10960 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 60.91 milliseconds.

• Multimodal Immune Profiling to Determine Mechanisms of COVID-19 Clinical Trajectory in Uganda

  We conducted a prospective cohort study of adults (RESERVE-U-C19) admitted to Entebbe Regional Referral Hospital (ERRH), a national COVID-19 referral center, across three viral variant-driven phases of the pandemic in Uganda. In this cohort, which reflects the entire spectrum of SARS-CoV-2 infection, we integrated clinical data with serum proteomics (N=306) and whole-blood transcriptomics (N=100) to determine a range of host responses associated with COVID-19 severity, SARS-CoV-2/HIV co-infection, and circulating viral variants. Beyond the prognostic importance of myeloid cell-driven immune activation and lymphopenia, we show that multifaceted impairment of host protein synthesis and extensive redox imbalance define core metabolic signatures of severe COVID-19, with central roles for IL-7, IL-15, and lymphotoxin-α in COVID-19 respiratory failure. While prognostic signatures were generally consistent in SARS-CoV-2/HIV-coinfection, type I interferon responses uniquely scaled with COVID-19 severity in persons living with HIV. Throughout the pandemic, COVID-19 severity peaked during phases dominated by A.23/A.23.1 and Delta B.1.617.2/AY variants, with Delta phase COVID-19 distinguished by exaggerated pro-inflammatory myeloid cell and inflammasome activation, NK and CD8+ T-cell depletion, impaired host protein synthesis, and upregulation of viral cell entry and trafficking pathways. Data from this study available through dbGaP include raw RNA-Seq data from whole-blood of adult participants (N=100).

  Study phs003246

• Genetics of Disorders Affecting Tooth Structure, Number, Morphology and Eruption

  The long-term objective of this research project is to discover the complete spectrum of genes that contribute to the etiologies of genetic disorders of dentition. Inherited tooth defects can be isolated (the only symptom) or syndromic (having additional symptoms), and can be caused by mutations in many different genes. Clinically, it can be difficult to distinguish among the diverse forms. Making an accurate diagnosis would be greatly improved if reliable tests could identify the specific genetic defect that causes the disease in each case. Current technology can identify the numerous sequence variations throughout a patient's exome, but the disease-causing variation among them cannot be identified unless it is already on the list of genes that potentially cause the disease. A diagnosis based upon the genetic defect that causes the disorder distinguishes between isolated and syndromic tooth defects. A precise diagnosis permits formulation of a more accurate prognosis, which informs treatment decisions. The benefits of accomplishing our aims are to 1) enable genetic testing to achieve a precise and accurate diagnosis, and thereby optimize treatment, and 2) improve our understanding of normal and pathological tooth formation, leading to future improvements in treatment and eventually cures. Our short-term objectives are to 1) recruit kindreds with inherited disorders affecting their dentition, characterize their dental phenotype (and non-dental phenotypes when applicable) and the distribution of the disorder throughout the family, and 2) determine the genetic etiology of their disorders.

  Study phs001491

• Biomarkers in Transplant Recipients

  Biliary atresia causes jaundice and liver failure in newborn children. In this study, single nucleotide polymorphisms were characterized in children with biliary atresia and identified ARF6 as a susceptibility gene for this disease. Knockdown of this gene in zebrafish embryos impaired formation of bile ducts and excretion of bile from the zebrafish liver. Subject enrollment: Children with biliary atresia were enrolled at Children's Hospital of Pittsburgh (CHP) after obtaining written consent from parents for the University of Pittsburgh IRB approved protocol number 0405628. At the Center for Applied Genomics (CAG), all subjects were enrolled after obtaining written consent from parents per Children's Hospital of Philadelphia IRB approval number 06-004886 Genotyping array: Genotyping of DNA obtained from blood was performed with the Infinium HumanHap550K BeadChip (Illumina, San Diego, CA). Statistical methods and software: SNP genotype frequencies were compared between cases and controls with a chi-square test statistic applied in Plink [Purcell et al, 2007] for SNPs with at least 90% call rate and 1% minor allele frequency (MAF). Cases and controls: All DNA samples had excellent data quality with call rates > 98%. A total of 63 Caucasian BA cases and 1907 controls were compared at > 550000 SNPs, and demonstrated a very low genomic inflation factor of 1.00627. Description of Cases: Biliary atresia patients had received a Kasai procedure and demonstrated histopathological features of biliary obstruction, and were recruited at evaluation for transplantation or after liver transplantation.

  Study phs000960

• Smoking and the Vaginal Microbiome

  The focus of this study was to better understand the effects of cigarette smoking on the vaginal microbiome. There were two phases of the study, cross-sectional and longitudinal, conducted at the Center for Health Behavior Research at the University of Maryland School of Public Health. In the cross-sectional phase, 20 smokers and 20 non-smokers collected mid-vaginal swabs, measured their vaginal pH, prepared a vaginal smear on a slide for Nugent Gram stain analysis, and completed questionnaires about demographics, tobacco use, and reproductive and sexual health history. Smoking status was confirmed through self-report, carbon monoxide exhalation and saliva cotinine measures. Secretions from the mid-vaginal swabs were tested for presence/absence of HPV strains and GC-MS was used to quantify the levels of over 600 metabolites. In the longitudinal phase, 7 participants who were current smokers and motivated to quit smoking were recruited and followed for up to 12 weeks. On a daily basis, participants collected mid-vaginal swabs, measured their vaginal pH, and prepared a mid-vaginal smear on a slide for Nugent Gram stain analysis, and completed daily diaries on tobacco use and reproductive health. Carbon monoxide exhalation and saliva cotinine measures were collected at weekly clinical visits. In addition, participants had weekly behavioral counseling sessions about smoking cessation and used Nicoderm CQ patches to aid in quitting smoking. The self-collected vaginal swabs were used for DNA extractions,16s rRNA sequencing and measurement of metabolites in vaginal fluid.

  Study phs001386

• Tumor Mutation Burden, Expressed Neoantigen and Immune Microenvironment in Diffuse Gliomas

  A consistent correlation between tumor mutation burden (TMB) and tumor immune microenvironment has not been observed in gliomas as in other cancers. Driver germline and somatic mutations, TMB, neoantigen, and immune cell signatures were analyzed using whole exome sequencing (WES) and transcriptome sequencing of tumor and WES of matched germline DNA in a cohort of 66 glioma samples (44 IDH-mutant and 22 IDH-wildtype). Fourteen samples revealed a hypermutator phenotype (HMP). Eight pathogenic (P) or likely pathogenic (LP) germline variants were detected in 9 (19%) patients. Six of these 8 genes were DNA damage repair genes. P/LP germline variants were found in 22% of IDH-mutant gliomas and 12.5%of IDH-wildtype gliomas (p= 0.7). TMB was correlated with expressed neoantigen but showed an inverse correlation with immune score (R =−0.46, p= 0.03) in IDH-wildtype tumors and no correlation in IDH-mutant tumors. Antigen Processing and Presentation (APP) score correlates with immune score. The APP is higher in non-hypermutator phenotype (NHMP) samples versus HMP samples in the IDH-wildtype gliomas, but higher in HMP samples versus NHMP samples in the IDH-mutant gliomas. Conclusion: TMB was inversely correlated with the immune score in the IDH-wildtype gliomas, and showed no correlation in the IDH-mutant tumors. The APP was correlated with the immune score, and may be further investigated as a biomarker for response to immunotherapy in gliomas. Studies of germline variants in a large glioma cohort are warranted.

  Study phs002653

• Region-Specific Neural Stem Cell Lineages Revealed by Single-Cell RNA-Sequences from Human Embryonic Stem Cells

  During development of the human brain, multiple cell types with diverse regional identities are generated. Here we report a system to generate early human brain forebrain and mid/hindbrain cell types from human embryonic stem cells (hESCs), and infer and experimentally confirm a lineage tree for the generation of these types based on single-cell RNA-Seq analysis. We engineered SOX2Cit/+ and DCXCit/Y hESC lines to target progenitors and neurons throughout neural differentiation for single-cell transcriptomic profiling, then identified discrete cell types consisting of both rostral (cortical) and caudal (mid/hindbrain) identities. Direct comparison of the cell types were made to primary tissues using gene expression atlases and fetal human brain single-cell gene expression data, and this established that the cell types resembled early human brain cell types, including preplate cells. From the single-cell transcriptomic data a Bayesian algorithm generated a unified lineage tree, and predicted novel regulatory transcription factors. The lineage tree highlighted a prominent bifurcation between cortical and mid/hindbrain cell types, confirmed by clonal analysis experiments. We demonstrated that cell types from either branch could preferentially be generated by manipulation of the canonical Wnt/beta-catenin pathway. In summary, we present an experimentally validated lineage tree that encompasses multiple brain regions, and our work sheds light on the molecular regulation of region-specific neural lineages during human brain development.

  Study phs001205

• Cell Type-Specific and Disease-Associated eQTL in the Human Lung

  This study was conducted to investigate the genetic control of gene expression in a cell-type and context-specific manner in the human lung. We performed single-cell RNA-sequencing (scRNA-seq) of lung tissue from 66 Interstitial Lung Disease (ILD) cases and 48 unaffected donors. Employing a pseudo-bulk approach, we mapped expression quantitative trait loci (eQTL) across 38 cell types. The scRNA-seq data presented here include previously published (PMID 34262047) and unpublished samples. ILD tissue samples were obtained from lungs removed at the time of lung transplantation at either Vanderbilt University Medical Center (VUMC) or the Norton Thoracic Institute (NTI). Control tissue samples were obtained from lungs declined for organ donation either at the Donor Network of Arizona (DNA) or VUMC. The self-reported ethnicities of donors were 66.7% European, 9.6% African American, 17.5% not available (N/A), and 6.1% other. The smoking history includes 46.5% ever smoker, 29.8% never smoker, 23.7% N/A. For genotyping, flash-frozen tissue in DNA/RNA shield was homogenized via a bullet blender. Genomic DNA was extracted using Zymo Quick DNA/RNA microprep plus kit. Library preparation and low-pass Whole Genome Sequencing (WGS) were carried out at TGen or by Gencove Inc. At TGen, libraries were prepared using PCR-free Watchmaker kits (Watchmaker Genomics) with 200 ng input. Genomes were sequenced on NovaSeq at low coverage (typically 0.4–1x). The resulting sequence data were processed and imputed using Gencove's imputation platform.

  Study phs003521

• LCLF1.0 Data

  In this study, we investigated ad libitum food intake of 20 healthy adult volunteers who each completed a 4-week stay at the National Institutes of Health (NIH). During their stay, they consumed a low-carbohydrate, high-fat (LCHF) diet and a low-fat, high-carbohydrate (LFHC) diet for 2 weeks each, in random order. We collected information about energy intake and metabolic changes in response to the two test diets. The test diets were presented to subjects in amounts exceeding their daily energy requirements, and subjects were instructed to eat as much or as little of each diet as desired. This study implemented 7-day rotating menus for each test diet. The diets were matched for presented calories and protein, but the LCHF diet was low in carbohydrate (~10% of calories) and high in fat (~75% of calories) whereas the LFHC diet was high in carbohydrates (~75% of calories) and low in fat (~10% of calories). The two test diets had a common foundation of vegetables with low amounts of digestible carbohydrates such as lettuce, spinach, kale, cabbage, cauliflower, zucchini, tomato, asparagus, broccoli, peppers, brussels sprouts, and green beans. The LCHF diet included meat, poultry, fish, eggs, dairy, and nuts. The LFHC diet included legumes, rice, root vegetables, soy products, corn, lentils, peas, whole grains, bread, and fruit. The test diets were designed using a standard computerized nutrition database, and blood samples were collected from the subjects.

  Study phs003187

• Single Cell Genotypic and Phenotypic Analysis of Measurable Residual Disease in Acute Myeloid Leukemia

  Acute myeloid leukemia (AML) is a group of blood cancers with high mortality. Even though complete remission is often achieved, majority of the AML patients still relapse. Measurable residual disease (MRD), defined as the population of cancer cells which persists following chemotherapy, is responsible for AML relapse. Understanding the biology enabling MRD clones to resist therapy is necessary to guide the development of curative treatments more effectively. Discriminating residual leukemic clones, preleukemic clones, and normal precursors remains a challenge with current MRD tools. We developed a single cell MRD (scMRD) assay by combining flow cytometric enrichment of the targeted precursor/blast population with integrated single cell DNA sequencing (scDNA-seq) and immunophenotyping (Tapestri, Missionbio). The platform utilizes a custom amplicon panel covering 109 amplicons across 31 genes frequently mutated in AML and a panel of 42 oligo-conjugated antibodies against surface makers. We applied our scMRD assay to sequence 30 MRD samples (multiplexed into 6) from 29 AML patients to study the clonal architecture and protein correlation. In addition, 2 MRD samples were sequenced with scDNA+protein sequencing technology without enrichment or multiplexing. Five patients with AML at diagnosis were also sequenced with scDNA+protein sequencing technology without enrichment or multiplexing. In order to establish the sensitivity of our scMRD assay, we spiked AML cells into normal bone marrow cells. We sequenced 12 such spiked samples after multiplexing.

  Study phs003233

• Comprehensive Genomic Characterization of Translocation Renal Cell Carcinoma

  Xp11 translocation renal cell carcinoma (tRCC) is a rare, female-predominant cancer driven by a fusion between the TFE3 gene on chromosome Xp11.2 and a partner gene on either chrX or an autosome. It remains unknown what types of rearrangements underlie TFE3 fusions, whether fusions can arise from both the active (chrXa) and inactive X (chrXi) chromosomes, and whether TFE3 fusions from chrXi translocations account for the female predominance of tRCC. To address these questions, we performed haplotype-specific analyses of chrX rearrangements in tRCC whole genomes. We show that TFE3 fusions universally arise as reciprocal translocations and that oncogenic TFE3 fusions can arise from chrXi:autosomal translocations. Female-specific chrXi:autosomal translocations result in a 2:1 female-to-male ratio of TFE3 fusions involving autosomal partner genes and account for the female predominance of tRCC. Our results highlight how X chromosome genetics uniquely constrains somatic chrX alterations and underlies cancer sex differences.This version of the dbGaP study provides a comprehensive set of whole genome data and tables with clinical information collected for the 16 patients (15 pateints as tRCC and 1 patient as ccRCC) in the study cohort. The data also contains 12 RNA-seq samples used in the study and analyses. We anticipate that this data will considerably advance our molecular and genetic understanding of oncogenic translocations in TFE3-tRCC involving inactive chromosome X and its role in cancer sex bias.

  Study phs003008

• Uncovering Inversion Formation in the Human Genome and its Impact to Disease

  The relevance of inversions for disease causation, speciation and adaptation is broadly recognized, although the prevalence of inversions is unknown. In humans, de novo inversions are associated with congenital anomalies in approximately 9.6% of patients. Yet, despite the biological relevance of inversions, their molecular features, formation mechanism, impact to the genomic structure of carriers, as well as their contribution to clinical phenotypes, have not been further explored. Inversions are typically classified as balanced reciprocal events generated by ectopic recombination, although recent studies reveal a distinct picture whereby inversions originate from mechanisms that concomitantly generate copy number variants (CNVs). Surprisingly, those complex inversions underlie as much as 30% of neurodevelopmental-associated CNVs. The hypothesis of this project are: inversions are often generated de novo by mechanisms other than ectopic recombination a relevant fraction of inversions are associated with complex genomic rearrangements (CGRs), often overlooked in sporadic diseases, and inversions are a "hidden" type of structural variation for which contribution to a clinical phenotypes has been under assessed due to the lack of appropriate detection tools. A combined strategy using multiple genomic tools will be applied to characterize inversions and associated genomic alterations in individuals with neurodevelopmental disorders and controls: whole genome sequencing (WGS) with short-and long-reads; genome mapping; classical cytogenetics; and array CGH. This project will establish common ground to bridge studies of rare and common diseases, human evolution, and population genetics.

  Study phs002999

• Risk Factors for Asymptomatic Diverticulosis

  Data for this analysis came from a prospective study of colonic diverticulosis at the University of North Carolina Hospital in Chapel Hill, North Carolina (NIH R01DK094738). This is a case-control genetic and transcriptomic study to identify the genetic and cellular determinants underlying colonic diverticulosis and the relationship with other gastrointestinal disorders. The study inclusion and exclusion are described below. DNA and RNA sequencing were performed on colonic tissue from 404 patients with (N=172) and without (N=232) diverticulosis. We assessed variation in the transcriptome associated with diverticulosis and integrated this variation with human intestine single-cell RNA-seq data. We integrated our expression quantitative trait loci with GWAS using Mendelian Randomization. A polygenic risk score analysis examined associations between severity of diverticulosis and other gastrointestinal disorders. We identified 38 genes with differential expression and 17 genes with varied transcript usage linked to diverticulosis. Our results suggest tissue remodeling as a primary mechanism for diverticula formation. The presence of diverticulosis was linked to stromal and epithelial cells in the colon including endothelial cells, myofibroblasts, fibroblasts, goblet, tuft, enterocytes, neurons, and glia. MR highlighted five genes including CCN3, CRISPLD2, ENTPD7, PHGR1, and TNFSF13. In diverticulosis cases, ENTPD7 upregulation was confirmed. A greater burden of diverticula was positively correlated with genetic predisposition to diverticulitis. The data related to the study including total RNA-Seq, SNP array and imputed genotypes will be available through dbGaP.

  Study phs003556

• Alpha1-Antitrypsin Deficiency Registry (AADR-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives: To characterize the clinical and laboratory course of patients with severe alpha 1-antitrypsin deficiency whether or not the patient is undergoing long-term augmentation therapy.Background: A hereditary disorder, patients with low serum levels of alpha-1-antitrypsin are at an increased risk for the early onset of emphysema. The only approved treatment for alpha-1-antitrypsin deficiency is augmentation therapy using a purified preparation of human alpha-1-antitryspin. Sample sizes for a randomized controlled clinical trial of augmentation therapy were determined to be infeasible; therefore, a multi-center registry was initiated in 1988 to explore the natural history of the disease and the relative efficacy of augmentation therapy in patients with a severe deficiency of alpha-1-antitrypsin.Participants: Eligible participants included individuals 18 years of age or greater for whom the Central Laboratory confirmed that the serum alpha 1-antitrypsin level is Conclusions: Participants receiving augmentation therapy had decreased mortality risk during follow-up. FEV1 decline among all participants did not differ by augmentation therapy; however, among participants with FEV1 35-49% predicted, FEV1 decline was significantly slower for participants on augmentation therapy than for those not receiving therapy. (Am J Respir Crit Care Med, 1998; 158:49-59)

  Study phs004187

• Whole exome sequencing data for paired non-serous endometrial and ovarian carcinomas from 27 patients with concurrent tumours.

  Introduction: Concurrent non-serous endometrial and ovarian tumours are often managed clinically as two separate primary tumours, but almost all exhibit evidence of a genomic relationship. Methodology: This study investigates the extent of relatedness using whole exome sequencing, which was performed on paired non-serous endometrial and ovarian carcinomas from 27 patients with concurrent tumours in a cohort with detailed clinicopathological annotation. Four whole exome sequencing-derived parameters (mutation, mutational burden, mutational signatures and mutant allele tumour heterogeneity scores) were used to develop a novel unsupervised model for the assessment of genomic similarity to infer genomic relatedness of paired tumours. Results: This novel model demonstrated genomic relatedness across all four parameters in all tumour pairs. Mutations in PTEN, ARID1A, CTNNB1, KMT2D and PIK3CA occurred most frequently and 24 of 27 (89 %) tumour pairs shared identical mutations in at least one of these genes, with all pairs sharing mutations in a number of other genes. Ovarian endometriosis, CTNNB1 exon 3 mutation, and progression and death from disease were present across the similarity ranking. Mismatch repair deficiency was associated with less genomically similar pairs. Discussion: Although there was diversity across the cohort, the presence of genomic similarity in all paired tumours supports the hypothesis that concurrent non-serous endometrial and ovarian carcinomas are genomically related and may have arisen from a common origin. Keywords: Co-existing; Concurrent; Endometrial carcinoma; Genomics; Mutation; Ovarian carcinoma; Paired tumours; Tumour mutational burden.

  Study EGAS00001008259

• Multi-omics bulk and single-cell profiling of epithelioid sarcoma

  Epithelioid sarcoma (EpS) is an aggressive sarcoma, characterized by the loss of SMARCB1 expression. EpS is traditionally classified as distal or proximal according to clinicopathological features, but its molecular characteristics remain largely unknown. To establish an EpS molecular classification and uncover determinants of inter- and intra-patient heterogeneity in EpS, we used multi-omics profiling and integrated the genomic, transcriptional and methylome landscapes with single-cell RNA sequencing on fresh samples as well as spatial transcriptomics. We identified two molecular subtypes of EpS: “distal-like” and “proximal-like”, which were distinct from the histological subtypes. Distal-like tumors include all morphological distal subtypes and a subset of proximal and hybrid EpS. They express a specific molecular single-cell derived epithelial-to-mesenchymal transition signature, which associates with improved patient survival and includes Desmoglein 2 (DSG2), which we identify as a potential routine immunohistochemical biomarker to improve diagnosis. Distal-like EpS also display increased peri-tumoral CD8+ T cell infiltrates and specific tumor-immune cell interactions. Conversely, proximal-like EpS harbor a higher inter-tumoral molecular heterogeneity with some cases resembling other SMARCB1-deficient tumors by DNA methylation profiling, and increased intra-tumoral pro-tumoral macrophage infiltrates. Our study introduces a novel molecular classification of EpS with prognostic value, associated diagnostic biomarkers and distinct tumor immune microenvironments, which extends beyond traditional clinicopathological classification. This paves the way for precision medicine-based therapeutic strategies for patients with EpS.

  Study EGAS50000000973

• Evolution of the African pygmy phenotype

  The evolutionary history of the human ‘pygmy’ phenotype (small body size), a characteristic of African and Southeast Asian rainforest hunter-gatherers, is largely unknown. Here we use a genome-wide admixture mapping analysis to identify 16 genomic regions that are significantly associated with the pygmy phenotype in the Batwa, a rainforest hunter-gatherer population from Uganda (East Central Africa). The identified genomic regions have multiple attributes that provide supporting evidence of genuine association with the pygmy phenotype, including enrichments for SNPs previously associated with stature variation in Europeans and for genes with growth hormone receptor and regulation functions. To test adaptive evolutionary hypotheses we computed the haplotype-based iHS statistic and the level of population differentiation (FST) between the Batwa and their agricultural neighbors, the Bakiga, for each SNP. Both |iHS| and FST values were significantly higher for SNPs within the Batwa pygmy phenotype-associated regions than the remainder of the genome, a signature of polygenic adaptation. In contrast, when we expanded our analysis to include Baka rainforest hunter-gatherers from Cameroon and Gabon (West Central Africa) and Nzebi and Nzime neighboring agriculturalists, we did not observe elevated |iHS| or FST values in these genomic regions. Together, these results suggest adaptive and at least partially convergent origins of the pygmy phenotype even within Africa, supporting the hypothesis that small body size confers a selective advantage for tropical rainforest hunter-gatherers but raising questions about the antiquity of this behavior.

  Study EGAS00001000908

• Targets of MEK inhibition in DIPG

  The survival of children with diffuse intrinsic pontine glioma (DIPG) remains dismal, with new treatments desperately needed. In the era of precision medicine, targeted therapies represent an exciting treatment opportunity, yet resistance can rapidly emerge, playing an important role in treatment failure. In a prospective biopsy-stratified clinical trial, we combined detailed molecular profiling (methylation BeadArray, exome, RNAseq, phospho-proteomics) linked to drug screening in newly-established patient-derived models of DIPG in vitro and in vivo. We identified a high degree of in vitro sensitivity to the MEK inhibitor trametinib in samples which harboured genetic alterations targeting the MAPK pathway, including the non-canonical BRAF_G469V mutation, and those affecting PIK3R1 and NF1. However, treatment of PDX models and of a patient with trametinib at relapse failed to elicit a significant response. We generated trametinib-resistant clones in the BRAF_G469V model through continuous drug exposure, and identified acquired mutations in MEK1/2 (MEK1_K57N, MEK1_I141S and MEK2_I115N) with sustained pathway up-regulation. These cells showed the hallmarks of mesenchymal transition, and expression signatures overlapping with inherently trametinib-insensitive primary patient-derived cells that predicted an observed sensitivity to dasatinib. Combinations of trametinib with dasatinib and the downstream ERK inhibitor ulixertinib showed highly synergistic effects in vitro. These data highlight the MAPK pathway as a therapeutic target in DIPG, and show the importance of parallel resistance modelling and rational combinatorial treatments likely to be required for meaningful clinical translation.

  Study EGAS00001004495

• Platelet RNAseq data for SLFN14 K219N patients

  Pathogenic missense variants in SLFN14, which encodes an RNA endoribonuclease protein that regulates rRNA degradation, are known to cause inherited thrombocytopenia with impaired platelet aggregation and ATP secretion. Despite rather mild laboratory defects, these patients display an obvious bleeding phenotype. The function of SLFN14 in megakaryocyte (MK) and platelet biology is unknown. This study aims to characterize the platelet transcriptome in patients with a SLFN14 K219N variant and model the disease in the immortalized megakaryocyte cell line imMKCL. Total platelet RNA was sequenced for two patients and 19 healthy controls. Differential gene expression analysis yielded a total of 2999 and 2888 significantly (|log2FC|>1, FDR<0.05) up- and downregulated genes, respectively. Remarkably, these downregulated genes were not enriched for any biological pathway while upregulated genes were enriched for pathways involved in (mitochondrial) translation and transcription with a significant upregulation of 134 ribosomal protein genes (RPG). Heterozygous and homozygous SLFN14 K219N imMKCL showed a defect in MK differentiation that aggravated during cell passaging of undifferentiated cells and in proplatelet formation. SLFN14 defective platelets and MK showed signs of rRNA degradation while this was absent in undifferentiated imMKCL cells. Upregulation of RPG through increased mTOR signaling in SLFN14 K219N MK seems to be a compensatory response for rRNA degradation. Indeed, mTOR inhibition with rapamycin resulted in further enhanced rRNA degradation in SLFN14 K219N MK. Taken together, our study indicates dysregulation of mTOR-regulated ribosomal biogenesis as the disease mechanism for SLFN14-related thrombocytopenia.

  Study EGAS00001006339

• RB1 Gene Inactivation by Chromothripsis in Human Retinoblastoma

  Retinoblastoma is a rare childhood cancer of the developing retina. Most retinoblastomas initiate with biallelic inactivation of the RB1 gene through diverse mechanisms including point mutations, nucleotide insertions, deletions, loss of heterozygosity and promoter hypermethylation. Recently, a novel mechanism of retinoblastoma initiation was proposed. Gallie and colleagues discovered that a small proportion of retinoblastomas lack RB1 mutations and had MYCN amplification [1]. In this study, we identified recurrent chromosomal, regional and focal genomic lesions in 94 primary retinoblastomas with their matched normal DNA using SNP 6.0 chips. We also analyzed the RB1 gene mutations and compared the mechanism of RB1 inactivation to the recurrent copy number variations in the retinoblastoma genome. In addition to the previously described focal amplification of MYCN and deletions in RB1 and BCOR, we also identified recurrent focal amplification of OTX2, a transcription factor required for retinal photoreceptor development. We identified 10 retinoblastomas in our cohort that lacked RB1 point mutations or indels. We performed whole genome sequencing on those 10 tumors and their corresponding germline DNA. In one of the tumors, the RB1 gene was unaltered, the MYCN gene was amplified and RB1 protein was expressed in the nuclei of the tumor cells. In addition, several tumors had complex patterns of structural variations and we identified 3 tumors with chromothripsis at the RB1 locus. This is the first report of chromothripsis as a mechanism for RB1 gene inactivation in cancer.

  Study EGAS00001000598

• Bacterial SNPs in the human gut microbiome associate with host BMI

  Genome-wide association studies (GWAS) have revolutionized the field of genetics, providing numerous associations between human SNPs and health traits. Likewise, metagenome-wide association studies (MWAS) between bacterial SNPs and human traits can suggest mechanistic links between the microbiota and its host. However, very few such studies have been done to date, in part due to the large number of samples required to address the variable coverage of bacteria across samples and the fact that most bacteria are present in only a subset of the population. Here, we devised an MWAS framework to detect SNPs and associate them with host phenotypes systematically. We recruited and obtained gut metagenomic samples from a cohort of 7,190 healthy individuals and discovered 1,358 statistically significant associations between a bacterial SNP and host body mass index (BMI). To address the possible effects of population structure and linkage disequilibrium, we applied a clumping procedure, and found 40 independent associations between SNPs and host BMI. We uncovered BMI-associated SNPs in the genomes of 27 bacterial species, even though the relative abundance of 12 of these species was not associated with the phenotype. We separated genome-wide sub-species variations from local associations in individual SNPs, and demonstrated how this framework can highlight specific bacterial functions of interest. Our results demonstrate the importance of considering nucleotide-level diversity in microbiome studies and pave the way toward a better understanding of interpersonal gut microbiome differences and their health implications.

  Study EGAS00001007204

• Molecular Attributes Underlying Central Nervous System and Systemic Relapse in Diffuse Large B-cell Lymphoma

  Central nervous system (CNS) relapse in diffuse large B-cell lymphoma remains a significant conundrum. While clinical risk scores and biomarkers allow the identification of patients with higher risk of CNS relapse, their predictive ability is low. Herein, we report findings from a comprehensive study examining gene expression changes, mutations and clonal evolution. Firstly, considering diagnostic samples from patients with CNS relapse, systemic relapse or no relapse, we found a striking enrichment of gene expression changes reflecting protein biosynthesis in patients who experienced CNS or systemic relapse. Furthermore, diagnostic specimens of relapsing cases were characterized by low immune infiltrates. The most discriminative gene feature in our analysis was SLAMF1, high expression of which was associated with favourable outcomes. Next, we assessed whether specific gene mutations were associated with subsequent CNS or systemic relapse. Activated B-cell-like genes such as PIM1, CD79B and PRDM1 were more frequently mutated in cases with CNS relapse, whereas TP53, BCL2 and FOXO1 mutations were associated with systemic relapse. Lastly, we performed tumor evolution analysis in five patients, identifying significant clonal divergence that accompanied CNS relapse. In summary, we identified both common biology underlying both CNS and systemic relapse, independent of cell-of-origin (COO), and specific COO-enriched gene mutations that conferred a higher risk of either CNS or systemic relapse. Moreover, we identified a pattern of clonal evolution that can explain difficulties in both predicting and treating CNS relapse.

  Study EGAS00001004057

• UK10K_RARE_HYPERCHOL

  In the UK10K project we propose a series of complementary genetic approaches to find new low frequency/rare variants contributing to disease phenotypes. These will be based on obtaining the genome wide sequence of 4000 samples from the TwinsUK and ALSPAC cohorts (at 6x sequence coverage), and the exome sequence (protein coding regions and related conserved sequence) of 6000 samples selected for extreme phenotypes. Our studies will focus primarily on cardiovascular-related quantitative traits, obesity and related metabolic traits, neurodevelopmental disorders and a limited number of extreme clinical phenotypes that will provide proof-of-concept for future familial trait sequencing. We will analyse directly quantitative traits in the cohorts and the selected traits in the extreme samples, and also use imputation down to 0.1% allele frequency to extend the analyses to further sample sets with genome wide genotype data. In each case we will investigate indels and larger structural variants as well as SNPs, and use statistical methods that combine rare variants in a locus or pathway as well as single-variant approaches.Familial Hypercholesterolemia is a condition where the affected person has a consistently high level of LDL which can lead to early clogging of the coronary arteries. All patients selected for this study will have been found not to carry the common APOB and PCSK9 mutations, and to have no detectable LDLR mutations by testing for 18 common mutations. For further information with regard to this cohort please contact Steve Humphries(steve.humphries@ucl.ac.uk).

  Study EGAS00001000129

• Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)

  Purpose: Pediatric solid tumors arise from diverse tissues during development and exhibit a wide range of molecular, cellular and genetic features. This diversity, combined with the low incidence of pediatric cancer makes it increasingly difficult to personalize therapy for individual patients based on the unique features of their tumors. Therefore, well-credentialed preclinical models that capture the diversity and heterogeneity of pediatric solid tumors are essential for identifying molecular targeted therapeutics for precision medicine. Experimental Design: Here, we report 281 orthotopic patient derived xenografts (O-PDXs) from 224 patients representing 24 different types of pediatric solid tumors. We have performed genomic characterization of the O-PDXs and compared them to their corresponding patient tumors. To demonstrate the feasibility and utility of using such a diverse collection of O-PDXs in preclinical studies, we performed a preclinical pediatric precision medicine trial based on the NCI-COG Pediatric MATCH trial enrollment criteria. We also tested molecular targeted therapy for a novel oncogenic fusion recently reported in pediatric melanoma and precision drug delivery using nano-liposomal irinotecan. Results: In the preclinical match study, we identified one specific single agent response to LY3023414 in an osteosarcoma model with a TSC2 variant of unknown significance. Combinations of nano-liposomal irinotecan were effective in treating both Ewing sarcoma and rhabdomyosarcoma xenografts. Conclusion: Our studies demonstrate the value of large, well-credentialed preclinical models for future precision medicine in pediatric oncology using single agents, drug combinations and novel drug formulations.

  Study EGAS00001008011

• Genetic and epigenetic characterization of adenoid cystic carcinoma

  Translocation events are frequent in cancer and may create chimeric fusions or regulatory rearrangements that drive oncogene overexpression. Although regulatory rearrangements are increasingly recognized in hematopoietic and even solid tumors, the underlying mechanisms remain obscure. Here we identify super-enhancer translocations that drive overexpression of the oncogenic transcription factor MYB as a unifying theme in adenoid cystic carcinoma (ACC). Whole genome sequencing data and chromatin state maps for 13 primary tumors and xenografts reveal distinct chromosomal rearrangements that juxtapose super-enhancer clusters to the MYB locus. Chromosome conformation capture confirms that the translocated enhancers physically interact with the MYB promoter. Remarkably, the MYB product itself binds to the translocated enhancers, thus creating a positive feedback loop that sustains its own expression. MYB also binds a large number of active enhancers that drive opposing regulatory programs in alternate cell lineages in ACC. MYB cooperates with the transcription factor TP63 in the myoepithelial component of the tumors, but promotes a Notch program in the luminal epithelial component. Bromodomain inhibitors, which disrupt enhancer function, slow tumor growth in ACC primagraft models in vivo, but are ineffective against high grade tumors that harbor activating mutations in the Notch pathway. Thus, our study identifies super-enhancer translocations as a unifying feature of ACC, and provides insight into the mechanism by which sustained MYB overexpression drives alternate cell fates in this disease.Processed ChIP-seq data is available on GEO under accession number GSE76465.

  Study EGAS00001001457

• Whole genome study of Hurthle cell thyroid carcinoma

  Oncocytic thyroid carcinoma, also known as Hürthle cell thyroid carcinoma, accounts for only a small percentage of all thyroid cancers. However, this malignancy often presents at an advanced stage and poses unique challenges to patients and clinicians. Surgical resection of the tumor accompanied in some cases by radioactive iodine treatment, radiation and chemotherapy are the established modes of therapy. Knowledge of the perturbed oncogenic pathways can provide better understanding of the mechanism of disease and thus opportunities for more effective clinical management. Initially, two oncocytic thyroid carcinomas and their matched normal tissues were profiled using whole genome sequencing. Subsequently, 72 oncocytic thyroid carcinomas, one cell line and 5 Hürthle cell adenomas were examined by targeted sequencing for the presence of mutations in multiple endocrine neoplasia I (MEN1) gene. We report the identification of MEN1 loss-of-function mutations in approximately 7% of patients diagnosed with oncocytic thyroid carcinoma. Whole genome sequence data also revealed large regions of copy number variation encompassing nearly the entire genomes of these tumours. Menin, a ubiquitously expressed nuclear protein, is a well-characterized tumor suppressor whose loss is the cause of multiple endocrine neoplasia type 1 syndrome. Menin is involved in several major cellular pathways such as regulation of transcription, control of cell cycle, apoptosis and DNA damage repair pathways. Mutations of this gene in a subset of Hürthle cell tumors point to a potential role for this protein and its associated pathways in thyroid tumorigenesis.

  Study EGAS00001000940

• Whole Tumor spatial heterogeneity in metastatic melanoma

  Heterogeneous inter-tumoral responses, sustained periods of apparent clinical benefit despite lack of objective response to various therapies, and even spontaneous remission are well known within a subpopulation of advanced melanoma patients. The molecular and cellular dynamics facilitating long-term survival remain poorly defined, particularly in the current era ofexposure to multiple potentially active therapies. We studied an exceptional case of long-term survival in a patient with non-responding metastatic melanoma in order to characterize the clonal and microenvironmental factors.We performed immunogenomic analysis of 3 metachronous tumors, and of 67 intratumor sub-regions of one metastatic lesion, usingwhole exome sequencing, RNA-sequencing, immunohistochemistry, and T cell receptor sequencing. Longitudinal analysesidentified mutations in severalknownresistance genes affecting distinctmetastases. Intra-tumoral immune signatures revealed spatially-distinct pockets of immune activation and suppression throughout the metastasis. A specific T cell VBeta CDR3 rearrangement was identified as both dominant and recurrent not only across multiple spatial points within a single tumor mass, but also across metachronous tumors spanning the patient’s disease course. Immunophenotyping of this T cell population with single-cell sequencingsuggestedrepeatedT-cell priming events leading to the persistence of both activated and exhausted T cells bearing this same TCR-Beta at any given time.Our findings highlight genomic and immune heterogeneityin metastatic disease, extending to the intra-tumoral leveland provide a rationale for integrative spatiotemporal analysis of metastatic lesions in the context of immune checkpoint blockade.

  Study EGAS00001003292

• Atypical 3q26/MECOM rearrangements genocopy inv(3)/t(3;3) in acute myeloid leukemia

  Acute myeloid leukemia (AML) with inv(3)/t(3;3)(q21q26) is a distinct WHO recognized entity, characterized by its aggressive course and poor prognosis. In this subtype of AML, the translocation of a GATA2 enhancer (3q21) to MECOM (3q26) results in overexpression of the MECOM isoform EVI1 and monoallelic expression of GATA2 from the unaffected allele. The full-length MECOM transcript, MDS1-EVI1, is not expressed as the result of the 3q26 rearrangement. Besides the classical inv(3)/t(3;3), a number of other 3q26/MECOM rearrangements with poor treatment response have been reported in AML. Here we demonstrate, in a group of 33 AML patients with atypical 3q26 rearrangements, MECOM involvement with EVI1 overexpression, but no or low MDS1-EVI1 levels. Moreover, the 3q26 translocations in these AML patients often involve super-enhancers of genes active in myeloid development (e.g. CD164, PROM1, CDK6 or MYC). In more than 50% of these cases allele specific GATA2 expression was observed, either by copy number loss or by an unexplained allelic imbalance. Altogether, atypical 3q26 recapitulate the main leukemic mechanism of inv(3)/t(3;3) AML, namely EVI1 overexpression driven by enhancer hijacking, absent MDS1-EVI1 expression and potential GATA2 involvement. Therefore, we conclude that both atypical 3q26/MECOM and inv(3)/t(3;3) can be classified as a single entity of 3q26-rearranged AMLs. Routine analyses determining MECOM rearrangements, EVI1 and MDS1-EVI1 expression are required to recognize 3q-rearranged AML cases.

  Study EGAS00001004325

• Partner-independent fusion gene detection by multiplexed CRISPR/Cas9 enrichment and long-read Nanopore sequencing

  Fusion genes are hallmarks of various cancer types and important determinants for diagnosis, prognosis and treatment possibilities. The promiscuity of fusion genes with respect to partner choice and exact breakpoint-positions restricts their detection in the diagnostic setting, even for known and recurrent fusion gene configurations. To accurately identify these gene fusions in an unbiased manner, we developed FUDGE: a FUsion gene Detection assay from Gene Enrichment. FUDGE couples target-selected and strand-specific CRISPR/Cas9 activity for enrichment and detection of fusion gene drivers (e.g. BRAF, EWSR1, KMT2A/MLL) - without prior knowledge of fusion partner or breakpoint-location - to long-read Nanopore sequencing. FUDGE encompasses a dedicated bioinformatics approach (NanoFG) to detect fusion genes from Nanopore sequencing data. Our strategy is flexible with respect to target choice and enables multiplexed enrichment for simultaneous analysis of several genes in multiple samples in a single sequencing run. We observe on average a 508-fold on-target enrichment and identify fusion breakpoints at nucleotide resolution - all within two days. We demonstrate that FUDGE effectively identifies fusion genes in cancer cell lines, tumor samples and on whole genome amplified DNA irrespective of partner gene or breakpoint-position in 100% of cases. Furthermore, we show that FUDGE is superior to routine diagnostic methods for fusion gene detection. In summary, we have developed a rapid and versatile fusion gene detection assay, providing an unparalleled opportunity for pan-cancer detection of fusion genes in routine diagnostics.

  Study EGAS00001003964

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models: validation cohort

  While cell-free DNA (cfDNA) in liquid biopsies is widely being used and investigated, free circulating RNA (extracellular RNA, exRNA) has the potential to improve therapy response monitoring and cancer detection due to its dynamic nature. A fundamental open question hampering the initiation of large-scale liquid biopsy collections for tumour exRNA analysis is that it remains unclear in which blood subcompartment tumour-derived exRNAs primarily reside. We set out to develop a host-xenograft deconvolution framework, exRNAxeno, with cDNA mapping strategies to either a combined human-mouse reference genome or both species genomes in parallel, that can be applied to exRNA sequencing data from liquid biopsies of human xenograft mouse models, enabling to distinguish (human) tumoural RNA from (murine) host RNA, and as such to specifically analyse tumour-derived exRNA. Subsequently, the preferred exRNAxeno combination pipeline was applied to total exRNA sequencing data from blood platelets and three plasma fractions from a breast cancer patient-derived and neuroblastoma cell line-derived xenograft mouse model. We show that tumoural exRNA concentrations are not determined by plasma platelet levels, while host exRNA concentrations increase with platelet content. Furthermore, a large variability in exRNA levels and gene content across individual mice is observed. In general, the tumoural gene detectability in plasma is correlated with the RNA expression levels in the tumour tissue or cancer cell line. Our results unravel new aspects of tumour-derived exRNA biology in xenograft mouse models.

  Study EGAS00001006582

• Differentially methylated CpGs in response to growth hormone administration in children with idiopathic short stature

  Background: Recombinant human growth hormone (rhGH) has shown a great growth-promoting potential in children with idiopathic short stature (ISS). However, the response to rhGH differs across individuals, largely due to genetic and epigenetic heterogeneity. Since epigenetic marks on the methylome can be dynamically influenced by GH, we performed a comprehensive pharmaco-epigenomics analysis of DNA methylation changes associated with long-term rhGH administration in children with ISS. Results: We measured DNA methylation profiles before and after GH treatment (with a duration of ~18 months in average) on 47 healthy children using customized methylC-seq capture sequencing. Their changes were compared and associated with changes in plasma IGF1 by adjusting sex, age, treatment duration, and estimated blood proportions. We observed a considerable inter-individual heterogeneity of DNA methylation changes responding to GH treatment. We identified 267 response-associated differentially methylated cytosines (DMC) that were enriched in promoter regions, CpG islands and blood cell-type specific regulatory elements. Furthermore, the genes associated with these DMCs were enriched in the biology process of "cell development", "neuron differentiation" and "developmental growth", and in the TGF-beta signaling pathway, PPAR Alpha pathway, endoderm differentiation pathway, adipocytokine signaling pathway as well as PI3K-Akt signaling pathway, and cAMP signaling pathway. Conclusion: Our study provides a first insight in DNA methylation changes associated with rhGH administration, which may help understand mechanisms of epigenetic regulation on GH-responsive genes.

  Study EGAS00001006115

• Non-muscle Invasive Bladder Cancer Molecular Subtypes Predict Differential Response to Intravesical Bacillus Calmette-Guérin

  The recommended treatment for patients with high-risk non-muscle invasive bladder cancer (HR-NMIBC) is tumor resection followed by adjuvant Bacillus Calmette-Guérin (BCG) bladder instillations. However, only 50% of patients benefit from this therapy. In case of progression to advanced disease, patients must undergo a radical cystectomy with significant morbidity and have a poor clinical outcome. Identifying tumors least likely to respond to BCG can translate into alternative treatments, such as early radical cystectomy or novel targeted or immunotherapies. Here we present molecular profiling of 132 BCG-naive, HR-NMIBC patients, and 44 post-BCG recurrences (34 matched), which uncovered three distinct BCG Response Subtypes (BRS1-3). Patients with BRS3 tumors have reduced recurrence and progression-free survival compared to BRS1-2. BRS3 tumors expressed high EMT-basal markers and had an immunosuppresive profile, which was confirmed with spatial proteomics. Tumors which recurred post-BCG were enriched for BRS3. BRS stratification was validated in a second cohort of 151 BCG-naive HR-NMIBC patients and the molecular subtypes outperformed guideline recommended risk stratification based on clinicopathological variables. For clinical application, we validated that a commercially approved assay was able to accurately predict BRS3 tumors (AUROC 0.86). Our findings provide a potential clinical tool for improved identification of HR-NMIBC patients at the highest risk of progression, which can be used to select patients for early radical cystectomy or novel subtype-directed therapies.

  Study EGAS00001006879

• Action to Control Cardiovascular Risk in Diabetes (ACCORD-BioLINCC)

  Related StudiesWhole genome and whole exome data is available on a subset of participants with phs001411. ECG signal data is available with phs003562.ObjectivesThe purpose of this study was to determine if intensive glycemic control, multiple lipid management and intensive blood pressure control could prevent major cardiovascular events (myocardial infarction, stroke or cardiovascular death) in adults with type 2 diabetes mellitus. Secondary hypotheses included treatment differences in other cardiovascular outcomes, total mortality, microvascular outcomes, health-related quality of life and cost-effectiveness. BackgroundGlycemia Trial:Patients with type 2 diabetes mellitus die of cardiovascular disease (CVD) at rates two to four times higher than non-diabetic populations of similar demographic characteristics. They also experience increased rates of nonfatal myocardial infarction and stroke. With the growing prevalence of obesity in the United States, CVD associated with type 2 diabetes is expected to become an even greater public health challenge in the coming decades than it is now. Expected increases in event rates will be associated with a concomitant rise in suffering and resource utilization.The ACCORD study investigated whether intensive therapy to target normal glycated hemoglobin (HbA1c) levels would reduce cardiovascular events in patients with type 2 diabetes who had either established cardiovascular disease or additional cardiovascular risk factors when compared to standard therapy (HbA1c between 7.0% and 7.9%). A separate analysis investigated whether reduction of blood glucose concentration decreases the rate of microvascular complications in these patients. Lipid Therapy Trial: Patients with type 2 diabetes mellitus have an increased incidence of atherosclerotic cardiovascular disease attributable, in part, to associated risk factors such as dyslipidemia. This is characterized by elevated plasma triglyceride levels, low levels of high-density lipoprotein (HDL) cholesterol and small, dense low-density lipoprotein (LDL) particles. The ACCORD Lipid Therapy trial was designed to test the effect of a therapeutic strategy that uses a fibrate to raise HDL-C and lower triglyceride levels and uses a statin for treatment of LDL-C reduce the rate of CVD events compared to a strategy that only uses a statin for treatment of LDL-C on cardiovascular outcomes in patients with type 2 diabetes that were at high risk for cardiovascular disease. Blood Pressure Trial: Diabetes mellitus increases the risk of cardiovascular disease at every level of systolic blood pressure. Because cardiovascular risk in patients with diabetes is graded and continuous across the entire range of levels of systolic blood pressure, even at prehypertensive levels, the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC 7) recommended beginning drug treatment in patients with diabetes who have systolic blood pressures of 130 mm Hg or higher, with a treatment goal of reducing systolic blood pressure to below 130 mm Hg. There is, however, a paucity of evidence from randomized clinical trials to support these recommendations. The ACCORD Blood Pressure trial tested the effect of a target systolic blood pressure below 120 mm Hg on major cardiovascular events among high-risk persons with type 2 diabetes compared to a strategy that targeted a SBP of EYE Substudy: Diabetic retinopathy, an important microvascular complication of diabetes, is a leading cause of blindness in the United States. Randomized, controlled clinical trials in cohorts of patients with type 1 diabetes and those with type 2 diabetes have shown the beneficial effects of intensive glycemic control and intensive treatment of elevated blood pressure on the progression of diabetic retinopathy. Elevated serum cholesterol and triglyceride levels have been implicated, in observational studies and small trials, as additional risk factors for the development of diabetic retinopathy and visual loss. The ACCORD EYE Substudy evaluated the effects of the ACCORD medical strategies on the progression of diabetic retinopathy in a subgroup of trial patients. MIND Substudy: Studies suggest that older persons with type 2 diabetes have at least twice the likelihood of developing late-life cognitive impairment or dementia compared to those without. The mechanisms underlying these cognitive disorders are increasingly thought to reflect a mixed pathology pattern with contributions from vascular, neurodegenerative and neurovascular processes. Pathophysiological mechanisms that have been described include inflammation, oxidative stress, energy imbalance, protein misfolding, glucocorticoid-mediated effects and differences in genetic susceptibilities. The ACCORD MIND substudy took as a premise that early intervention with the ACCORD therapeutic strategies to improve glycemic control could mitigate the adverse effects of type 2 diabetes on the brain. Participants10,251 participants with type 2 diabetes and HbA1c concentrations of 7.5% or more participated in the trial. Of these patients, 5518 were assigned to the lipid therapy arm and 4733 to the blood pressure arm. EYE Substudy: A subgroup of 2856 participants was evaluated for the effects of the ACCORD interventions at 4 years on the progression of diabetic retinopathy. Participants who, at baseline, had a history of proliferative diabetic retinopathy that had been treated with laser photocoagulation or vitrectomy were excluded. MIND Substudy: A subgroup of 2977 participants was evaluated for cognitive function and brain volume. The ACCORD MIND substudy excluded participants aged Design Participants were randomly assigned to undergo either intensive glycemic control (targeting a glycated hemoglobin level EYE Substudy: EYE Substudy participants were evaluated at two standardized and comprehensive eye examinations for the effects of the ACCORD interventions at 4 years on the progression of diabetic retinopathy by 3 or more steps on the Early Treatment Diabetic Retinopathy Study Severity Scale (as assessed from seven-field stereoscopic fundus photographs, with 17 possible steps and a higher number of steps indicating greater severity) or the development of diabetic retinopathy necessitating laser photocoagulation or vitrectomy. MIND Substudy: The cognitive primary outcome, the Digit Symbol Substitution Test (DSST) score, was assessed at baseline, 20 and 40 months. Total brain volume (TBV), the primary brain structure outcome, was assessed with MRI at baseline and 40 months in a sub-set of 632 patients. All patients with follow-up data were included in the primary analyses. Conclusions Glycemia Trial: As compared with standard therapy, the use of intensive therapy to target normal glycated hemoglobin levels for 3.5 years increased mortality and did not significantly reduce major cardiovascular events. (Action to Control Cardiovascular Risk in Diabetes Study Group, et al.,2008, PMID:18539917). Microvascular Outcomes of the Glycemia Trial: Intensive therapy did not reduce the risk of advanced measures of microvascular outcomes, but delayed the onset of albuminuria and some measures of eye complications and neuropathy. Microvascular benefits of intensive therapy should be weighed against the risk of increased total and cardiovascular disease-related mortality, increased weight gain, and higher risk for severe hypoglycemia. (Ismail-Beigi et al., 2010, PMID: 20594588) Lipid Therapy Trial: The combination of fenofibrate and simvastatin did not reduce the rate of fatal cardiovascular events, nonfatal myocardial infarction or nonfatal stroke, as compared with simvastatin alone. These results do not support the routine use of combination therapy with fenofibrate and simvastatin to reduce cardiovascular risk in the majority of high-risk patients with type 2 diabetes (ACCORD Study Group, et al., 2010, PMID: 20228404). Blood Pressure Trial: In patients with type 2 diabetes at high risk for cardiovascular events, targeting a systolic blood pressure of less than 120 mm Hg, as compared with less than 140 mm Hg, did not reduce the rate of a composite outcome of fatal and nonfatal major cardiovascular events (ACCORD Study Group, et al., 2010, PMID: 20228401). EYE Substudy: Intensive glycemic control and intensive combination treatment of dyslipidemia, but not intensive blood-pressure control, reduced the rate of progression of diabetic retinopathy (ACCORD Study Group, et al., 2010, PMID: 20587587). MIND Substudy: Although significant differences in TBV favored the intensive therapy, cognitive outcomes were not different. Combined with the unfavorable effects on other ACCORD outcomes, MIND findings do not support using intensive therapy to reduce the adverse effects of diabetes on the brain in patients similar to MIND patients (Launer et al., 2011, PMID: 21958949).

  Study phs003551

• Projects

  Projects Jointly managed by the European Bioinformatics Institute (EMBL-EBI) in Cambridge (UK) and the Centre for Genomic Regulation (CRG) in Barcelona, the EGA provides an invaluable service to the worldwide biomedical research community. The teams leading the EGA are involved in several international partnerships and consortia in numerous scientific fields, where they contribute to ambitious projects. In addition to the project listed below, the EGA is in a long-standing partnership with the Global Alliance for Genomics and Health (GA4GH), as described on the dedicated page. On-going projects Project Duration Domain Funder Tags CANDLE | CANDLE project aims to conceptualise and advance the development of National Cancer Data Nodes (NCDNs) in European countries. These NCDNs will boost the reuse of cancer data for research, innovation and policy making, in order to improve diagnostics and treatment for cancer patients, as well as prevention and early detection. 2025-2028 Cancer Horizon Europe DOCUMENTATION EASIGEN-DS | The EASIGEN-DS project aims to conduct a design study to establish a new European Research Infrastructure on Advanced Genomics Technologies, EASIGEN. To develop an excellent scientific, technological and operational design, we will conduct landscape studies, stakeholder consultations, and community surveying. 2025-2028 Genomic and health data Horizon Europe DATA MANAGEMENT DOCUMENTATION INFRASTRUCTURE Go-IMPaCT | Go-IMPaCT will contribute sequenced genomes and provide infrastructure as part of IMPaCT-Cohort, one of the three fundamental pillars of the Precision Medicine Infrastructure associated with Science and Technology (IMPaCT) program in Spain. Along with the Genome of Europe (GoE) project, around 18.000 people will have their genomes sequenced, also contributing to Spain's commitments in 1+MG. Go-IMPaCT will fund the development of an EGA node to manage and share this genomic and phenoclinic data, laying the foundations for regional and ethnic genomic variability in Spain to be available for research purposes. The IMPaCT cohort is created with the spirit of being an open research tool, compatible with the rest of the health research ecosystem, and other international initiatives. 2025-2027 Large-scale genomics and health data; personalised medicine Instituto de Salud Carlos III ACCESS DISCOVERY INFRASTRUCTURE METADATA STANDARDS FAIR-FEGA | This project seeks to accelerate data depositions into FEGA, significantly increasing the data flow in and from FEGA nodes. It will build capacity within the FEGA nodes and increase awareness in a wide range of stakeholders, thus altogether achieving the ultimate goal of enhancing data reuse. The project will be carried out by a strategic consortium comprising seven ELIXIR nodes and two ELIXIR communities. 2025-2026 Not applicable ELIXIR ACCESS DISCOVERY DOCUMENTATION INFRASTRUCTURE METADATA STANDARDS FEGA-Connect | A consortium of six ELIXIR nodes plus the Polish FEGA node (in-kind contribution) joining forces to build a solid base to develop solutions for effective multi-omic sensitive data integration between FEGA nodes and other infrastructures and specialised Data repositories. We aim to promote a more coherent data deposition, discoverability and retrieval of multi-omics datasets, providing FAIRer data and consequently accelerating research. 2025-2026 Multi-omics data ELIXIR ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE METADATA STANDARDS IMPaCT-Data 2 | IMPaCT-Data 2 will develop a digital platform for the integration and modelling of biomedical data associated with IMPaCT (Precision Medicine Infrastructure associated with Science and Technology) projects in Spain. It will deploy a sustainable infrastructure that facilitates the integration, standardisation, interoperability and analysis of clinical, genomic, molecular and medical imaging data. This platform will be aligned with European projects such as Genome of Europe (GoE), the first project to make use of the European Genomic Data Infrastructure (GDI), and EUCAIM. IMPaCT-Data 2 will benefit from advanced Artificial Intelligence and High Computing Capacity Systems capabilities, offering robust and accessible tools for researchers from the National Health System in Spain. 2025-2026 Large-scale genomics and health data; personalised medicine Instituto de Salud Carlos III ACCESS DISCOVERY INFRASTRUCTURE METADATA STANDARDS SenSec | This project aims to establish a mechanism for orchestrating secure access to sensitive data hosted by the EGA, whether in Central EGA or any Federated Node, from Galaxy, a popular open-source, community-driven VRE (Virtual Research Environment) for bioinformatics analysis. Building on a previous prototype that enabled Galaxy users within Trusted Research Environments (TREs) to decrypt sensitive data for workflow execution without sharing private encryption keys, SenSec will expand this prototype into a comprehensive solution for secure data analysis in Galaxy, facilitating encrypted data access and transfer from FEGA/EGA repositories to designated TREs. 2025-2026 Genomic and health data; trusted research environment ELIXIR ACCESS DATA ANALYSIS ERDERA | The European Rare Disease Research Alliance (ERDERA) takes over EJPRD to deliver concrete health benefits to rare disease patients in the next decade by advancing prevention, diagnosis and treatment research. To leave no one behind, over 170 organisations championed by the European Union and member states are working hand in hand to make Europe a world leader in rare diseases research and innovation. 2024-2034 Rare diseases Horizon Europe; "La Caixa" Foundation cofunds CRG's contribution ACCESS DATA ANALYSIS DISCOVERY INFRASTRUCTURE SYNTHIA | The aim of SYNTHIA is to deliver validated, reliable tools and methods for synthetic data generation (SDG). The tools will cover multiple data types including lab results, clinical notes, genomics, imaging and m-health data. SYNTHIA also hopes to make possible the generation of longitudinal data. 2024-2029 Genomic and health data; multi-omics; AI solutions Innovative Health Initiative (IHI) DATA ANALYSIS DATA MANAGEMENT INFRASTRUCTURE GoE | The Genome of Europe initiative aims to build a European network of national genomic reference cohorts of at least 500.000 citizens. These reference cohorts will be selected to be representative of the European population. 2024-2028 Large-scale genomic and health data Horizon Europe ACCESS DISCOVERY INFRASTRUCTURE METADATA STANDARDS HEREDITARY | HEREDITARY aims to transform the way we approach disease detection, prepare treatment response, and explore medical knowledge by building a robust, interoperable, trustworthy, and secure framework that integrates multimodal health data (including genetic data) while ensuring compliance with cross-national privacy-preserving policies. 2024-2027 Neurodegenerative disorders, gut-brain interplay Horizon Europe DATA MANAGEMENT DATA ANALYSIS EOSC-ENTRUST | The mission of EOSC-ENTRUST is to create a European network of trusted research environments for sensitive data and to drive European interoperability by joint development of a common blueprint for federated data access and analysis. 2024-2026 Trusted Research Environment Horizon Europe INFRASTRUCTURE EBV-MS | "Targeting Epstein-Barr Virus Infection for Treatment and Prevention of Multiple Sclerosis". The ambitious goals of the project are to answer the questions why only a few EBV infected persons develop MS, and define the underlying mechanism of this process, as well as clarify if targeting the EBV infection can prevent MS or improve the disease course. 2023-2028 Viral-host genetics; immune response; disease modelling; disease prevention; AI/ML solutions Horizon Europe DATA MANAGEMENT DATA ANALYSIS WISDOM | WELL-BEING IMPROVEMENT THROUGH THE INTEGRATION OF HEALTHCARE AND RESEARCH DATA AND MODELS WITHOUT BORDER FOR CHRONIC IMMUNE-MEDIATED DISEASES aims to deploy novel approaches for data processing, harmonisation, management, and secure data sharing and federated access for diseases like multiple sclerosis. Using an end-user guided approach, it will facilitate responsible and critical assessment of the use of AI in healthcare. 2023-2028 Chronic immune-mediated diseases Horizon Europe DATA MANAGEMENT INFRASTRUCTURE EUCAIM | EUropean Federation for CAncer IMages is a project that will build a highly secure, federated and large-scale European cancer imaging platform, with capabilities that will greatly enhance the potential of Artificial Intelligence in oncology. 2023-2027 Cancer Digital Europe Programme (DIGITAL) DISCOVERY CONTAGIO | CONTAGIO (COhorts Network To be Activated Globally In Outbreaks) aims to create coordination mechanisms to rapidly react to infectious disease (re-)emergence in low- and middle-income countries (LMICs). 2023-2026 Infectious Diseases European Commission - Horizon Europe ACCESS DATA MANAGEMENT DISCOVERY Youth-GEMs | Youth-GEMS (Gene Environment Interactions in Mental Health TrajectorieS of Youth) will conduct research into the genetic and environmental factors of mental health in young European people. 2022-2027 Mental health European Commission - Horizon Europe DATA MANAGEMENT DISCOVERY GDI | The European Genomics Data Infrastructure project is enabling access to genomic and related phenotypic and clinical data across Europe. It is doing this by establishing a federated, sustainable and secure infrastructure to access the data. 2022-2026 Genomic and health data European Commission - Horizon Europe; "La Caixa" Foundation cofunds CRG's contribution DISCOVERY DOCUMENTATION INFRASTRUCTURE IMPaCT-T2D | The IMPaCT-T2D project aims at studying the complete genomes of a large cohort of patients with Type 2 Diabetes mellitus (T2D), using modern sequencing technologies and artificial intelligence (AI) in order to improve the stratification and pharmacological treatment in the context of precision medicine. 2022-2025 Cardiovascular and Complex Diseases Spanish Ministry of Science and Innovation; Instituto de Salud Carlos III ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE Completed projects Project Duration Domain Funder Tags EOSC4Cancer | EOSC4Cancer builds on existing projects, research outcomes and established community solutions to create the federated FAIR data, analysis and services infrastructure needed for European Cancer research programmes. 2022-2025 Cancer European Commission - Horizon Europe DISCOVERY EuCanImage | A European Cancer Image Platform Linked to Biological and Health Data for Next-Generation Artificial Intelligence and Precision Medicine in Oncology. 2020-2025 AI Solutions in Oncology European Commission - H2020 Programme; "La Caixa" Foundation cofunds CRG's contribution DATA MANAGEMENT METADATA STANDARDS GenoMed4ALL | A consortium built to empower personalised medicine in the field of haematological diseases through the use of AI and the pooling of genomic and clinical data. 2020-2025 Hematological diseases European Commission - H2020 Programme DISCOVERY METADATA STANDARDS BY-COVID | The BeYond-COVID project aims to make COVID-19 data accessible to scientists in laboratories but also to anyone who can use it, such as medical staff in hospitals or government officials. Going beyond SARS-CoV-2 data, the project will provide a framework for making data from other infectious diseases open and accessible to everyone. 2021-2024 Infectious diseases European Commission - H2020 Programme ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE IMPaCT-Data | IMPaCT-Data aims to create the infrastructure for secondary use of data from Spanish healthcare systems - electronic health records, medical imaging and genomic repositories - and contribute with the knowledge and methodology produced to the healthcare system. 2021-2024 Large-scale genomics and health dataSpanish Ministry of Science and Innovation; Instituto de Salud Carlos III ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE LaMarato | It is a project aimed at creating and developing a catalan interhospitalary network to interrogate genetic variants from thousands of genetic tests carried out in patients with rare diseases from the main catalan hospitals. 2021-2024 Genomic and health data Fundacio La Marato de TV3 (catalan foundation) DISCOVERY HealthyCloud | This consortium will contribute a Strategic Agenda towards the European Health Research and Innovation Cloud. The project will work in collaboration with a broad range of stakeholders to ensure that all voices are included and that the results are technically and ethically sound. 2021-2023 Not Applicable European Commission - H2020 Programme DOCUMENTATION B1MG | Beyond 1 Million Genomes aims to create a network of genetic and clinical data across Europe. The project provides coordination and support to the 1+ Million Genomes Initiative (1+MG). This initiative is a commitment of 24 EU countries, the UK and Norway to give cross-border access to one million sequenced genomes by 2022. 2020-2023 Not applicable European Commission - Horizon Europe DATA MANAGEMENT INFRASTRUCTURE METADATA STANDARDS ELIXIR-CONVERGE | An alliance with the goal of Connecting and aligning ELIXIR Nodes to deliver sustainable FAIR life-science data management services. 2020-2023 Data Management and Infectious Diseases European Commission - H2020 Programme DATA MANAGEMENT INFRASTRUCTURE METADATA STANDARDS IHCC | The International HundredK+ Cohorts Consortium aims to create a global platform for translational research ? informing the biological and genetic basis for disease and improving clinical care and population health. 2020-2022 Translational research NIH; The Wellcome Trust; CZI INFRASTRUCTURE METADATA STANDARDS PPCG | The Pan Prostate Cancer Group aims to harmonise and interrogate Whole Genome DNA Sequence data generated around the world from over 2000 men with prostate cancer, with associated transcriptome and methylome data to include men from different clinical categories, and ethnicities. This project is about providing breakthrough advances through analysis of a very large series of Whole Genome DNA data from prostate cancer contributed by many of the leading scientists and clinicians working in prostate cancer genomics. 2019-2024 Cancer Cancer Research UK DATA MANAGEMENT CINECA | Consortium providing a Federated solution enabling population-scale genomic and biomolecular data accessible across international borders accelerating research and improving the health of individuals resident across continents. 2019-2023 Large-scale Genomics and Health Data European Commission - H2020 Programme ACCESS DATA MANAGEMENT DISCOVERY INFRASTRUCTURE EASI-Genomics | A project designed to provide easy access to cutting-edge DNA sequencing technologies to researchers from academia and industry, within a framework that ensures compliance with ethical and legal requirements, as well as FAIR and secure data management. 2019-2023 Next Generation Sequencing European Commission - H2020 Programme ACCESS EJP-RD | An European consortium built to create a comprehensive, sustainable ecosystem allowing a virtuous circle between research, care, and medical innovation. 2019-2023 Rare diseases European Commission - H2020 Programme ACCESS DATA MANAGEMENT DOCUMENTATION METADATA STANDARDS EOSC-Life | EOSC-Life brings together the 13 Life Science research infrastructures (LS RIs) to create an open, digital and collaborative space for biological and medical research. The project will publish 'FAIR' data and a catalogue of services provided by participating RIs for the management, storage and reuse of data in the European Open Science Cloud (EOSC). 2019-2023 Not applicable European Commission - H2020 Programme DOCUMENTATION EUCANCan | A federated network aiming at implementing a cultural, technological and legal integrated framework across Europe and Canada, to enable and facilitate the efficient sharing of cancer genomic data. 2019-2023 Cancer European Commission - H2020 Programme DATA MANAGEMENT METADATA STANDARDS The Federated EGA framework: supporting sensitive data management across the ELIXIR Nodes | This project is a direct continuation of the FHD IS with the goal to position the FEGA framework as the core infrastructure driver to support human data sharing for research. 2019-2023 Human genomic data ELIXIR INFRASTRUCTURE UK Biobank | UK Biobank is a large-scale biomedical database and research resource, containing in-depth genetic and health information from half a million UK participants. This project is to archive whole genome sequencing and other genetic data for UK Biobank participants. 2019-2023 Large-scale Genomics and Health Data The Wellcome Trust; UKRI; Amgen; AstraZeneca; GSK; Johnson & Johnson DATA MANAGEMENT INFRASTRUCTURE VEIS | The core mission of VEIS is to create an open ecosystem of technologies that will address and adapt to the requirements of the systems used to analyse and interpret -omics and clinical data in research and application environments in biomedicine. The aim of the project is to leverage the value of the EGA for both industry and society. 2019-2022 Oncology and Rare diseases Generalitat de Catalunya and European Regional Development Fund (ERDF) ACCESS DISCOVERY ELIXIR BEACON IS | This study follows on from a number of earlier activities that have established the ELIXIR Beacon Project. The main aim is to extend the Beacon protocol, developed at EGA, to become the reference ELIXIR Data Discovery product 2019-2021 Not applicable ELIXIR DISCOVERY ELIXIR FHD IS | This project coordinates the delivery of FAIR compliant metadata standards, interfaces, and reference implementation to support the federated ELIXIR network of human data resources. 2019-2021 Human genomic data ELIXIR INFRASTRUCTURE ELIXIR Rare Disease | The Rare Disease Community extends and generalises the system of access authorisation and high volume secure data transfer developed within the EGA. The goal of the Community is to create a federated infrastructure that will enable researchers to discover, access and analyse different rare disease repositories across Europe. It is doing this in partnership with other European infrastructure projects, namely RD-CONNECT, BBMRI-ERIC and E-Rare.2019-2021 Rare diseases ELIXIR INFRASTRUCTURE Solve-RD | Solve-RD - solving the unsolved rare diseases - is a research project funded by the European Commission. It echoes the ambitious goals set out by the International Rare Diseases Research Consortium (IRDiRC) to deliver diagnostic tests for most rare diseases by 2020. The current diagnostic and subsequent therapeutic management of rare diseases is still highly unsatisfactory for a large proportion of rare disease patients - the unsolved RD cases. For these unsolved rare diseases, we are unable to explain the etiology responsible for the disease phenotype, predict the individual disease risk and/or rate of disease progression, and/or quantitate the risk of relatives to develop the same disorder. 2018-2024 Rare diseases European Commission - H2020 Programme ACCESS DATA MANAGEMENT METADATA STANDARDS EuCanShare | An EU-Canada joint infrastructure for next-generation multi-Study Heart research. 2018-2022 Cardiovascular Diseases European Commission - H2020 Programme ACCESS METADATA STANDARDS

  Documentation about/projects-and-funders/projects

• Genetic Analysis of Normal Human Facial Variation

  The purpose of this project is to identify genes associated with normal human quantitative facial variation. The motivation for this project stems from the fact that very little is known about how variation in specific genes relates to the diversity of facial forms commonly observed in humans. Viable candidates for these morphogenes originate from a number of sources: tissue expression studies, animal models with targeted or spontaneous mutations, and genetic syndromes with craniofacial manifestations. Importantly, understanding the genetic basis for normal facial variation also has important implications for health-related research. For example, this work has the potential to shed light on the factors influencing liability to common craniofacial anomalies such as orofacial clefts. There is now ample evidence that certain facial features (e.g., increased midfacial retrusion) characterize individuals genetically at-risk for orofacial clefts (e.g., biological relatives of affected cases). While these predisposing facial features are statistically over-represented in at-risk groups, they are also common in the general population. Since many of the current candidate genes for clefting are thought to play a critical role in facial morphogenesis, variation in these genes may also underlie normal variation in these facial features. These candidate genes, however, probably represent only a small fraction of the total number of loci influencing normal human facial variation. Phenotypes for this project were obtained from over 3000 healthy Caucasian subjects recruited through three separate studies. The majority of the subjects were recruited as part of the 3D Facial Norms Project, which is described in extensive detail here: (https://www.facebase.org/facial_norms/notes). The provided dbGaP phenotypes include a series of anthropometric craniofacial measurements (linear distances) primarily derived from 3D photographic facial surface scans (see previous hyperlink). The specific genotyping requested is described elsewhere in this document. Our analysis team is pursuing a variety of different analytic approaches to derive genetically informative phenotypes, including various shape-based morphometric methods. For those interested in pursuing more advanced phenotypic approaches, the original 3D surface scans and additional phenotypic traits are available to researchers through the FaceBase Consortium. This dataset has the potential to facilitate the discovery of new genetic loci with an important role in both normal and abnormal facial development. It may also serve as a dataset to test hypotheses regarding specific SNP associations (e.g. as a replication dataset) or as part of a larger meta-analysis.

  Study phs000949

• GA4GH

  Standards The EGA is a long-standing supporter of the Global Alliance for Genomics & Health (GA4GH) to enhance responsible sharing of human genetic data through the development of interoperable global standards for human data access. The EGA is one of the founding GA4GH Driver Projects and has contributed to the development and implementation of several GA4GH standards and APIs. Below is a list of the GA4GH standards and APIs that are currently available or planned for implementation at EGA. TechnicalStandards Purpose SpecificationVersion SupportedVersion Implementation Large Scale Genomics htsget A protocol for secure, efficient, and reliable access to sequencing read and variation data. V1.3.0 V1.0.0 Specification Documentation Endpoint Read File Formats (SAM/BAM/CRAM) Specifications for storing next-generation sequencing read data. V3.0.0 V3.0.0 Implementation Example of Usage Variation File Formats (VCF/BCF) The specifications for Variant Call Format Files (VCF) and its binary counterpart BCF. V4.0.0 V2.0.0 V4.0.0 V2.0.0 Implementation Example of Usage Crypt4GH v1.0 Enables direct byte-level compatible random access to encrypted genetic data stored in community standards (e.g. CRAM, VCF) V1.0 V1.0 Specification Documentation Endpoint refget API Enables access to reference sequences using an identifier derived from the sequence itself. V1.2.6 NA Specification RNAget API v1 Provides a means of retrieving data from several types of RNA experiments including (i) feature-level expression data from RNA-seq type measurements and (ii) coordinate-based signal/intensity data similar to a bigwig representation via a client/server model. V1.0.0 NA Documentation Discovery Beacon v2 Supports discovery of genomic variants, phenotypes, and individuals V1.0.1 V0.3 Web UI API Source Code Service Info API v1 The Service Info API is an endpoint for describing GA4GH service metadata, designed for extension and inclusion in other APIs. Service info is used to describe a single service, while Service Registry is used to describe multiple services. V1.0.0 NA Documentation Service Registry API v1 provides information about other GA4GH services, primarily for the purpose of organizing services into networks or groups and service discovery across organizational boundaries. V1.0.0 NA Documentation Data Use Researcher Identities Data Use Ontology (DUO) Allow users to semantically tag genomic datasets with usage restrictions, allowing them to become automatically discoverable based on a health, clinical, or biomedical researcher’s authorisation level or intended use. 2021-02-23 2021-02-23 Specification Documentation Endpoint Authentication & Authorization Infrastructure (AAI) The GA4GH AAI specification leverages OpenID Connect (OIDC) Servers for use in authenticating the identity of researchers desiring to access clinical and genomic resources from data holders adhering to GA4GH standards, and to enable data holders to obtain security-related attributes of those researchers. V1.2.0 V1.2.0 API URI: ega.ebi.ac.uk:8443 Documentation Repository Researcher IDs (passport, visa) Specify the collection of researchers that may access a dataset at any given time, and the credentials they must supply. V1.0.1 V1.0.1 Specification Documentation Endpoint Cloud Tool Registry Service API TRS is a standard API for exchanging tools and workflows to analyze, read, and manipulate genomic data. V2.0.1 NA Documentation Repostiory Data Repository Service API ​DRS API is a standard for building data repositories and adapting access tools to work with those repositories, works with other approved APIs from the GA4GH Cloud Work Stream to allow researchers to discover algorithms across different cloud environments and send them to datasets they wish to analyse. V1.0.3 NA Documentation Repostiory Workflow Execution Service API This API lets users run a single workflow (defined using CWL or WDL) on multiple different platforms, clouds, and environments, and be confident that it will work the same way. The API provides methods to request that a workflow be run, pass parameters to that workflow, get information about running workflows, and cancel a running workflow. V1.0.1 NA Documentation Repostiory Genomic Knowledge Standards Variation Representation v1 Provides a flexible framework of computational models, schemas, and algorithms to precisely and consistently exchange genetic variation data across communities. V1.3.0 EGA team is contributing to including it in in Beacon v2 Specification and Elixir Reference Implementation Documentation Repostiory Clin/ Pheno Data Capture Phenopackets Provides information models with different levels of complexity to enable high level clinical phenotype information as well as deep clinical phenotype information to be exchanged. V2.0.0 Included in Ongoing Submissions EGA team is contributing to including it in in Beacon v2 Specification and Elixir Reference Implementation Documentation Repostiory Driver Project The EGA, jointly coordinated by the EBI and the CRG, was announced, in 2017, to be one of the 15 Driver Projects for GA4GH. Driver Projects are international genomic data initiatives, focussed on real projects and challenges that will guide the development efforts in order to accelerate and enable completely responsible and standarised data sharing by 2022. All chosen Driver Projects make a cross-sectional effort by playing an important role across the different workstreams. Thomas Keane, Jordi Rambla, Mallory Freeberg, and Aina Jené have been named Driver Project Champions for the EGA. All Driver Project Champions will be leading this ambitious initiative for the following years.

  Documentation about/projects-and-funders/ga4gh

• Mid-frequency hearing loss is a characteristic clinical feature of OTOA-associated hearing loss

  In this study, we performed NGS analysis of a large Japanese hearing loss cohort, and identified 7 patients with OTOA-associated hearing loss. As novel clinical features identified in this study, the audiometric configurations of OTOA-associated hearing loss patients was found to be mid-frequency.

  Study JGAS000200

• CEITEC DAC

  A CEITEC Data Access Committee (DAC) is a body of one or more named individuals who are responsible for data release to external requesters. The members of DAC are selected members of research groups and their respective leaders. Multiple datasets may be affiliated to a single DAC. DAC continues communication with requester to understand the purpose of use, i.e. research setting the dataset is envisioned for by requester, to identify if data sharing is possible directly under current conditions for the dataset, or actions such as re-consenting is needed and desirable to accommodate the proposed research setting/data use.

  Dac EGAC50000000049

• Long-read sequencing identifies a common transposition haplotype predisposing for CLCNKB deletions

  Long-read whole genome sequencing, long-read long-range PCR sequencing, targetted long fragment long-read sequencing data of the CLCNKA/CLCNKB locus in 27 Bartter syndrome patients. Multiple different deletion alleles are identified and a new common transposition haplotype predisposing for CLCNKB deletions is described.

  Study EGAS00001007339

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• 120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  Study EGAS00001001733

• Hip OA Functional Genomics RNAseq (2017-06-09)

  From 9 patients undergoing hip joint replacement surgery for osteoarthritis, we collected 3 cartilage samples each: a low-grade sample (no obvious evidence of damage or fibrillation); a high-grade sample (damaged and fibrillated cartilage); an osteophytic sample (overlaid bony protrusions mainly around the margins of the articular surface). Multiplexed libraries were sequenced on Illumina HiSeq 2000 (75bp paired-end read length) and a cram file was produced for each sample. This dataset contains all the data available for this study on 2017-06-09.

  Dataset EGAD00001003354

• microRNA-seq of human serum from a longitudinal study of 66 women with no history of cancer

  This dataset includes microRNA sequencing data from 198 human serum samples, representing a subset of 66 women with no history of cancer who participated in the UKCTOCS study and with serum samples collected at three timepoints over a period of up to 5 years. Small RNA libraries prepared from the serum samples were sequenced with 50-bp single end reads on an Illumina HiSeq 2000 instrument. Data is provided as FASTQ files.

  Dataset EGAD00001004348

• Whole exome sequencing of young onset Primary Sclerosing Cholangitis

  Primary sclerosing chloangitis is a rare autoimmune disease of the liver (prevalence =10/100,000) with a mean age of onset of 40 years. We are currently undertaking GWASand immunochip experiments to identify loci underlying PSC susceptibility. Through ourcollaborators at the University of Calgary we have access to DNA from three parent-offspringtrios where the children required liver transplants due to PSC before the age of 9. These areextremely rare cases indeed and we believe that exome-sequencing represents a powerfulmeans of identifying the causal mutation underlying this severe phenotype.

  Dataset EGAD00001000671

• RNASeq_EGAS00001001306

  RNASeq sequencing. Each library was sequenced using TruSeq SBS Kit v3-HS, in paired-end mode with a read length of 2 × 76 bp. We generated more than 20 million paired-end reads for each sample in a fraction of a sequencing lane on HiSeq2000 (Illumina Inc.) following the manufacturer’s protocol. Image analysis, base calling and quality scoring of the run were processed using the manufacturer’s software Real Time Analysis (RTA 1.13.48) and followed by generation of FASTQ sequence files.

  Dataset EGAD00001001443

• Analysis of tumor periphery and center-specific mutations in renal cell carcinoma

  Renal cell carcinoma (RCC) is a genomically heterogeneous tumor. In the present project, the question whether intratumoral heterogeneity follows a zonal pattern indicating spatial niches was addressed. Whole exome sequencing of 16 paired samples from tumor periphery and center revealed a number of region-specific functional SNVs and Indels. Therefore, RCCs are not composed of evenly admixed tumor cells but show topological differences in their clonal composition.

  Dataset EGAD00001002067

• DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001005757

• Spatial RNA-sequencing of metastatic melanoma

  We performed RNA sequencing of 48 different regions sub-sampled from a metastatic melanoma biopsy that was treated with anti-PD-1 inhibitor. RNAseq was performed on samples with a minimum RNA integrity number (RIN) of 5.5 except for two cases (6A10 and 8A3) with RINs greater than 3. A minimum of 700ng of RNA were required for all samples undergoing RNAseq. Paired-end transcriptome reads were aligned using TopHat2, to the UCSC hg19 reference genome.

  Dataset EGAD00001005820

• CRUK Accelerator: Non-small cell lung cancer whole exome and RNA sequencing

  Whole exome and RNASeq raw sequencing data for a cohort 24 patients with non-small cell lung cancer, 15 adenocarcinoma (8 female, 7 male) and 9 squamous cell carcinoma(5 female, 4 male). Median age at diagnosis was 69. Tumour tissue and PBMCs were used for whole exome sequencing and RNA sequencing. This data was generated as part of a study funded by a Cancer Research UK Centres Network Accelerator Award Grant (A21998).

  Dataset EGAD00001007934

• Oral microbiota composition assessed with 16S rRNA sequencing from adults aged over 65 years old.

  This is a oral microbiota amplicon dataset derived from adult participants aged over 65 years old. It consists a total number of 491 samples, stored in 982 paired-end FASTQ files with sequence lengths of 200 nucleotides generated with a Illumina MiSeq. Of those 491 samples, 347 were used in analysis, the remaining 144 samples are control samples.

  Dataset EGAD00001007705

• Comprehensive RNA repository of tissue and plasma from patients with esophageal cancer or precursor lesions

  A comprehensive RNA repository (both coding and non-coding) from 17 patients diagnosed with esophageal adenocarcinoma, high-grade dysplastic or non-dysplastic Barrett’s esophagus. Per patient, a blood plasma sample, and a healthy esophageal and disease tissue sample were collected. This dataset includes both mRNA and small RNA sequencing data (fastq.gz files) of all tissue and plasma samples. In total,102 RNA-seq libraries from 51 samples (17 plasma and 34 tissue samples) were sequenced (plasma mRNA libraries were sequenced twice).

  Dataset EGAD00001006857

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• Ultra-deep sequencing of cell-free DNA derived from reference materials and a patient with asymmetric overgrowth

  This dataset contains: Ultra-deep sequencing data using the Duplex sequencing technology of: 1.) SeraSeq cfDNA reference materials with spike-in variants with allele frequencies from 0% to 5% 2.) One cfDNA sample from a CRC patient 3.) One cfDNA sample from a patient with asymmetric overgrowth Paired-end sequencing was performed with 2x151 bp reads on the NextSeq 500 system. Data is provided as mapped .bam files (aligned to GRCh38/hg38).

  Dataset EGAD00001009784

• DNA Double Strand Breaks in KMT2A-Rearranged AML patients

  DNA breakage at specific rearrangement-participating genes, which are more sensitive to a range of environmental and chemotherapeutic agents than other regions of the human genome, contributes to the generation of leukemia-causing rearrangements, and can be used as a predictor of susceptibility to cancer caused by gene rearrangements. As a direct proof-of-principle regarding the feasibility of employing fragile site breakage to identify and monitor high-risk populations to allow personalized treatments, genome-wide DNA break mapping/sequencing was used to determine whether preferential DNA breaks are generated at the major breakpoint regions of KMT2A in AML remission patients with previously diagnosed KMT2A rearrangement. We are submitting break mapping data from three patients with KMT2A rearrangements and three non-fusion patients, with and without etoposide treatments.

  Study phs002804

• Genome wide association study for early onset coronary disease and related phenotypes (ADVANCE)

  ADVANCE (Atherosclerotic Disease, VAscular functioN, and genetiC Epidemiology) is a large epidemiological study of genetic and non-genetic determinants of coronary artery disease (CAD) that started in 2000 as a collaborative effort between researchers at Stanford University and Kaiser Permanente of Northern California. The overarching goal of the study is to improve our ability to prevent, diagnose and treat CAD. The initial study included recruitment of over 3600 subjects (including 1873 subjects with incident clinically significant coronary disease and 1745 control subjects) from multiple race/ethnic backgrounds. A subset of ~ 500 subjects with very early onset coronary disease (men < 45 and women < 55) and ~ 500 similar aged controls were genotyped using the Illumina 550K platform as part of an NIH funded effort within the STAMPEED consortium.

  Study phs000423

• Rapid Acceleration of Diagnostics - Digital Health Technologies (RADx-DHT): Large Scale Flu Surveillance Study (LSFS)

  The purpose of this study was to better understand behavioral and physiological functioning in relation to recent self-reported influenza and influenza-like-illness (ILI), including coronavirus disease (COVID-19). Over 65,000 Achievement members responded to a weekly one-click survey asking if they had experienced ILI within the previous 7-day period. If they responded no, they were given the option to complete a survey about their risk factors and behavior. If they responded yes, they were given the option to complete a survey asking about the specifics of the incident. Participants were also asked to sync their wearable activity trackers and health apps in order for researchers to better understand changes in behavioral and physiological outcomes related to self-reported ILI experiences.DOI: https://rapids.ll.mit.edu/10.57895/fkth-d352

  Study phs002539

• Genetic Epidemiology of Chronic Lymphocytic Leukemia

  Chronic lymphocytic leukemia (CLL) is a subtype of B-cell lymphoproliferative disorders (LPD), and is the most common form of adult leukemia in Caucasians in the United States. Small lymphocytic lymphoma (SLL) is also a B-cell LPD and is typically considered to be the same disease as CLL, based on pathology. We consider CLL and SLL as the same disease entity, and hereafter refer to both simply as "CLL". Using genealogical databases and cancer records, the familial clustering for CLL is one of the strongest for all cancer sites, strongly implicating germline genetic risk. We ascertained CLL cases and controls for a genomewide association study (GWAS) that was undertaken as part of the International Lymphoma Epidemiology (InterLymph) consortium GWAS. Some CLL cases are also part of extended high-risk CLLpedigrees.

  Study phs001568

• HNPCC-Sys: Molecular Characterization of Lynch Syndromes

  Lynch Syndrome (LS) tumors are characterized by constitutional mutations in DNA mismatch-repair genes. Colorectal cancers (CRCs) are the predominant tumor type in patients with LS. Here, we have used whole-genome and transcriptome sequencing of LS- CRC to find similarities and differences of mutation and gene expression characteristics between LS-CRC and sporadic CRC (data provided by TCGA via dbGaP). Furthermore, we were interested in the molecular heterogeneity of LS-CRC. We have performed a molecular characterization of LS-tumors and of matched tumor-distant reference colonic mucosa based on whole-genome DNA- and RNA-sequencing analyses. Our data indicates the existence of two subgroups of LS-CRCs, G1 and G2, where G1 tumors show a higher number of somatic mutations, higher microsatellite slippage and a different mutation spectrum.

  Study phs001407

• HuBMAP: Single-Cell Data from Human Tissues

  The small bowel and colon are organs critical for maintaining homeostasis of the human body by mediating nutritional absorption upon the ingestion of food. Though both organs are extensive in length, there are known differences in function and cellular heterogeneity within different portions of each. Also, a cross section anywhere in the bowel reveals a complex layering of components involved in absorption and secretion, motility of gut contents, circulation, and immunity. We are mapping the complexity of the the small bowel and colon with cell-to-cell resolution in histologic sections, both along their lengths and across multiple individuals. Our molecular data consist of single cell ATAC-seq and RNA-seq. These profiles are spatially mapped to histologic sections using CO-Detection by indEXing (CODEX), a highly multiplexed system of antibody-tagged target epitopes.

  Study phs002272

• Evolution of Resistance in ER+ Breast Cancer

  While the combination of endocrine therapy and CDK4/CDK6 inhibitors has been shown to be effective in the metastatic ER+ breast cancer setting, to test whether it is effective in an earlier stage neoadjuvant setting, the FELINE trial (NCT02712723) was established to test the efficacy of letrozole and ribociclib in a ER-positive, HER2-negative patients in a randomized, placebo-controlled, multicenter trial. Patients were randomized to one of three arms: those in Arm A received letrozole and placebo, Arm B letrozole and intermittent ribociclib, and Arm C letrozole and continuous ribociclib. Samples were collected at screening (Day 0), Cycle 1 (Day 14), and end of trial (Day 180). Samples from 24 patients, where cancer cells were present at Day 0 and one additional time point, were subjected to whole-exome sequencing profiling.

  Study phs002287

• Transcriptomic and Clonal Characterization of T Cells in the Human Central Nervous System

  The cerebrospinal fluid (CSF) is thought to be a main route for immune surveillance in the central nervous system (CNS). Understanding the composition and state of CSF in healthy individuals may provide insight into perturbations present during neuroinflammation. Here, we have used single-cell RNA and TCR sequencing to profile CSF and peripheral blood mononuclear cells (PBMCs) from healthy individuals and patients with relapsing-remitting multiple sclerosis (MS), a chronic autoimmmune disease. In addition, with the goal of understanding how transcriptional artefacts are introduced in transcriptomics experiments, we have performed single-cell and TCR sequencing to profile PBMCs from a healthy individual that were processed with the same enzymatic digestion used for tissues (such as the brain) in the presence or absence of transcription inhibitors. 

  Study phs002222

• Hereditary Cancer Predisposition Syndromes and Uveal Melanoma

  Uveal melanoma (UM) is a subtype of melanoma characterized by the strong contribution of genetic rather than environmental factors in the pathogenesis of the disease, making it an ideal model disease to study the genetic basis of cancer. The long-term goal of our laboratory is to determine the genes and mechanisms responsible for hereditary cancer predisposition associated with UM. BAP1 has been identified as a candidate gene with definitive association with predisposition to UM. However, pathogenic variants in BAP1 are detected in only a small subset of UM patients even those with strong personal and family history of cancer suggesting the existence of other candidate genes. The goal of this project is to identify novel candidate genes contributing to hereditary predisposition to UM in patients with no detectable germline pathogenic variant in BAP1.

  Study phs001943

• Somatic Mutations in Epilepsy: Whole Genome Sequence Analysis of Single Neurons

  Low-coverage whole-genome sequencing was performed on single-cells from resected brain tissues obtained from an individual with hemimegalencephaly (HMG) along with a somatic copy number variant (sCNV) of chromosome 1q in order to characterize the sCNV at the single cell level. Single neuronal nuclei and non-neuronal nuclei were isolated by fluorescence-activated cell sorting (FACS) using NeuN immunoreactivity to identify neurons. 46 neurons and 30 non-neuronal cells, as well as a batch of 10 and a batch of 100 cells from each group, were genome amplified using multiple displacement amplification (MDA) and sequenced on an Illumina HiSeq 2000 sequencer. Thirty-two samples were multiplexed into each HiSeq lane for single-end 50 bp runs, obtaining ~5 million pass-filter reads per sample.

  Study phs002615

• The Oral Microbiome and Head and Neck Cancer

  Oral microbiota may influence head and neck squamous cell carcinoma (HNSCC) development, potentially related to carcinogen metabolism. The human oral cavity hosts a diverse microbiota, including bacteria and fungi. We performed shotgun sequencing and ITS1 sequencing on 236 HNSCC case participants who developed HNSCC during a mean follow-up of 5.1 years and 458 matched controls who remained HNSCC-free. Oral samples were obtained from a prospective nested case-control study within three epidemiological cohorts: the American Cancer Society Cancer Prevention Study II Nutrition Cohort (ACS CPS-II), the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial (PLCO), and the Southern Community Cohort Study (SCCS). Control participants were selected using 2:1 frequency matching based on cohort, age, sex, race and ethnicity, and time since oral sample collection.

  Study phs004018

• Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

  The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

  Study phs004044

• exploration of biomarkers discriminating squamous cell carcinoma from other lung cancers

  Targeted therapies based on the molecular and histological features of cancer types are becoming standard practice. The most effective regimen in lung cancers is different between squamous cell carcinoma (SCC) and adenocarcinoma (AD). Therefore a precise diagnosis is crucial, but this has been difficult, particularly for poorly differentiated SCC (PDSCC) and AD without a lepidic growth component (non-lepidic AD). Biomarkers enabling a precise diagnosis are therefore urgently needed. To achieve this goal, we initially performed CAGE (Cap Analysis of Gene Expression) to quantify promoter activities on 97 frozen tissues from surgically resected lung cancers (22 SCC and 75 AD). We furhter expanded the transcriptome profiling to cover additional 48 malignant neoplasm of bronchus and lung, including mesothelioma and metastatic lung cancers derived from other tissues.

  Study JGAS000488

• Transcriptomic profiling of circulating regulatory T cells from follicular lymphoma patients before and after Lenalidomide treatment

  Lenalidomide has demonstrated a favorable efficacy profile in follicular lymphoma (FL) in combination with anti-CD20 antibodies. However, in vivo administration of Lenalidomide in FL patients triggers a proliferation of functional regulatory T cells (Tregs), and a high percentage of Tregs before and along the course of treatment with Lenalidomide/anti-CD20 combination is of poor prognosis. In this study, we evaluated the impact of Lenalidomide on circulating Treg in 3 FL patients using single cell RNA sequencing (scRNAseq). For this purpose, we took advantage of the GALEN clinical trial (NCT01582776), where Lenalidomide was initiated one week before starting the anti-CD20 antibody Obinutuzumab, allowing us to compare the transcriptomic profile of immune cells before (D0) and at day 7 (D7) of treatment by Lenalidomide alone.

  Study EGAS50000001048

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  This study included samples from metastatic breast cancer patients who underwent a biopsy in the context of SAFIR01 (NCT01414933), SAFIR02 (NCT02299999), SHIVA (NCT01771458) and MOSCATO (NCT01566019) prospective trials. These French multicentre trials used high throughput genome analysis on fresh frozen tumor biopsies as a therapeutic decision tool for metastatic cancer patients, with solid cancers (SHIVA, MOSCATO) or specifically with breast cancer (SAFIR01, SAFIR02). All patients gave their informed consent for translational research and genetic analyses of their somatic DNA. Overall, whole-exome sequencing for a total of 216 pairs of metastatic tumor and unmutated DNA derived from corresponding blood samples was performed using Illumina technology. The results of the analysis of the mutational profile of metastatic breast cancer was reported in Lefebvre et al. (PMID:28027327).

  Study EGAS00001001695

• Tumor-associated preferred end coordinates and somatic variants as signatures of circulating tumor DNA

  Cell-free DNA fragmentation is a nonrandom process. We showed that cell-free DNA fragments with ends at certain genomic coordinates had higher likelihoods of being derived from hepatocellular carcinoma. Other coordinates were associated with cell-free DNA molecules originating from the liver. Quantitative assessment of cell-free DNA molecules bearing these respective groups of end signatures correlated with the amounts of tumor-derived or liver-derived DNA in plasma. There were millions of tumor-associated plasma DNA end coordinates across the genome. Due to their high prevalence, they were more readily detectable than somatic mutations as a cancer signature in plasma. Hence, detection of tumor-associated plasma DNA ends may offer a cost-effective means of capturing evidence for the presence of cancer through liquid biopsy assessment.

  Study EGAS00001003160

• Germline Aberrations of PAX5 Cause Susceptibility to pre-B cell Acute Lymphoblastic Leukemia

  A novel heterozygous germline variant, c.547G>A (p.Gly183Ser), in the paired box protein encoding gene, PAX5, was found to segregate with disease in two unrelated kindreds with autosomal dominant pre-B cell acute lymphoblastic leukemia (ALL). Leukemic cells from both families exhibited 9p deletion, with loss-of-heterozygosity and retention of the mutant PAX5 allele at 9p13 . Two additional sporadic ALL cases with 9p loss demonstrated PAX5 Gly183 substitution in the leukemic cells. Functional analysis of the PAX5 germline variants demonstrated reduced transcriptional activity, as well as decreased interaction with Groucho-4. These data extend the role of PAX5 alterations in the pathogenesis of pre-B ALL, and implicate PAX5 in a novel syndrome of germline susceptibility to pre-B cell neoplasia.

  Study EGAS00001000447

• Pediatric Low-Grade Glioma RNA and Targeted Sequencing

  Pediatric low-grade gliomas (pLGG) are frequently driven by genetic alterations in the RAS/MAPK pathway yet show unexplained variability in their clinical outcome. To address this, we characterized a cohort of >1,000 clinically annotated pLGG. 84% of cases harbored a driver alteration, while those without an identified alteration also often exhibited up-regulation of the RAS/MAPK pathway. pLGG could be broadly classified based on their alteration type. Rearrangement-driven tumors were diagnosed at a younger age, enriched for WHO grade I histology, infrequently progressed, and rarely resulted in death as compared to SNV-driven tumors. Further sub-classification of clinical-molecular correlates stratified pLGG into risk categories. These data highlight the biological and clinical differences between pLGG subtypes and opens avenues for future treatment refinement.

  Study EGAS00001004242

• 10x genomics single cell RNA-seq and ATAC-seq from 10 pre-menopausal patients fimbriae and ampullary part of the fallopian tube

  The fallopian tube, connecting the uterus with the ovary, is a dynamic organ that undergoes cyclical changes and is the site of several diseases, including serous cancer. Here, we use single-cell technologies to construct a comprehensive cell map of healthy pre-menopausal fallopian tubes, capturing the impact of the menstrual cycle and menopause on different fallopian tube cells at the molecular level. The comparative analysis between pre- and post-menopausal fallopian tubes reveals substantial shifts in cellular abundance and gene expression patterns, highlighting the physiological changes associated with menopause. Further investigations into menstrual cycle phases illuminate distinct molecular states in secretory epithelial cells caused by hormonal fluctuations. The markers we identified characterizing secretory epithelial cells provide a valuable tool for classifying ovarian cancer subtypes.

  Study EGAS50000000628

• Clinical relevance of TCGA subtypes for gastric cancer patients

  There is a clinical need for the availability of molecular biomarkers in the tratment of gastric cancer (GC), since survival rates remain poor with a 5-year survival rate of only ~`40% for patients with resectable disease. These markers will elad to a more tailored approach in the treatment of GC, which enhances efficacy and reduces toxicity. Recently, The Cancer Genome Atlas (TCGA) classified GC patients into four molecular subgroups: Epstein Barr Virus positive (EBV+), genomically stable (GS), microsatellite instable (MSI), and chromosomal instable (CIN). For this purpose we aim to collect tumor tissue blocks from patients who participated in the Dutch D1/D2 or the CRITICS trial and who gave informed consent for translational studies. Associations between TCGA subtypes and outcomes to these different therapeutic options will be analyzed.

  Study EGAS50000000779

• ECM-free patient-derived organoids preserve diverse prostate cancer lineages and uncover in vitro-enriched cell types

  Patient-derived organoids (PDOs) hold promise for modeling various cancers, yet their application in prostate cancer (PCa) has been limited due to low culture success and the predominance of non-tumor-like cells. Using 164 PCa samples and optimizing culture conditions, we demonstrate that an extracellular matrix (ECM)-free culture method improves PDO take-rates, fostering cell populations with luminal and PCa-specific characteristics. Single-cell RNA sequencing (scRNA-seq) reveals that these ECM-free PDOs closely mirror their original tumors at the transcriptomic level and maintain a diverse array of tumor cell types, unlike traditional Matrigel-based cultures which predominantly yield benign-like cells. This study introduces a PCa PDO single-cell atlas, providing a valuable resource for advancing prostate cancer research.

  Study EGAS50000000807

• Loss-of-activity-mutation in the cardiac chloride-bicarbonate exchanger AE3 causes short QT syndrome

  Patients with short QT syndrome (SQTS) may present with syncope, ventricular fibrillation or sudden cardiac death. Six SQTS susceptibility genes, encoding cation channels, explain less than 25% of SQTS cases. Here we identify a missense mutation in the anion exchanger (AE3)-encoding SLC4A3 gene in two unrelated families with SQTS. The mutation causes reduced surface expression of AE3 and reduced membrane bicarbonate transport. Slc4a3 knockdown in zebrafish causes increased cardiac pHi, short QTc, and reduced systolic duration, which is rescued by wildtype but not mutated SLC4A3. Mechanistic analyses suggest that an increase in pHi and decrease in [Cl-]i shortened the action potential duration. However, other mechanisms may also play a role. Altered anion transport represents a mechanism for development of arrhythmia and may provide new therapeutic possibilities.

  Study EGAS00001002632

• Multiple migrations to the Philippines during the last 50,000 years

  A key link to understand human history in Island Southeast Asia is the Philippine archipelago and its poorly investigated genetic diversity. We collected and analyzed the most comprehensive set of population-genomic data for the Philippines, 1028 individuals covering 115 indigenous communities. We demonstrate that the Philippines were populated by at least five waves of human migration. The Cordillerans migrated into the Philippines prior to the arrival of rice agriculture, where some remain to be the least admixed East Asians carrying an ancestry shared by all Austronesian-speaking populations; thereby challenging an exclusive Out-of-Taiwan model of joint farming-language-people dispersal. Altogether, our findings portray Philippines as a crucial gateway, with a multilayered history, that ultimately changed the genetic landscape of the Asia-Pacific region.

  Study EGAS00001005083

• Germline SDHB-inactivating mutation in gastric spindle cell sarcoma (HIPO-021)

  Gastrointestinal stromal tumors (GISTs) are the most frequent mesenchymal tumors of the gastrointestinal tract. Inactivating mutations or epigenetic deregulation of succinate dehydrogenase complex (SDH) genes are considered defining features of a subset of GIST occurring in the stomach. Based on comprehensive molecular profiling and biochemical analysis within a precision oncology program, we identified hallmarks of SDH deficiency (germline SDHB-inactivating mutation accompanied by somatic loss of heterozygosity, lack of SDHB expression, global DNA hypermethylation, and elevated succinate/fumarate ratio) in a 40-year-old woman with undifferentiated gastric spindle cell sarcoma that did not meet the diagnostic criteria for other mesenchymal tumors of the stomach, including GIST. These data reveal that the loss of SDH function can be involved in the pathogenesis of non-GIST sarcoma of the gastrointestinal tract.

  Study EGAS00001004277

• Persistent Mutation Burden Drives Sustained Anti-Tumor Immune Responses

  Tumor mutation burden is an imperfect proxy of tumor foreignness and has therefore failed to consistently demonstrate clinical utility in predicting responses in the context of immunotherapy. We evaluated mutations in regions of the genome that are unlikely to undergo loss and discovered that clonal mutations in single-copy regions and those present in multiple copies per cell constitute a persistent tumor mutation burden (pTMB) that is linked with therapeutic response to immune checkpoint blockade. Persistent mutations were retained in the context of tumor evolution under selective pressure of immunotherapy and tumors with a high pTMB content were characterized by a more inflamed tumor microenvironment. pTMB imposes an evolutionary bottleneck that cancer cells cannot overcome and may thus drive sustained immunologic tumor control in the context of immunotherapy.

  Study EGAS00001006660

• The Iberian Roma genetic variant server

  The Roma are the most numerous ethnic minority in Europe. The Iberian Roma arrived in the Iberian Peninsula five centuries ago and still today, they keep a strong group identity. Demographic and cultural reasons lie behind a high rate of Mendelian disease often related to founder variants. We have analysed exome data from 119 Iberian Roma individuals collected from 2018 to 2020. A database of variant frequency has been implemented (IRPVS) and made available online. We have analysed the carrier rate of founder private alleles as well as pathogenic variants present in the general population. Significant enrichment in structural variants involving gene clusters related to keratinization and epidermal growth suggest that evolutive mechanisms have developed towards climate and environmental adaptation. IRPVS can be accessed at http://irpvs.clinbioinfosspa.es/

  Study EGAS00001006758

• GCparagon: Evaluation and correction of GC biases in cell-free DNA at the fragment level

  We present GCparagon, a two-stage algorithm for computing and correcting GC biases in cell-free DNA (cfDNA) samples. The length of the highly fragmented cfDNAs and the number of GC bases are essential parameters in the calculations. Regions of low mappability, known reference genome assembly errors and regions surrounding assembly gaps are excluded from the bias computation. GCparagon outputs a bias matrix and an optional tagged BAM file with GC bias balance weights as alignment tags. Parallelization allows calculation of a GC bias estimate in less than 2 minutes per sample with between 99.0% and 99.9% of fragments already corrected. We propose that GCparagon can help standardize cfDNA applications and evaluate the impact of GC bias on algorithms used in the analysis of liquid biopsy data.

  Study EGAS00001006963

• Transcriptome human nasal epithelium

  1. Odors are detected, firstly, by olfactory sensory neurons (OSNs) in the olfactory epithelium of the nose. This neurons then project directly to the olfactory bulb in the brain. Olfaction depends on cellular regeneration of the OE, olfactory bulb and hippocampus, and on their continual re-wiring. The olfactory neural pathway includes regions of the frontal, temporal and limbic brain, which in turn overlap with brain areas involved in brain disorders. OSNs are the only aspect of the human brain exposed to the external environment. This not only makes them vulnerable to environmental changes, but also accessible for biomedical studies. We have already sequenced and developed a protocol for analyzing the transcriptome of mouse main olfactory epithelium and single OSNs. We propose here to perform a similar study for samples from the human olfactory epithelium. We have developed a minimally invasive method for obtaining human OSNs, among other cells from the nasal epithelium. In this experiment, we have obtained cell samples from the olfactory epithelium, including OSN, from healthy volunteers. We would like to further characterize them by RNA sequencing. This will give us valuable insight into human olfaction. It will also provide a first step into a new avenue to study, and find biomarkers for, brain diseases though the analysis of these easily available neurons. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Dataset EGAD00001002226

• Direct Comparative Analysis of 10X Genomics Chromium and Smart-seq2

  Single cell RNA sequencing (scRNA-seq) is widely used for profiling transcriptomes of individual cells. The droplet-based 10X Genomics Chromium (10X) approach and the plate-based Smart-seq2 full-length method are two frequently-used scRNA-seq platforms, yet there are only a few thorough and systematic comparisons of their advantages and limitations. Here, by directly comparing the scRNA-seq data by the two platforms from the same samples of CD45- cells, we systematically evaluated their features using a wide spectrum of analysis. Smart-seq2 detected more genes in a cell, especially low abundance transcripts as well as alternatively spliced transcripts, but captured higher proportion of mitochondrial genes. The composite of Smart-seq2 data also resembled bulk RNA-seq data better. For 10X-based data, we observed higher noise for mRNA in the low expression level. Despite the poly(A) enrichment, approximately 10-30% of all detected transcripts by both platforms were from non-coding genes, with lncRNA accounting for a higher proportion in 10X. 10X-based data displayed more severe dropout problem, especially for genes with lower expression levels. However, 10X-data can better detect rare cell types given its ability to cover a large number of cells. In addition, each platform detected different sets of differentially expressed genes between cell clusters, indicating the complementary nature of these technologies. Our comprehensive benchmark analysis offers the basis for selecting the optimal scRNA-seq strategy based on the objectives of each study.

  Dataset EGAD00001005448

• Programmatic submission based on XML

  Programmatic submissions (XML based) For further information please check our Submission FAQs, submission quickguide as well as submission terms! Introduction Besides the Submitter Portal tool, EGA supports programmatic sequence and clinical data metadata submissions. If you are not sure what this means, you may want to explore our brief metadata introduction. Programmatic submissions are recommended for array-based submission. Moreove, it may be of help if your submission is recurrent or it is difficult to manage manually due to its sheer size. Otherwise, we highly recommend using the Submitter Portal to perform submissions. In this page we will guide you through the required steps to programmatically submit data to the EGA. Programmatic submissions require your metadata to be structured for an easy and straightforward validation and archival. It basically consists in formatting your metadata as Extensible markup language (XML) files and submitting them to the EGA using the WEBIN Before submitting metadata to the EGA, it is important to ensure that the information in your XML files is compliant with our standards. You can see further details on how these standards are maintained at EGA at our EGA Schemas documentation page. Using WEBIN, you can validate your XML files against EGA's schemas to ensure that your metadata is compliant before submission. WEBIN services WEBIN production service WEBIN test service We advise you to submit your metadata to the test service when submitting to the production service for the first time. The test service is identical to the production service except that all submissions will be discarded in the following 24 hours. This allows you to learn about the submission process without having to worry about data being submitted. Authentication Authentication is required each time a submission is made. The submission service uses HTTPS protocol for metadata encryption and identification to provide a secure submission environment. Data file upload Both Runs and Analyses reference files (e.g. FASTQ need to be uploaded to the EGA before these metadata objects are submitted. In other words, if you submit a Run that references a file that we cannot find associated with your account, the metadata submission will fail. See further details on how to upload your files in our File Upload documentation. Metadata model of the EGA Our metadata model is formed by multiple metadata objects. Check further details in our documentation at our EGA Schema documentation page. Working with EGA XMLs files Now that the basic concepts of the EGA metadata have been described, you can start preparing your programmatic submission through XML. Here you will find the guidance on how to prepare the XML files. Programmatic Submission Tutorial Video Take a look at the Programmatic Submission Tutorial Video, which explains the workflow of a programmatic submission and goes over an example metadata submission. Programmatic Submission Tutorial Video. When building your XML files, we recommend using text editors (e.g.Sublime Text or VisualStudio) that allow you to visualise the structure of the XML with ease. Furthermore, these editors constantly check the consistency of the XML structure. Alternatively, and if the submission consists of a big number of objects (specially analyses), you may find the tool star2xml handy. This tool allows for a direct conversion between metadata in a tabular format (e.g. a spreadsheet) into XMLs. Identifying objects: Aliases and center names Every EGA object must be uniquely identified within the submission account using their alias attribute. The aliases can be used in submissions to make references between EGA objects. Let us dig into EGA's use of aliases and center names: alias: every object should have a name that is unique within your submission account. Once submitted successfully, every alias will be assigned a unique and permanent accession (EGA ID). refname: when an object references another by its alias, the alias of the referenced object goes into the "refname" attribute of the referencing object. For example, if a sample has the alias "sample1", and an experiment uses this sample, then the experiment's "EXPERIMENT/SAMPLE/refname" attribute should be "sample1". center_name: The "center_name" attribute is required within the submission XML and, if not provided when the object is submitted, it will be automatically filled using your default EGA account center_name. This element is the "controlled vocabulary acronym or abbreviation that is provided to the account holder when the account is first generated". If the submitter is brokering a submission for another institute, the submitter should use their special broker account name in broker_name while the data centre acronym remains in center_name. Log-in details should have been provided when you requested a submission account. Please contact our Helpdesk team if you have any questions. run_center: Many submitting centers contract out the actual sample sequencing to another center. In these cases, the sequencing center should be acknowledged in the run_center attribute. Again, this is controlled vocabulary and the acronym should be sought from EGA helpdesk before submitting. Please contact our Helpdesk team if you have any questions. Prepare your XMLs The goal of this section is to provide sufficient information to be able to create the metadata XML documents required for programmatic submissions. Please note, the EGA utilises the XML schemas maintained at the European Nucleotide Archive (ENA). It is important due to the fact that by using a similar system, some pieces of documentation from the ENA's programmatic submission can also help you with your programmatic submission to the EGA. For example, you can submit programmatically without using a Submission XML by following the steps at Submission actions without submission XML. A submission does not have to contain all different types of XMLs. For example, it is possible to submit only a few samples; or a study that is later to be referenced. You can submit each object one by one, or submit all in a batch: you choose what method of submission works best for you. We do recommend, nevertheless, that you submit the objects to be referenced (e.g. samples or studies) first, and the objects that reference these (e.g. experiments or datasets) afterwards. You can see a graphical view of these objects and their relationships at our EGA Schemas page. Independently of the submission scenario, you will always require a Dataset XML. The entity of a dataset is what is used to control access to the given data, in the form of runs or analyses. In other words, when a requester is granted access, it is through the dataset and the objects (e.g. runs or analyses) that the dataset contains, granting access to them in one go. Given the nature of the EGA, a dataset XML will always be required for the data access. First, we will differentiate between submissions of "raw" and "processed" data: Runs and Analyses, respectively. Run data submissions Raw data derives from instruments "as is". For example, a plain sequence file (e.g. FASTQ or unaligned BAM files) would be considered raw data. A typical raw (unaligned) sequence read submission consists of 8 XMLs: Submission Study Sample Experiment Run DAC Policy Dataset When technical reads (e.g. barcodes, adaptors or linkers) are included in the submitted raw sequences, a spot descriptor must be submitted to describe the position of the technical reads so that they can be removed. The following data files can be submitted without providing spot descriptor information in the experiment/run XML: BAM files (single reads) SFF files (single reads without barcodes) FastQ files (single reads without any technical reads) Complete Genomics files Analysis data submissions Processed data is, in some way, refined raw data. This includes raw data that has been processed by some form of analysis method (e.g. alignment, noise reduction, etc.). For example, an aligned sequence (e.g. BAM file), that was created using raw FASTQ files, would be a processed file. This category includes most types of data: sequence alignment files (e.g. BAM or CRAM), clinical data (e.g. phenopackets), sequence variation files (e.g. VCF), sequence annotation, etc. A typical EGA analysis data submission consists of 7 EGA XML: Submission Study Sample Analysis DAC Policy Dataset We accept three different types of analysis data submissions: BAM files (for multiple read alignments) VCF files (for sequence variations) Phenotype files (in any format) In anycase, keep in mind that samples must be created in order to be referenced in the analyses. In other words, the provenance of the information within the BAM, VCF and phenotype files Example XMLs Below you can find a non-extensive list of example XMLs with descriptive fields (i.e. explaining what to provide in each field). Furthermore, you can also find real examples (i.e. the true value of the provided fields) in our GitHub repository. Submission XML The submission XML is used to validate, submit or update any number of other objects. The submission XML refers to other XMLs. New submissions use the ADD action to submit new objects. Object updates are done using the MODIFY action and objects can be validated using the VERIFY action. Descriptive submission XML example True values submission XML example Study XML The study XML is used to describe the study containing a title, a study type and abstract as it would appear in a publication. Descriptive study XML example True values study XML example Please use the following notation within the property "STUDY_LINKS" when including PubMed citations in the Study XML: <STUDY_LINKS> <STUDY_LINK> <XREF_LINK> <DB>PUBMED</DB> <ID>18987735</ID> </XREF_LINK> </STUDY_LINK> </STUDY_LINKS> Sample XML The sample XML is used to describe the samples used to obtain the data, whether they were sequenced, measured in any other way, or have an associated phenotype. The mandatory fields include information about the taxonomy of the sample, sex, subject ID and phenotype. For example, the mandatory attribute fields for each sample would look like these, within the array of "SAMPLE_ATTRIBUTES": <SAMPLE_ATTRIBUTES> <SAMPLE_ATTRIBUTE> <TAG>subject_id</TAG> <VALUE>free text!</VALUE> </SAMPLE_ATTRIBUTE> <SAMPLE_ATTRIBUTE> <TAG>sex</TAG> <VALUE>female/male/unknown</VALUE> </SAMPLE_ATTRIBUTE> <SAMPLE_ATTRIBUTE> <TAG>phenotype</TAG> <VALUE>Free text, EFO terms (e.g. EFO:0000574) are recommended</VALUE> </SAMPLE_ATTRIBUTE> </SAMPLE_ATTRIBUTES> Sample is one of the most important objects to be described biologically, it is highly recommended that “TAG-VALUE” pairs are generated as SAMPLE_ATTRIBUTES to describe the sample in as much detail as possible. For example, were we to give the population ancestry of the sample, we could add a new attribute to the array, in which, for example, we would indicate that the sample derives from an individual of "Mende in Sierra Leone" (MSL), with an african ancestry: <SAMPLE_ATTRIBUTE> <TAG>Population</TAG> <VALUE>MSL</VALUE> </SAMPLE_ATTRIBUTE> Given that VALUE and TAG are free text, the combinations are limitless in order to give you full flexibility on the information you want to provide. We recommend you use the Experimental Factor Ontology (EFO) to describe the phenotypes of your samples. You can provide more than one phenotype by adding more items to the array of SAMPLE_ATTRIBUTES. Phenotypes considered essential for understanding the data submission should be provided. Each phenotype described should be listed as a separate sample attribute <SAMPLE_ATTRIBUTE> </SAMPLE_ATTRIBUTE>. There is no limit to the number of phenotypes that can be submitted. If a suitable EFO accession cannot be found for your phenotype attribute, please consider using another controlled ontology database (e.g. HPO, MONDO, etc.) before using free text. Descriptive sample XML example True values sample XML example Experiment XML The experiment XML is used to describe the experimental setup, including instrument platform and model details, library preparation details, and any additional information required to correctly interpret the submitted data. Where any of these values differ between runs, a new experiment object must exist, since runs are grouped by experiments. Each experiment references a study and a sample by alias, or if previously-submitted, by accession. Pooled data must be demultiplexed by barcode for submission. Descriptive experiment ( Illumina paired read ) XML example True values experiment ( Illumina paired read ) XML example Run XML The run XML is used to associate data files with experiments and typically comprises a single data file (e.g. a FASTQ file). Please note that pooled samples should be de-multiplexed prior submission and submitted as different runs. Descriptive run XML example True values run XML example Analysis XML Given that an analysis can be used to submit any type of processed data to the EGA, we will list below an example of each of the three most common types of analysis XMLs submitted to the EGA: sequence alignments (e.g. BAM files); sequence variation (e.g. VCF files); and clinical metadata or phenotypes (e.g. phenopackets). Regardless of the type of processed data submitted in the analysis, the analysis must be associated with a Study and can reference multiple types of other objects, from samples to experiments, if they are available at the EGA. Just like with Runs, whenever a file is submitted to the EGA through an analysis object, the file MD5 checksums must be present, in order for the EGA to validate file integrity upon transfer. This also includes index files when applicable (e.g. .bai.md5 files). Ideally, any analysis that uses a reference sequence for some kind of alignment (e.g. BAM, CRAM or VCF files), would contain metadata about the alignment, such as INSDC reference assemblies and sequences, by either using accessions (e.g. CM000663.1) or common labels (e.g. GRCh37). Read alignment (BAM) Analysis XML The Analysis can be used to submit BAM alignments to EGA. Only one BAM file can be submitted in each analysis and the samples used within the BAM read groups must be associated with Samples. Descriptive bam alignments XML example True values bam alignments XML example Sequence variation (VCF) Analysis XML The Analysis can be used to submit VCF files to EGA. Only one VCF file can be submitted in each analysis and the samples used within the VCF files must be associated with Samples. Download analysis XML (VCF) Phenotype files The Analysis XML can be used to submit phenotype files to the EGA. Only one phenotype file can be submitted in each analysis and the samples used within the phenotype files must be associated with EGA Samples. Download analysis XML (Phenotype) DAC XML The DAC XML describes the Data Access Committee (DAC) affiliated to the data submission. The DAC may consist of a group or a single individual and is responsible for the data access decisions based on the application procedure described in the POLICY.XML. As with any other object, if it was already submitted to the EGA, there is no need to submit it again: you can reference an existing object within the EGA. Hence, A DAC XML does not need to be provided if your submission is affiliated to an existing EGA DAC.. Further information on DACs can be found here, and you can always contact our Helpdesk team if you have further inquiries. Descriptive dac XML example True values dac XML example Policy XML The Policy XML describes the Data Access Agreement (DAA) to be affiliated to the named Data Access Committee. Descriptive policy XML example True values study XML example Dataset XML The dataset XML describes the data files, defined by the Run.XML and Analysis.XML, that make up the dataset and links the collection of data files to a specified Policy. The dataset xml is commonly the last metadata object to be submitted, since it references multiple other entities. Please consider the number of datasets that your submission consists of. For example, a case-control study is likely to consist of at least two datasets. In addition, we suggest that multiple datasets should be described for studies using the same samples but different sequence technologies. Descriptive dataset XML example True values dataset XML example Validating and submitting your EGA Validating EGA's XMLs through Webin After you have ensured that the XMLs are properly formatted and contain all the required information. You can proceed to validate and submit your data. Use the curl command to validate your XML file: Once you have prepared your XML file and asserted you have access to Webin, you can validate your XML file programmatically against EGA's schemas using the curl command. There are multiple ways in which you can validate your XMLs. This variety has to do with the fact that: (1) there are 2 instances of Webin (test and production); and (2) that validation is a default step during submission. In other words, any time that you submit your data through Webin, it will be validated automatically before being accepted. This allows for 4 possible routes of validation, all having the same validation result: validating or submitting to either the production service or the test service of Webin. For example, directly validating a "study" object XML in the testing service (wwwdev…) would look like the following: curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" In this command, you would need to replace <USERNAME> and <PASSWORD> with your EGA account username and password, respectively. You would also replace <INPUT_FILE> with the path to your XML file. A mock example would look like the following: curl -u ega-test-data@ebi.ac.uk:egarocks -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" The validation attempt can have different results depending on the given arguments: If your XML file is valid according to EGA's schemas, you will see a message indicating that your XML file is compliant. For example, see below for our mock example, where the "success" was "true" (i.e. no validation errors found). Nevertheless, notice how the "<STUDY accession=" is empty: it is because we were simply validating, so the study did not get an accession or ID. <?xml version="1.0" encoding="UTF-8"?> <?xml-stylesheet type="text/xsl" href="receipt.xsl"?> <RECEIPT receiptDate="2023-04-11T15:19:28.850+01:00" submissionFile="submission-EBI-TEST_1681222768850.xml" success="true"> <STUDY accession="" alias="Mock example" status="PRIVATE"/> <SUBMISSION accession="" alias="SUBMISSION-11-04-2023-15:19:28:840"/> <MESSAGES> <INFO>VALIDATE action has been specified.</INFO> <INFO>Submission has been rolled back.</INFO> <INFO>This submission is a TEST submission and will be discarded within 24 hours</INFO> </MESSAGES> <ACTIONS>VALIDATE</ACTIONS> <ACTIONS>PROTECT</ACTIONS> If there are any errors or warnings, the tool will display them, allowing you to correct them before submitting your data to EGA. For example, in the following response, it is said that the object we were trying to submit was already existing, and therefore the "success" was "false". <?xml version="1.0" encoding="UTF-8"?> <?xml-stylesheet type="text/xsl" href="receipt.xsl"?> <RECEIPT receiptDate="2023-04-11T15:12:35.609+01:00" submissionFile="submission-EBI-TEST_1681222355609.xml" success="false"> <STUDY alias="Example!_Human Microbiome Project SP56J" status="PRIVATE" holdUntilDate="2023-03-11Z"/> <SUBMISSION alias="SUBMISSION-11-04-2023-15:12:35:576"/> <MESSAGES> <ERROR>In study, alias: "Example!_Human Microbiome Project SP56J". The object being added already exists in the submission account with accession: "ERP127584".</ERROR> <INFO>VALIDATE action has been specified.</INFO> <INFO>Submission has been rolled back.</INFO> <INFO>This submission is a TEST submission and will be discarded within 24 hours</INFO> </MESSAGES> <ACTIONS>VALIDATE</ACTIONS> <ACTIONS>PROTECT</ACTIONS> If the curl command retrieves no response at all, please double check if your username and password are correctly provided. Also notice the "ACTION=..." argument passed to the Curl command. This specifies the action to take during the call to Webin, so we do not need a "Submission" XML just for a validation attempt. See more at submission actions without submission XML. Furthermore, validation of multiple files or objects (e.g. sample, experiment, study…) can be done in a single command by adding more arguments (i.e. '-F'). For example: curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" -F "SAMPLE=@sample.xml" -F "DATASET=@dataset.xml" As mentioned above, beside "validate" action in the test environment, you can also validate your metadata by three other methods: "Validate" in the production server. From our example above, you simply need to take the "dev" away from the URL. curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://www.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" "Add" in the development server. From our example above, you would simply need to replace the action: from "validate" to "add". Whatever is submitted to this service will be discarded in 24h, so whether something gets submitted or not would not matter in the long run. curl -u <USERNAME>:<PASSWORD> -F "ACTION=ADD" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" "Add" in the productionserver. A combination of the previous two methods, which would render this attempt into a submission. This path is just to be taken when you are sure your metadata is compliant and what you want to submit. curl -u <USERNAME>:<PASSWORD> -F "ACTION=ADD" "https://www.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" What happens after the submission of a dataset XML? Once you have completed the registration of your dataset/s please contact our Helpdesk Team to provide a release date for your study. Please note that all datasets affiliated to unreleased studies are automatically placed on hold until the authorised submitter or DAC contact contact the EGA Helpdesk for the study to be released. We strongly advise you not to delete your data until EGA Helpdesk confirms that your data has been successfully archived.

  Documentation submission/metadata/submission/programmatic-submission-xml

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response

  The study 'Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response' reports the genomic characterization at the single allele level upon Whole Exome Sequencing of Bladder Cancer (BLCa) Patient Tumor (PT) samples obtained from 18 patients and corresponding Patient Derived Organoids (PDOs), implementing the SPICE pipeline (Ciani Y et al). Our cohort included 21 PTs and 22 PDOs. In this study, we generated a unique biobank resource of BLCa organoids that encompasses a broad spectrum of disease stages. We demonstrated that PDOs retain cancer heterogeneity and mutational burden. Furthermore, we observed that BLCa PDO can have different morphologies which may reflect tumor-specific features. Indeed, a solid morphology may be associated with more advanced tumors, as supported by the high PDO genomic burden and high primary tumor stage. Moreover, with our drug screening pipeline, we demonstrated the clinical relevance and feasibility of using a BLCa PDO-based drug assay for comparing the standard of care (SOC) drugs with compounds not currently in use for BLCa. Response to SOC was highly heterogeneous with approximately 50% of non-muscle invasive bladder cancer and 33% of muscle invasive bladder cancer PDOs showing no or minimal response. The most effective targeted therapy was lapatinib. We used an integrative analysis of drug response profiles with matched PDO genomic analysis to determine enrichment thresholds for candidate markers of therapy resistance and sensitivity. Importantly, by assessing the clinical history of longitudinally sampled cases, the clonal evolution of the disease could be determined and matched with PDO drug response profiles.

  Study phs003149

• Genomic Studies of Bipolar Disorder in a Large Cohort from The Netherlands

  The transcriptomes of whole blood samples of a large cohort of individuals from the Netherlands were assayed using RNA-seq. These whole blood samples included patients diagnosed with schizophrenia or bipolar disorder, family members of patients, and healthy controls. Within the whole blood dataset, about 600 of the samples were sequenced to an average of 13.9 million mapped reads per sample, while about 2,000 were sequenced to an average of 5.9 million mapped reads per sample, in order to assess changes in power to detect eQTLs based on sample size. We find that expression, defined as the log transcripts per million reads (TPMs), is highly correlated when comparing the moderate (13.9M) and lower (5.9M) coverage datasets.&nbsp;Additionally, a subset of about 150 individuals provided fibroblast cell lines which were assessed for the levels of gene expression using RNA-seq at an average of 50 million mapped reads per sample. We use downsampling techniques to generate synthetic datasets derived from this real fibroblast RNA-Seq data to explore the relationship between coverage and number individuals in an eQTL analysis.&nbsp;Corresponding individual-level genotypes for the samples included in the expression matrix are also made available. The genotypes were derived from multiple other project cohorts, each using different genotyping platforms including OmniExpress Exome, Global Screening Array, Illumina550, and PsychChip. A Plink file set of these cohorts is provided here after merging the separate project file sets and extracting only the individuals who have expression data also provided here; quality control for SNP-missingness is recommended.&nbsp;We demonstrate in this study that given a fixed budget, eQTL discovery power can be increased by lowering the sequencing depth per sample to allow for an a greater number of individuals sequenced.&nbsp;

  Study phs002856

• Whole genome sequencing of a breast cancer cohort with known functional homologous recombination status

  Optimal patient selection for PARP inhibitors and double strand break (DSB) inducing chemotherapy is of great clinical importance. In principle, the use of these therapies can be extended beyond germline BRCA1/2 mutated cancers. Although several methods for detection of BRCA-like tumors have been developed, a golden standard is lacking. We have developed the RECAP test, a functional HR assay exploiting the formation of RAD51 foci in proliferating cells after ex vivo irradiation of fresh primary breast cancer (BrC) tissue. The RECAP test seems robust and has an advantage over genetic tests, due to its functional character for exploring the HR phenotype. Another type of HRD test is the BRCAness classifier, which is based on specific genomic patterns derived from copy number data of BRCA1/2 mutated BrCs that also occur in sporadic cancers. The BRCAness classifier is a robust test that is easily applicable in the clinic and has also been validated to predict in vivo response to high dose chemotherapy in clinical trials. More recently, a new HRD test based on genomic signatures which can be extracted from whole genome sequencing has been published, HRDetect. Studies comparing these different HRD tests within the same cohort of patients do not yet exist. Here, we have the unique opportunity to compare three HRD tests within the same cohort. We aim to compare three different HRD tests (RECAP, BRCAness classifier and HRDetect) within the same cohort of primary BrCs (n=41). As a secondary aim, we will analyze additional genetic alterations in HRD tumors (both BRCA-deficient and BRCA-proficient HRD tumors).

  Study EGAS00001005572

• A transcriptomic approach to understand patient susceptibility to pneumonia after abdominal surgery

  Rationale Nosocomial infections are a major healthcare challenge, developing in over 20% of patients aged 45 or over undergoing major-abdominal surgery, with postoperative pneumonia associated with an almost five-fold increase in 30-day mortality. Objectives To describe immune-pathways and gene-networks altered following major-abdominal surgery and identify transcriptomic patterns associated with postoperative pneumonia. Methods and Measurements From a prospective consecutive cohort (n=150) undergoing major-abdominal surgery whole-blood RNA was collected preoperatively and at three time-points postoperatively (2-6, 24 and 48hrs). Twelve patients diagnosed with postoperative pneumonia and 27 matched patients remaining infection-free were identified for analysis with RNA-sequencing. Main Results Compared to preoperative sampling, 3,639 genes were upregulated and 5,043 downregulated at 2-6hrs. Pathway-analysis demonstrated innate-immune activation with neutrophil-degranulation and Toll-like-receptor signalling upregulation alongside adaptive-immune suppression. Cell-type deconvolution of preoperative RNA-sequencing revealed elevated S100A8/9-high neutrophils alongside reduced naïve CD4 T-cells in those later developing pneumonia. Preoperatively, a gene-signature characteristic of neutrophil-degranulation was associated with postoperative pneumonia acquisition (P=0.00092). A previously reported Sepsis Response Signature (SRSq) score, reflecting neutrophil-dysfunction and a more dysregulated host response, at 48hrs postoperatively, differed between patients subsequently developing pneumonia and those remaining infection-free (P=0.045). Analysis of the novel neutrophil gene-signature and SRSq scores in independent major-abdominal surgery and polytrauma cohorts indicated good predictive performance in identifying patients suffering later infection. Conclusions Major-abdominal surgery acutely upregulates innate-immune pathways while simultaneously suppressing adaptive-immune pathways. This is more prominent in patients developing postoperative pneumonia. Preoperative transcriptomic signatures characteristic of neutrophil-degranulation and postoperative SRSq scores may be useful predictors of subsequent pneumonia risk.

  Study EGAS00001007229