites, we found that some patients can exhibit site-to-site differences. While the overall composition of the tumor microenvironment did not differ significantly between sites, we did detect a specific correlation between site-to-site tumor heterogeneity and T follicular helper cell abundance. Our study demonstrates the significant limitations of a solitary biopsy in defining the full scope of a patient's disease.

  Study phs002188

• March 2017 data update (bam/fastq) (containing H3K27ac for CEMT_87, RNA-Seq for CEMT_141, CEMT_142, CEMT_145, CEMT_146, H3K27me3, H3K9me3, H3K4me3, H3K4me1, ChIP-Seq Input for CEMT_88, CEMT_90 and CEMT_91) for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  March 2017 data update (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies (Canadian Epigenetics, Environment and Health Research Consortium), Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001003272

• Fastq data for stranded mRNA-Seq assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for stranded mRNA-Seq assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001402

• Fastq data for whole genome shotgun sequencing for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for whole genome shotgun sequencing assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001400

• Fastq data for whole genome bisulfite sequencing for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for whole genome bisulfite sequencing assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001312

• MBD4 targeted sequencing

  We sequenced a gene of interest, MBD4, in both germline (n=1099) and tumor (n=192) sample from Uveal Melanoma patients.

  Study EGAS00001005012

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• WGS and RNA-Seq data from a GBM patient PT-DS9789

  WGS and RNA-Seq data from a GBM patient PT-DS9789

  Dataset EGAD00001004233

• WGS and RNA-Seq data from a GBM patient PT-GJ3716

  WGS and RNA-Seq data from a GBM patient PT-GJ3716

  Dataset EGAD00001004240

• WGS and RNA-Seq data from a GBM patient PT-KM5291

  WGS and RNA-Seq data from a GBM patient PT-KM5291

  Dataset EGAD00001004249

• WGS and RNA-Seq data from a GBM patient PT-JW6420

  WGS and RNA-Seq data from a GBM patient PT-JW6420

  Dataset EGAD00001004248

• WGS and RNA-Seq data from a GBM patient PT-SK0976

  WGS and RNA-Seq data from a GBM patient PT-SK0976

  Dataset EGAD00001004260

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line WXS

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009758

• WGS and RNA-Seq data from a GBM patient PT-LC6372

  WGS and RNA-Seq data from a GBM patient PT-LC6372

  Dataset EGAD00001008522

• Whole-genome sequencing (WGS) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  We used WGS (Complete Genomics) to characterise five metastatic tumours from a BRAF mutant melanoma patient who presented intrinsic resistance.

  Dataset EGAD00001003120

• WGS and RNA-Seq data from a GBM patient PT-PD6881

  WGS and RNA-Seq data from a GBM patient PT-PD6881

  Dataset EGAD00001004255

• WGS and RNA-Seq data from a GBM patient PT-LC3356

  WGS and RNA-Seq data from a GBM patient PT-LC3356

  Dataset EGAD00001004250

• Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx tumor patient

  Genome and transcriptome sequence data from a embryonal rhabdomyosarcoma of the nasopharynx patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015307

• Genome and transcriptome sequence data from a rosette-forming glioneuronal tumor (RGNT) tumor patient

  Genome and transcriptome sequence data from a rosette-forming glioneuronal tumor (RGNT) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015320

• WGS and RNA-Seq data from a GBM patient PT-EV3071

  WGS and RNA-Seq data from a GBM patient PT-EV3071

  Dataset EGAD00001004234

• Genome and transcriptome sequence data from a diffuse midline glioma, H3K27 mutant tumor patient

  Genome and transcriptome sequence data from a diffuse midline glioma, H3K27 mutant patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015326

• Aggregated panel-seq VCF for initial cohort screened for BoB

  Aggregated VCF file from cancer genes panel seq for the initial (n=500) cohort of solid tumors screened for the Basket of Baskets study

  Dataset EGAD00001008437

• A Model of Human Asthma Exacerbation Identifies Mechanisms That Drive Allergic Asthma

  In this study, we will enroll allergic adults to undergo bronchoscopic segmental allergen challenge, in order to identify differences in the airway immune response to allergen in those with asthma compared to those without asthma. After a discussion about the study and potential risks, subjects giving written informed consent will undergo two bronchoscopies. During the first procedure, samples will be collected from the left lung and allergen will be administered to a small segment of the right lung. The second procedure will be performed 24 hours later, with collection of samples from the allergen-challenged lung segment.

  Study phs003101

• DO NOT USE - Whole genome sequencing of SI-NETs from five patients

  Small intestine neuroendocrine tumor (SI-NET), the most common cancer of the small bowel, often displays a curious multifocal phenotype with several intestinal tumors centered around a regional lymph node metastasis, yet the typical path of evolution of these lesions remains unclear. Here, we determined the complete genome sequences of 37 tumors from 5 patients with multifocal SI-NET, allowing elucidation of phylogenetic relationships between multiple intestinal tumors and metastases in individual patients.

  Study EGAS00001004435

• Breast Cancer Family Registry Early-onset Breast Cancer GWAS

  In order to enhance our understanding of the genetic etiology of breast cancer, this study analyzed 1,265,548 Hapmap3 single-nucleotide polymorphisms (SNP) among a discovery set of 3,523 EOBC incident cases and 2,702 age-matched population control women, all of whom were age 50 or younger at enrollment. Subjects were recruited from the eight sites, some of which oversampled cases with a personal or family history of breast cancer.

  Study phs001589

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• Whole-exome sequencing of Helicobacter pylori-uninfected normal gastric gland

  Recent studies showed that somatic mutations accumulate in normal tissues with age; however, mutation accumulation in the Helicobacter pylori-uninfected normal gastric mucosa has not been reported. A total of 18 biopsied gastric mucosa were obtained from nine subjects without Helicobacter pylori-infection or gastric cancer. Gastric epithelia were manually dissociated from the lamina propria. Subsequently, single glands were picked up under a stereomicroscope. Genomic DNA isolated from each gland was subjected to whole-exome sequencing.

  Study JGAS000313

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Spatial Heterogeneity in CLL

  A whole-genome/exome sequencing (WGS/WES) characterization of the spatial heterogeneity found in chronic lymphocytic leukemia (CLL) at diagnosis. Fifteen synchronous peripheral blood and lymph node samples were analyzed by WGS (n=2) or WES (n=13). Subtle differences in the global architecture of the tumor at peripheral blood and lymph node were observed only in a fraction of patients. Spatial heterogeneity was not found among the well-established CLL driver alterations.

  Study EGAS00001003803

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-RW9277

  WGS and RNA-Seq data from a GBM patient PT-RW9277

  Dataset EGAD00001004259

• Genome and transcriptome sequence data from a diffuse aarge B-cell lymphoma (relapse) tumor patient

  Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015308

• Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm tumor patient

  Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015312

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor tumor patient

  Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015322

• Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour tumor patient

  Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015327

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001403

• Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001409

• Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001408

• Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001404

• Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001406

• Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001405

• Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001407

• Targeted sequencing of diffuse large B-cell lymphoma tumour samples from the UK's Haematological Malignancy Research Network

  Targeted sequencing was applied to an unselected population-based diffuse large B-cell lymphoma cohort (n=928) diagnosed in the UK's Haematological Malignancy Research Network catchment population of ~4 million (14 centres). DNA extracted from tumour samples was sequenced with a 293-gene panel using the Illumina HiSeq 2500. All data are provided in the CRAM format.

  Dataset EGAD00001008616

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• Comprehensive RNA repository of tissue and plasma from patients with esophageal cancer or precursor lesions

  A comprehensive RNA repository (both coding and non-coding) from 17 patients diagnosed with esophageal adenocarcinoma, high-grade dysplastic or non-dysplastic Barrett’s esophagus. Per patient, a blood plasma sample, and a healthy esophageal and disease tissue sample were collected. This dataset includes both mRNA and small RNA sequencing data (fastq.gz files) of all tissue and plasma samples. In total,102 RNA-seq libraries from 51 samples (17 plasma and 34 tissue samples) were sequenced (plasma mRNA libraries were sequenced twice).

  Dataset EGAD00001006857

• DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001005757

• Very short reads file for testing purposes

  Very short FASTQ reads file for testing purposes

  Study EGAS00001001701

• Amplicon sequencing of IPC-298 and MelJuso parental cell lines and Belvarafenib resistant IPC-298 colony

  Amplicon seqeuencing of (1) wildtype IPC298 cell line grown for 3-4 weeks with DMSO, amplified for ARAF exon 11 (2) IPC298 cells treated for 3-4 weeks with 10uM belvarafenib, isolated colony 9, amplified for ARAF exon 11 (3) MelJuso cell line grown with DMSO, amplified for ARAF exon 11

  Dataset EGAD00001007061