10961 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 25.25 milliseconds.

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• non-malignant plasma cfRNA

  Dataset contains mRNA capture sequencing data from plasma of 125 different human donors: 88 patients with a non-malignant disease and 37 cancer-free controls. Samples were sequenced on a NovaSeq X and sequencing data is provided in FASTQ format.

  Dataset EGAD50000001806

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Research Program on Genes, Environment and Health (RPGEH)

  The Kaiser Permanente Research Program on Genes, Environment, and Health (RPGEH) is a resource developed to facilitate research on genetic and environmental factors on common diseases and healthy aging. The RPGEH resource links biospecimens, health surveys, and comprehensive electronic medical records on broadly consented adult members of Kaiser Permanente Medical Care Plan, Northern California Region (KPNC). KPNC is an integrated health care delivery system with a membership of approximately 3.3 million people in northern California. The membership of KPNC is representative of the general population in the 14 county area in which facilities are located, although extremes of income are underrepresented. At the end of 2013, the RPGEH resource included: (1) demographic and behavioral surveys from over 430,000 participants; (2) biospecimens (DNA, serum, plasma, and/or saliva) from over 204,000 participants, including over 13,000 pregnant women; (3) genome-wide genotype data (70 billion SNP genotypes) on over 100,000 participants, including the Genetic Epidemiology Research on Adult Health and Aging (GERA) cohort; and (4) the longitudinal electronic medical records of the participants. The RPGEH was developed beginning in 2005 at the Division of Research of Kaiser Permanente Northern California by Catherine Schaefer (Director), Neil Risch (Co-Director), Lisa Croen, Eric Jorgenson, Lawrence Kushi, Charles Quesenberry, Sarah Rowell, Carol Somkin, Stephen Van den Eeden, Larry Walter, and Rachel Whitmer. Funding of the RPGEH was provided to C. Schaefer (PI) and N. Risch (co-PI) by the Wayne and Gladys Valley Foundation, The Ellison Medical Foundation, the Robert Wood Johnson Foundation, Kaiser Permanente Northern California, and the Kaiser Permanente National and Regional Community Benefit Programs. The GERA cohort was funded by a grant from NIH to RPGEH and UCSF (RC2 AG036607; C. Schaefer and N. Risch, PIs). At the time of the award of the RC2 project in late 2009, the RPGEH had established a cohort of about 140,000 individuals who had answered a detailed survey, provided saliva samples for extraction of DNA, and given broad consent for the use of their data in studies of health and disease. Survey and Cohort Recruitment. Initially, the RPGEH developed electronic disease registries to enable identification of phenotypes, using algorithms applied to EMR data. In 2007, the RPGEH mailed a four page survey to 1.9 million adult (≥ 18 years old) members of KPNC who had been members for two years or more, to obtain data on demographic and behavioral factors complementary to the clinical data in the EMR. The survey materials included a cover letter introducing the RPGEH, a two page list of Frequently Asked Questions, and the survey, which included questions on demographic factors such as education, race-ethnicity, income and marital status, dietary factors, physical activity, smoking, and alcohol consumption, as well as reproductive history and reproductive health. Members whose electronic medical records indicated a preference for written communications in Chinese or Spanish received survey materials both in English and a Chinese or Spanish translation. Approximately 400,000 completed surveys were returned. Saliva Sample Collection. Beginning in July 2008, respondents to the survey were asked to sign and return a consent form and authorization for use and disclosure of protected health information. The consent form authorized broad use of biospecimens, survey data, and data from participants' electronic health records for use in studies of genetic and environmental influences on health and disease. Respondents who returned completed consent forms were mailed (Oragene) saliva collection kits; more than 132,000 saliva samples were collected in two years. Completed saliva kits were scanned and archived in a temporary biorepository at the KPNC Division of Research. In late 2009, the RPGEH began collection of saliva samples from the California Men's Health Study (CMHS), a cohort that had been previously assembled in 2002-2003 and had been excluded from the RPGEH survey mailing with the intent of later adding CMHS participants to the assembled RPGEH cohort. The CMHS was developed to facilitate research on prostate cancer and other conditions in older men; the study protocol is described in Enger, et al., 2006. It enrolled and surveyed more than 40,000 men in KPNC, ages 45-69 years, who were members of KPNC during 2002-2003. CMHS men completed two mailed surveys with demographic and behavioral data similar to that of the RPGEH. The data on analogous variables were reconciled and integrated with the data derived from the RPGEH cohort for use in the RPGEH resource. By 2011, RPGEH collected approximately 15,400 saliva samples from men participating in the CMHS. RPGEH Access and Collaborations Website and Procedures. The RPGEH maintains a web portal for inquiries and applications for collaboration and access to data. The url is: https://rpgehportal.kaiser.org/. RPGEH has an application process and an Access Review Committee that reviews applications for collaboration and use. For more information, please contact RPGEH through the website.

  Study phs000788

• The Genetic Architecture of Smoking and Smoking Cessation

  This study includes samples from two projects: Collaborative Genetic Study of Nicotine Dependence (COGEND; PI: Laura Bierut) and University of Wisconsin Transdisciplinary Tobacco Use Research Center (UW-TTURC; PI: Timothy Baker). Data are available for an additional 1420 COGEND subjects through the Study of Addiction: Genetics and Environment (SAGE), dbGaP study accession phs000092. The majority of these subjects are independent from the current study, but there is a small amount of overlap between the two samples (n=29 subjects) for quality control purposes. It should be noted that the case definition in the SAGE study is DSM-IV alcohol dependence. The case definition in the current study is nicotine dependence by a current score of 4 or greater on the Fagerström Test for Nicotine Dependence (FTND). The overall goal of this project is to identify and characterize genetic variants that contribute to the development of nicotine dependence, related smoking behaviors, and smoking cessation. The COGEND sample includes unrelated cases and controls for a genetic association study of nicotine dependence. Cases are defined by a commonly used definition of nicotine dependence, a current score of 4 or more (maximum score of 10) on the Fagerström Test for Nicotine Dependence (FTND). Control status is defined as an individual who smoked at least 100 cigarettes during their lifetime, yet never became dependent (lifetime FTND=0). By selecting controls who smoked, those genetic effects that are specific to nicotine dependence can be examined. The UW-TTURC sample includes nicotine dependent smokers from three smoking cessation studies. Subjects had to smoke at least 10 cigarettes per day (confirmed smoking by an alveolar carbon monoxide (CO) level greater than 9) and report being motivated to quit smoking. Participants were excluded based on evidence of psychosis history, clinically significant depression symptoms, other severe mental illness, or contraindications to smoking cessation medications. COGEND: COGEND was initiated in 2001 as a three-part program project grant funded through the National Cancer Institute (NCI; PI: Laura Bierut). The three projects included a study of the familial transmission of nicotine dependence, a genetic study of nicotine dependence, and a study of the relationship of nicotine dependence with nicotine metabolism. The primary goal is to detect, localize, and characterize genes that predispose or protect an individual with respect to heavy tobacco consumption, nicotine dependence, and related phenotypes and to integrate these findings with the family transmission and nicotine metabolism findings. The primary design is a community based case-control family study. Nicotine dependent cases and non-dependent, smoking controls were identified and recruited from Detroit and St. Louis. In addition, one sibling for each case and control subject was recruited in a subset of the sample. More than 54,000 subjects aged 25-44 years were screened by telephone; more than 3,100 subjects were personally interviewed; and more than 2,900 subjects donated blood samples for genetic studies. UW-TTURC: The UW-TTURC was initiated in 2001 as a study of nicotine dependence and smoking cessation treatment. The second round of UW-TTURC was initiated in 2005 as a study of efficacy of smoking cessation and long term outcomes. Nicotine dependent smokers seeking cessation treatment were identified and recruited from Madison and Milwaukee, WI. Over 9,000 adult smokers were screened by telephone; 2,575 individuals were enrolled and randomized to treatment conditions that involved use of different smoking cessation medications. Participants from the UW-TTURC smoking cessation clinical trials had the option of participating in a genetic substudy, and approximately 2,000 donated blood samples for genetic studies. The goal of the genetic studies of smokers seeking cessation treatment is to detect, localize, and characterize genes that predispose or protect an individual with respect to heavy tobacco consumption, nicotine dependence, and related phenotypes including cessation, withdrawal, and relapse. Both studies (COGEND and UW-TTURC) include measures of basic socio-demographic variables, including age, sex, race/ethnicity, family income, and educational attainment. Information on nicotine dependence, as assessed by the Fagerström Test for Nicotine Dependence (FTND) is available for all subjects. In addition, participants also completed the Nicotine Dependence Syndrome Scale (NDSS; Shiffman et al., 2004) and the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68; Piper et al, 2004). Coding for both individual variables and indices has been standardized across studies. All subjects were assessed in person by trained research assistants. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to the genetic architecture of smoking through large-scale genome-wide association studies of two well-characterized cohorts. Genotyping was performed at the Johns Hopkins University Center for Inherited Disease Research (CIDR). Data cleaning and harmonization were done at the GEI-funded GENEVA Coordinating Center at the University of Washington.

  Study phs000404

• NHLBI TOPMed: The Jackson Heart Study (JHS)

  Since there is a greater prevalence of cardiovascular disease among African Americans, the purpose of the Jackson Heart Study (JHS) is to explore the reasons for this disparity and to uncover new approaches to reduce it. The JHS is a large, community-based, observational study whose 5306 participants were recruited from among the non-institutionalized African-American adults from urban and rural areas of the three counties (Hinds, Madison, and Rankin) that make up the Jackson, MS, metropolitan statistical area (MSA). Jackson is the capital of Mississippi, the state with the largest percentage (36.3%) of African Americans in the United States. The JHS design included participants from the Jackson ARIC study who had originally been recruited through random selection from a drivers' license registry. Approximately six months before the JHS was to begin, an amendment to the federal Driver's Privacy Protection Act was passed that changed the level of consent for public release of personal information from driver's license lists from an "opt out" to an "opt in" basis. The Mississippi Highway Patrol was no longer able to release a complete listing of all persons with driver's licenses or state identification cards, which prevented its use in the JHS. New JHS participants were chosen randomly from the Accudata America commercial listing, which provides householder name, address, zip code, phone number (if available), age group in decades, and family components. The Accudata list was deemed to provide the most complete count of households for individuals aged 55 years and older in the Jackson MSA. A structured volunteer sample was also included in which demographic cells for recruitment were designed to mirror the eligible population. Enrollment was opened to volunteers who met census-derived age, sex, and socioeconomic status (SES) eligibility criteria for the Jackson MSA. In addition, a family component was included in the JHS. The sampling frame for the family study was a participant in any one of the ARlC, random, or volunteer samples whose family size met eligibility requirements. Eligibility included having at least two full siblings and four first degree relatives (parents, siblings, children over the age of 21) who lived in the Jackson MSA and who were willing to participate in the study. No upper age limit was placed on the family sample. Known contact information was obtained during the baseline clinic examination from the index family member with a verbal pedigree format to identify name(s), age(s), address (es), and telephone number(s). Recruitment was limited to persons 35-84 years old except in the family cohort, where those 21 years old and above were eligible. Only persons who otherwise met study criteria but were deemed to be physically or mentally incompetent by trained recruiters were excluded from study eligibility.1 1 Wyatt SB, Diekelmann N, Henderson F, Andrew ME, Billingsley G, Felder SH et al. A community-driven model of research participation: the Jackson Heart Study Participant Recruitment and Retention Study. Ethn Dis 2003; 13(4):438-455 (PMID: 14632263).

  Study phs000964

• Methylation biomarker study of magnesium deficiency and colorectal cancer

  Five US studies using the Mg tolerance test, the "gold standard" test of Mg status, indicated that >50% participants had Mg deficiency. In our ongoing US trial, we have found a similar result. In growing recognition of the importance of Mg in human health, very recently, Mg was selected by the US Federal Dietary Reference Intake (DRI) Committee to update the DRI. In US and other populations at high risk of Mg deficiency, high Mg intake has been linked to reduced risk of colorectal neoplasia, insulin resistance, metabolic syndrome, type 2 diabetes, and cardiovascular disease (CVD). Conversely, in populations not at high risk of Mg deficiency, high Mg intake has been related to increased risk of total mortality (e.g. total cancer, colorectal cancer, and CVD), particularly when calcium intake is low. These observations suggest that the associations between high Mg intake and disease risks may completely differ by the underlying Mg status. Due to major limitations, the Mg tolerance test is not used in conventional clinical practice and rarely used in research. Instead, serum Mg is used for clinical diagnosis. However, serum Mg performs very poorly at identifying those with Mg deficiency. There is a great need to develop implementable, sensitive, and specific biomarkers which can be easily used for identifying people with Mg deficiency. Without such a marker, it is impossible to develop effective strategies that minimize adverse effects by targeting those who, as a result of Mg deficiency, are at risk of common diseases. It is known that DNA methylation changes are inducible by environmental exposures, including nutrients, and reversible when the exposure disappears. There are two major types of cytosine modifications in DNA, 5-hydroxymethylcytosine (5-hmC) and 5-methylcytosine (5-mC). 5-mC is often associated with suppressed gene expression. 5-hmC, generated by the oxidation of 5-mC, is specifically enriched in expressed genes and plays a critical role in activating and/or maintaining gene expression. However, current epigenomic profiling platforms cannot distinguish 5-hmC from 5-mC. Just recently, our collaborator, Dr. Chuan He (HHMI Investigator), established a novel and state of the art technique, TAB-Seq and TAB-Array protocol, which can separate 5-hmC from 5-mC in the genome. Our pilot studies indicate that Mg intake or treatment significantly affects methylation capacity, 5-mC and 5-hmC biomarkers. Our findings suggest blood leukocyte 5-hmC/5-mC biomarkers may serve as more sensitive biomarkers to identify Mg deficiency than serum Mg. Thus, a comprehensive epigenome-wide association study (EWAS) may help to identify the most sensitive 5-hmC/ 5- mC biomarkers for Mg deficiency. We propose to identify 5-hmC/5-mC biomarkers for Mg deficiency by a 4- phase EWAS study in the "Personalized Prevention of Colorectal Cancer Trial [PPCCT, R01CA149633; PI, Dai and Yu]" with a total of 240 participants. Mg tolerance test will be used as the gold standard. Finally, using newly identified biomarkers, we will evaluate if 12-week Mg treatment reduces TRPM7 expression, essential in Mg homeostasis and colorectal carcinogenesis, in rectal tissues only among those with Mg deficiency.

  Study phs002037

• INCLUDE: The Epidemiology of Transient Leukemia in Newborns with Down Syndrome

  The INCLUDE (INvestigation of Co-occurring conditions across the Lifespan to Understand Down syndromE) Project is an NIH-wide collaboration that seeks to improve health and quality-of-life for people with Down syndrome. The INCLUDE Project Data Coordinating Center and partners created the INCLUDE Data Hub, a centralized data resource that allows access to large-scale clinical and multi-omics datasets specific to Down syndrome and supports collaborative, cloud-based analysis to accelerate scientific discoveries related to Down syndrome and its co-occurring conditions.Down syndrome (DS) is associated with a remarkably high risk of childhood acute myeloid leukemia (AML), with an approximately 500-fold increased risk of the rare subtype acute megakaryoblastic leukemia. Though largely treatable, a proportion of myeloid leukemia in DS (ML-DS) patients relapse with dismal survival. ML-DS is preceded by a preleukemia, transient abnormal myelopoiesis (TAM), which presents clinically at birth and is driven by somatic truncating mutations in the erythro-megakaryocytic transcription factor gene GATA1. Up to 15% of DS newborns have TAM, and this can be fatal in up to 20% of cases. A further 10-15% of newborns with DS harbor subclonal GATA1 mutations with clinically silent disease (i.e., Silent TAM). Of the DS newborns with either TAM or Silent TAM (i.e., transient leukemia), up to 15% will acquire additional somatic mutations and progress to ML-DS. We predict that germline variation modifies the risk of developing somatic truncating GATA1 mutations, the first step towards ML-DS, however this has yet to be examined. To address this, the main aim of this X01 study is to perform the first genetic association study of GATA1 mutations in DS, through whole-genome sequencing (WGS) of 470 DS newborns in the Oxford Down Syndrome Cohort Study (ODSCS). Targeted sequencing of GATA1 has already been performed in the 470 DS newborns in the ODSCS, with 130 (28%) confirmed to harbor a somatic truncating GATA1 mutation. We will perform a genome-wide association study (GWAS) of GATA1 mutations to assess genetic variation genome-wide, in particular focusing on variants in candidate genes on the trisomic chromosome 21, RUNX1, ERG, ETS2, and DYRK1A, which have previously been associated with upregulation of GATA1. We will also carry out a chromosome X-wide association study (XWAS) to investigate genetic variation at the GATA1 gene, which resides on chromosome X. WGS data will also enable us to assess the potential role of copy number variation in the risk of transient leukemia in DS. Discovering genetic risk factors for GATA1 mutations in DS may reveal targets for new targeted therapies for TAM, and also inform the etiology of ML-DS as well as AML in the non-DS population. Finally, the ODSCS includes rich phenotypic data for the 470 DS newborns, including clinical diagnosis of TAM and other hematologic complications, complete blood counts, maternal pregnancy complications, and information on congenital heart disease and other birth defects. Thus, whole genome sequencing data in DS newborns from the ODSCS will provide a rich resource for the DS research community.

  Study phs002982

• RNA Expression in Diverse Donor Derived Dermal Fibroblasts Correlates with Reprogramming to Pluripotency

  The cohort used in this study includes 36 African American (17 female, 19 male) and 36 White American (19 female, 17 male) individuals. The total cohort has a median age of 32 years, with a range of 20-64 years. The African American cohort has a median age of 34, with a range of 21-52 years. The White American cohort has a median age of 31, with a range of 20-64 years. Primary dermal fibroblast lines were derived from skin biopsies obtained from adult individuals at the NIEHS under institutional review board approved protocol human subjects 10-E-0063, "Sample Collection Registry for Quality Control of Biological and Environmental Specimens and Assay Development and Testing protocol" (ClinicalTrials.gov #NCT01087307). All participants gave written informed consent for tissue donation. Donor sex, age, and ancestry were voluntarily self-reported. Fibroblast cells were reprogrammed via lentiviral transduction using six transcription factors contained in three plasmids (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M). Reprogramming efficiency was determined by alkaline phosphatase staining of triplicate 10cm reprogrammed dishes containing colonies, which were then scanned. The saved images were analyzed with ImageJ 1.51h (Wayne Rasband, National Institutes of Health, USA) to count colonies, using color threshold adjusted and binary converted images of each dish. Triplicate plates were averaged and reported as colony counts or percent reprogramming efficiency ((# of colonies/250,000) x100). The African American cohort had reprogramming efficiencies ranging from 0.06-1.37%, with a median of 0.655%. The White American cohort had reprogramming efficiencies ranging from 0.02-1.13%, with a median of 0.455%. Our goal was to define transcriptomic heterogeneity that could be contributing to differences in reprogramming efficiency between individuals and between groups. Total RNA was obtained from dermal fibroblasts and matched iPSCs. For each sample, 500 ng total RNA was used as input for preparation of whole transcriptome rRNA depleted libraries. An adapter-ligated library was prepared with the KAPA HyperPrep Kit (KAPA Biosystems, Wilmington, MA) using Bioo Scientific NEXTflex™ DNA Barcoded Adapters (Bioo Scientific, Austin, TX, USA) according to KAPA-provided protocol. Sequencing was performed using an Illumina HiSeq 2500 following Illumina-provided protocols for 2x150 bp paired-end sequencing. Each transcriptome was sequenced to a target depth of 125 million reads. The following mean raw reads were obtained: African American dermal fibroblasts= 129,571,450; White American dermal fibroblasts= 131,939,505; African American iPSCs= 132,501,335; White American iPSCs= 134,394,164. Raw reads were aligned to hg19 using the STAR alignment tool (https://github.com/alexdobin/STAR). The following mean aligned reads were obtained: African American dermal fibroblasts= 123,315,343; White American dermal fibroblasts= 125,178,035; African American iPSCs= 123,148,312; White American iPSCs= 123,886,992. Reprinted from L. C. Mackey et al., Epigenetic Enzymes, Age, and Ancestry Regulate the Efficiency of Human iPSC Reprogramming. Stem Cells 36, 1697-1708 (2018), with permission from Wiley. Reprinted from L. S. Bisogno et al., Ancestry-dependent gene expression correlates with reprogramming to pluripotency and multiple dynamic biological processes. Science Advances 6 (47) (2020) (PMID: 33219026), with permission from AAAS.

  Study phs002341

• Treatment Options for Type 2 Diabetes in Adolescents and Youth (TODAY)

  The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) of the National Institutes of Health (NIH) has sponsored a consortium of investigators to conduct a clinical treatment trial, Treatment Options for type 2 Diabetes in Adolescents and Youth (TODAY). The primary objective of the TODAY trial is to compare the efficacy of three treatment arms on time to treatment failure based on glycemic control. The secondary aims are to:compare and evaluate the safety of the three treatment arms;compare the effects of the three treatments on the pathophysiology of type 2 diabetes (T2D) with regards to beta cell function and insulin resistance, body composition, nutrition, physical activity and aerobic fitness, cardiovascular risk factors, microvascular complications, quality of life, and psychological outcomes;evaluate the influence of individual and family behaviors on treatment response; andcompare the relative cost effectiveness of the three treatment arms.The three treatment regimens are: (1) metformin alone, (2) metformin plus rosiglitazone, and (3) metformin plus an intensive lifestyle intervention called the TODAY Lifestyle Program (TLP). The study recruits patients over a three-year period and follows patients for a minimum of two years. Patients are randomized within two years of the diagnosis of T2D.

  Study phs002447

• Genome Variation among HIV-Resistant People with Hemophilia

  Rare individuals are highly resistant to infection with human immunodeficiency virus (HIV). Studies of candidate genes resulted in the discovery of a 32bp deletion in the CC-chemokine receptor 5 gene (CCR5Δ32), which rendered this critical co-receptor for primary HIV infection to be non-functional. Pharmacologic and vaccine-induced blockade of CCR5 is being pursued to treat and prevent HIV infection and other conditions. The allele frequency of CCR5Δ32 among persons of European ancestry is approximately 10%. CCR5Δ32/Δ32 homozygotes are almost totally resistant to HIV infection. People with severe hemophilia A require frequent replacement with clotting Factor VIII (FVIII) to control hemorrhage. Prior to the discovery of HIV in 1984 and licensure of recombinant FVIII in the late 1980s, people with severe hemophilia A were treated with plasma-derived FVIII and thus were intensively exposed to HIV. Only 5% of such patients were not infected with HIV. Of these, approximately 1/3 were CCR5Δ32/Δ32 homozygotes. The remaining 2/3 of these people who were highly resistant to HIV remain unexplained. This project seeks to discover genome variations among people who are highly resistant to HIV infection. Such variation is likely to serve as a target for reducing the morbidity and incidence of HIV.

  Study phs000445

• Gene Expression Signatures Characterized by Longitudinal Stability and Inter-Individual Variability Delineate Baseline Phenotypic Groups with Distinct Responses to Immune Stimulation

  RNA sequencing (RNAseq) of peripheral blood lymphocytes was used to develop a means to assess immune function in a way that can be used in discovery science and applied to patients individually in clinical settings. The premise is that profiles of RNA present in immune cells is reflective of the combined influence of genetic and environmental variation on immune potential of individuals and that this potential can be tapped to understand human immunity in a variety of biological contexts. CD4+ cells were isolated from fresh whole blood via positive magnetic bead selection and cell lysates were prepared using Qiazol (QIAGEN) and stored at -80ºC for 3 to 8 months. RNA was extracted in batches for cDNA library preparation and RNA-Seq. For this study, we developed standard operating procedures for handling human blood samples and determined: a) the best way to enrich for CD4+ T cells from whole blood and yield high quality RNA, b) the sensitivity of this RNA profiling strategy, and c) the reproducibility of generated immune profiles from healthy subjects. We then developed bioinformatics processes to establish immune response signatures and immune response phenotypes within cohorts of individuals.

  Study phs001512

• Identification and Molecular Characterization of Somatic Mutations in Malformations of Cortical Development

  Genetic mutations causing disease may be inherited, newly acquired in parental gametes and present in the zygote or acquired as somatic events at some point in development after fertilization. The burden and localization of an acquired mutation depend on when the mutation arises. As is the case for inherited genetic variation, there is accumulating evidence that somatic mutations can lead to severe tissue-specific disease. Malformations of cortical development (MCD) represent a group of disorders characterized by a range of morphological and structural abnormalities of the cerebral cortex reflecting errors in embryonic cortical development. MCD are associated with intellectual disability, as well as refractory epilepsy, and may require the surgical removal of the affected tissue. Inherited gene mutations involved in neuronal development explain only a fraction of MCD cases. In this project we sought to evaluate the hypothesis that somatic mutations disrupt embryonic cortical development and are responsible for a substantial fraction of MCD. Using high coverage next generation sequencing of protein-coding regions in DNA extracted from abnormal brain tissue and unaffected tissue (leukocytes) from patients with three forms of MCD, we sought to identify somatic mutations within each patient with MCD. Exome sequence data from study participants are provided to facilitate research into the genetic underpinnings of MCD.

  Study phs002128

• TNF-induced dynamic regulation of mRNA stabilome in rheumatoid arthritis fibroblast-like synoviocytes

  During rheumatoid arthritis (RA), TNF activates fibroblast-like synoviocytes (FLS) inducing in a temporal order a constellation of genes, which perpetuate synovial inflammation. Although the molecular mechanisms regulating TNF-induced transcription are well characterized, little is known about the impact of mRNA stability on gene expression and the impact of TNF on decay rates of mRNA transcripts in FLS. To address these issues we performed RNA sequencing and genome-wide analysis of the mRNA stabilome in RA FLS. We found that TNF induces a biphasic gene expression program: initially, the inducible transcriptome consists primarily of unstable transcripts but progressively switches and becomes dominated by very stable transcripts. This temporal switch is due to: a) TNF-induced prolonged stabilization of previously unstable transcripts that enables progressive transcript accumulation over days and b) sustained expression and late induction of very stable transcripts. TNF- induced mRNA stabilization in RA FLS occurs during the late phase of TNF response, is MAPK-dependent, and involves several genes with pathogenic potential such as IL6, CXCL1, CXCL3, CXCL8/IL8, CCL2, and PTGS2. These results provide the first insights into genome-wide regulation of mRNA stability in RA FLS and highlight the potential contribution of dynamic regulation of the mRNA stabilome by TNF to chronic synovitis.

  Study phs001371

• National Eye Institute (NEI) Exfoliation Genotyping Study

  The overall goal of our research is to elucidate the pathogenesis of exfoliation syndrome and the associated glaucoma, making it possible to implement effective screening and prevention strategies and to develop novel therapies. Cases genotyped for this project are from the Nurses Health Study (NHS), the Health Professionals Follow-up Study (HPFS), the Women's Genome Health Study (WGHS), the Massachusetts Eye and Ear Infirmary (MEEI), Mayo Clinic, the University of Iowa, the University of Miami and Duke University Medical Center. Exfoliation syndrome (XFS) is a common condition that is a major risk factor for high-tension open-angle glaucoma, pre-mature cataract formation, and increased risk of complications during cataract surgery. Previous studies suggest that exfoliation syndrome and the related glaucoma (XFG) are genetically complex, and one gene, LOXL1, has been identified as a major genetic risk factor. LOXL1 variants are found in up to 98% of affected patients; however, these same variants are also present in up to 80% of unaffected individuals, indicating that additional genetic and/or environmental factors are necessary for disease development. Samples genotyped for this study are a case set (1,096 samples) and 24 pedigrees (98 samples). Controls for association analyses are selected from the NEIGHBORHOOD study.

  Study phs001053

• Longitudinal Study of Urea Cycle Disorders

  Individuals with Urea Cycle Disorders (UCD) cannot remove ammonia, a waste product, from the blood. The purpose of this study is to conduct a longitudinal investigation of the natural history, morbidity, and mortality in people with UCD. This study will look at how people with a UCD grow and develop over time and how often they get sick. The research questions are: What is the prevalence of specific morbid indicators of disease severity, including hyperammonemia, developmental disabilities, and various long-term kidney and liver effects? What is the fatality rate associated with the various forms of UCD? What are the correlations between various biomarkers and disease severity and progression? What is the safety and efficacy of currently used and new UCD therapies? This is a longitudinal study of individuals with urea cycle disorders. Those participating in this study will be evaluated every three to twelve months, depending age and time of diagnosis. Participants two years of age and younger that were diagnosed with UCD within the first four weeks of life will be evaluated every three months. Those who are over two years of age or were diagnosed after four weeks of age will be evaluated every six months. Participants older than 18 years of age will be evaluated once every year.

  Study phs000577

• Identification of Targetable FGFR Gene Fusions in Diverse Cancers

  In this study, patients with advanced cancer across all histologies were enrolled in our IRB approved clinical sequencing program, called MI-ONCOSEQ, to go through an integrative sequencing which includes whole exome sequencing of the tumor and matched normal, and transcriptome sequencing. Four index cases were identified which harbor gene rearrangements of FGFR2 including two cholangiocarcinoma cases, a metastatic breast cancer case, and a metastatic prostate cancer case. After extending our assessment of FGFR rearrangements across multiple tumor cohorts, including TCGA, we identified FGFR gene fusions with intact kinase domains of FGFR1, FGFR2, or FGFR3 in cholangiocarcinoma, breast cancer, prostate cancer, lung squamous cell cancer, bladder cancer, thyroid cancer, oral cancer, glioblastoma, and head and neck squamous cell cancer. All FGFR fusion partners tested exhibit oligomerization capability, suggesting a shared mode of kinase activation. Overexpression of FGFR fusion proteins in vitro induced cell proliferation, and bladder cancer cell lines that harbors FGFR3 fusion proteins exhibited enhanced susceptibility to pharmacologic inhibition in vitro and in vivo. Due to the combinatorial possibilities of FGFR family fusion to a variety of oligomerization partners, clinical sequencing efforts which incorporate transcriptome analysis for gene fusions are poised to identify rare, targetable FGFR fusions across diverse cancer types.

  Study phs000602

• Germline hypomorphic CARD11 mutations in severe atopic disease

  We described five patients from four unrelated families who had severe atopic dermatitis and susceptibility to mild skin viral infections. Some patients also exhibited other allergic symptoms such as asthma and food allergy. We performed targeted sequencing for affected patients A-I of family A and B-I of family B, whole exome sequencing for D-I, D-II.1 and healthy mother D-II.3 of family D, and whole genome sequencing for C-I and healthy mother C-II.2 of family C. We identified three different novel damaging missense mutations of CARD11 (GeneID:84433) in patients A-I (L194P), B-I (R975W), and C-I (E57D). In patients D-I and D-II.1, a dup183_196 (p.K196_V197insMKEERDSYNDELVK) mutation was found in the coil-coil domain of the protein. These mutations act as dominant negatives impeding the scaffolding function of the wild type protein, which leads to downstream NF-kB and mTORC1 signaling defects after TCR stimulation. Sanger sequencing later identified the corresponding CARD11 mutations in the affected family members (C-II.1, D-II.2) that are not included in the dbGaP submission. Hypomorphic CARD11 dominant negative mutants are novel causes of severe atopic disease.

  Study phs001369

• NHLBI TOPMed - NHGRI CCDG: Pakistan Risk of Myocardial Infarction Study (PROMIS)

  The Pakistan Risk of Myocardial Infarction (PROMIS) study is a retrospective multicenter case-control cohort study of individuals with and without coronary heart disease from Pakistan. Multiple biological samples have been collected from the participants including DNA, plasma, serum, and whole blood. The goal of the study is to recruit 20,000 cases and 20,000 controls of Pakistani descent. Eligible cases were individuals aged 30-80 who presented to the emergency department of a participating recruitment center in Pakistan with clinical symptoms consistent with a myocardial infarction (MI), ECG changes consistent with MI, elevated troponin levels consistent with MI, and no prior history of cardiovascular disease. Controls were individuals of Pakistani descent who did not have a self-reported history of cardiovascular disease. This site hosts data generated via NHLBI's TOPMed program and NHGRI's Common Disease Genomics (CCDG) program. Both whole exome and whole genome data are presented here, namely 4,211 whole genomes from TOPMed, 3,859 whole genomes from NHLBI supplemental funds, 1,136 whole genomes and 16,855 whole exomes from CCDG. Please note that there is additional legacy whole exome data (7,298 subjects) also generated via NHGRI funds as part of the MIGen Exome Sequencing project that can be found in dbGaP at phs000917.

  Study phs001569

• Imaging: Hispanic Community Health Study/Study of Latinos (HCHS/SOL)

  The Hispanic Community Health Study/Study of Latinos (HCHS/SOL) is a multi-center epidemiologic study in Hispanic/Latino populations to determine the role of acculturation in the prevalence and development of disease, and to identify risk factors playing a protective or harmful role in Hispanics/Latinos. The study is sponsored by the National Heart, Lung, and Blood Institute (NHLBI) and six other institutes, centers, and offices of the National Institutes of Health (NIH). The goals of the HCHS/SOL include studying the prevalence and development of disease in Hispanics/Latinos, including the role of acculturation, and identifying disease risk factors that play protective or harmful roles in Hispanics/Latinos. A total of 16,415 persons of Cuban, Dominican, Mexican, Puerto Rican, Central American, and South American backgrounds were recruited through four Field Centers affiliated with San Diego State University, Northwestern University in Chicago, Albert Einstein College of Medicine in the Bronx area of New York, and the University of Miami. Seven additional academic centers serve as scientific and logistical support centers. Study participants aged 18-74 years took part in an extensive clinic exam and assessments to ascertain socio-demographic, cultural, environmental and biomedical characteristics. Annual follow-up interviews are conducted to determine a range of health outcomes.

  Study phs003963

• Comprehensive gene analysis of colorectal cancer cases

  Colorectal cancer is the third most common morbidity and the fourth leading cause of cancer death in the world.To characterize the mutation profiles of colorectal cancer with liver metastasis,we performed both whole-exosome sequencing and RNA sequencing for 12 cases of colorectal cancer with liver metastasis (group A) and 16 cases of colorectal cancer without liver metastasis (group B). As a result of driver mutation search by Mutsig pipeline, PTEN was identified as a significant mutant gene in group A alone.ADAMTS10,NELL1 and RXFP3 were identified as candidate genes for metastasis by MuTect,SID and VarScan pipeline.Furthermore, in all samples, the copy number of chromosomes 1p,4,7,8,13,15, 17p,18,20 and 22q were significantly abnormal. Chromosomes 1p,4,15,18,17p,22q were deleted and chromosomes 7, 8,13 and 20 were amplified by CNV.Pathway analysed revealed Wnt/Ca2+ and PCP pathway was involved in metastasis of cl cancer.9 kinds of fusion genes were identified in deFuse pipeline. Among them, ADAP1 fusion genes were identified in 2 samples, and ADAP1 fusion genes were further identified in 3 samples by our in-house algorithm. It is suggested that new fusion genes present in such multiple samples may be involved in the development of colorectal cancer.

  Study JGAS000128

• Development of New Diagnostics, Therapeutics, and Prevention Methods for Personalized Medicine Based on Comprehensive Cancer-Related Gene Exome Analysis and Information Analysis Using Cancer Specimens Stored in TMDU Biobank.

  Biobanked tumor samples are a valuable resource in real-world solid tumor research. Panel-based genomic profiling enables the identification of clinically significant alterations that inform personalized diagnostic and treatment decisions. This study aimed to characterize the genomic landscape of solid tumors collected through the TMDU Biobank by summarizing mutational, copy number, and gene fusion alterations in a large and diverse patient cohort. This dataset contains summary-level genomic information from 1,996 tumor samples analyzed by ACT Genomics and ACT med using the ACTOnco Comprehensive 440-Gene Cancer Panel. Data provided includes (1) gene-level mutation counts, (2) a summary of copy number alterations, and (3) a summary of detected fusion events. Clinical attributes such as ICD-10 codes, age group, sex, tumor mutational burden (TMB), and microsatellite instability (MSI) status were included at the aggregate level. Summary statistics were generated from three source tables (gene, sample, and copy number data) using standardized processing rules. Due to contractual and ethical considerations, individual-level mutation locations and raw sequence data are not included; only summary-level information is provided. This dataset will support future research in tumor-type-specific genomic patterns, molecular characterization of solid malignancies, and precision oncology.

  Study JGAS000863

• The last addition to the list of clonal evolution studies in the EGA

  Tumours of different types may arise from a single cell with at least one malignant mutation. Accumulation of subsequent hits generates lineages of cells with different cancer transformation power; thus, every clone follows an autonomous evolution, and several clones may co-exist into the same solid or liquid tumour. Clonal evolution studies are not new: the conceptual power of this approach has been recognized since the early ’80, especially in leukaemia patients. Nonetheless, these studies greatly benefit from recent technological improvements -machineries and protocols-, which enable ever-increasing sequencing depth, allowing the detection of low frequency variants and consequently more tumour clones. Note: the figure belongs to the original paper and is owned by the authors. Researchers at the University of Kyoto in Japan, have indeed used state of the art knowledge to investigate the clonal evolution of chronic myeloid leukemia (CML) in a large panel of patients. CML progresses from a majoritarian benign chronic phase into an often fatal blast crisis phase. It is nowadays known that blast crisis are triggered by genetic instability and disrupted DNA repair, which lead to accumulation of DNA mutations. The use of thyrosine kinase inhibitors targeting the Philadelphia chromosome have enormously improved the treatment of blast crisis, nonetheless resistant patients are still a medical challenge. Yotaro Ochi and collegues used Whole Exome Sequencing of paired chronic phase and blast crisis samples to depict the genetic landscape of progression from the first to the second stage of the disease (as illustrated in their figure). Their results were published in Nature Communication on this May 2021. They used a dataset previously deposited at the EGA (EGAS00001003071) and their new generated data have been made available under accession number EGAS00001005075. Their analysis of the occurring mutations contribute to understanding the mechanisms of CML evolution and therefore develop a protocol for early management of patients with a TKI resistance signature. Up to date, the EGA hosts 99 clonal evolution studies, developed in several cancer types, including myeloma, renal carcinomas and ovarian cancer, in addition to various leukaemia subtypes, where this approach has been more widely applied and produced important results and seminal papers. From a pan-cancer point of view, the definition of tumour architecture through clonal evolution studies is instrumental to unravel the mechanisms of disease progression and treatment-resistance insource. At the EGA, we are honoured to contribute to exciting and important science advances with our service!

  Blog the-last-addition-to-the-list-of-clonal-evolution-studies-in-the-ega

• Ethiopia_Genome_Project__high_coverage_

  The Ethiopian area stands among the most ancient ones ever occupied by human populations and their ancestors. Particularly, according to archaeological evidences, it is possible to trace back the presence of Hominids up to at least 3 million years ago. Furthermore, the present day human populations show a great cultural, linguistic and historic diversity which makes them essential candidate to investigate a considerable part of the African variability. Following the typing of 300 Ethiopian samples on Illumina Omni 1M (see Human Variability in Ethiopia project, previously approved by the Genotyping committee) we now have a clearer idea on which populations living in the area include the most of the diversity.This project therefore aims to sequence the whole genome of 300 individuals at low (4-8x) depth belonging to the six most representative populations of the Ethiopian area to produce a unique catalogue of variants peculiar of the North East Africa. Furthermore 6 samples (one from each population) will also be sequenced at high (30x) depth to ensure full coverage of the diversity spectrum.The retrieved variants will be of great help in evaluating the demographic dynamics of those populations as well as shedding light on the migrations out of Africa.

  Study EGAS00001000237

• Biallelic mutations in the ubiquitin ligase RFWD3 cause Fanconi anemia

  The WD40-containing E3 ubiquitin ligase RFWD3 has been recently linked to the repair of DNA damage by Homologous Recombination (HR). Here we show that an RFWD3 mutation within the WD40 domain is connected to the genetic disease Fanconi anemia (FA). An individual revealed congenital abnormalities characteristic for FA. Cells from the patient, carrying the compound heterozygous mutations c.205_206dupCC and c.1916T>A in RFWD3, show increased sensitivity to DNA interstrand cross-linking agents in terms of increased chromosomal breakage, reduced survival and cell cycle arrest in G2 phase. The cellular phenotype is mirrored in genetically engineered human and avian cells by inactivation of RFWD3 or by introduction of the patient-derived missense mutation, and is rescued by expression of wildtype RFWD3 protein. HR is disrupted in RFWD3 mutant cells, caused by impaired relocation of mutant RFWD3 to chromatin and defective physical interaction with RPA. Rfwd3 knockout mice exhibit increased embryonic lethality, are sub-fertile, show ovarian and testicular atrophy and have a reduced life span in which they resemble other FA mouse models. Although mutation was detected in a single child with FA yet, we propose RFWD3 as a novel FA gene, FANCW, supported by cellular paradigm systems and an animal model.

  Study EGAS00001002440

• APOBEC3 mutagenesis drives therapy resistance in breast cancer

  Acquired genetic alterations commonly drive resistance to endocrine and targeted therapies in metastatic breast cancer, however the underlying processes engendering these diverse alterations are largely uncharacterized. To identify the mutational processes operant in breast cancer and their impact on clinical outcomes, we utilized a well-annotated cohort of 3,880 patient samples with paired tumor-normal sequencing data. The mutational signatures associated with apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3 (APOBEC3) enzymes were highly prevalent and enriched in post-treatment compared to treatment-naïve hormone receptor-positive (HR+) cancers. APOBEC3 mutational signatures were independently associated with shorter progression-free survival on antiestrogen plus CDK4/6 inhibitor combination therapy in patients with HR+ metastatic breast cancer. Whole genome sequencing (WGS) of breast cancer models and selected paired primary-metastatic samples demonstrated that active APOBEC3 mutagenesis promoted resistance to both endocrine and targeted therapies through characteristic alterations such as RB1 loss-of-function mutations. Evidence of APOBEC3 activity in pre-treatment samples illustrated a pervasive role for this mutational process in breast cancer evolution. The study reveals APOBEC3 mutagenesis to be a frequent mediator of therapy resistance in breast cancer and highlights its potential as a biomarker and target for overcoming resistance.

  Study EGAS50000000875

• Reconstructing oral cavity tumor evolution through brush biopsy

  Oral potentially malignant disorders (OPMDs) with genomic alterations have a heightened risk of evolving into oral squamous cell carcinoma (OSCC). Currently, genomic data are typically obtained through invasive tissue biopsy. However, brush biopsy is a non-invasive method that has been utilized for identifying dysplastic cells in OPMD but its effectiveness in reflecting the genomic landscape of OPMDs remains uncertain. This pilot study investigates the potential of brush biopsy samples in accurately reconstructing the genomic profile and tumor evolution in a patient with both OPMD and OSCC. We analyzed single nucleotide variants (SNVs), copy number aberrations (CNAs), and subclonal architectures in paired tissue and brush biopsy samples. The results showed that brush biopsy effectively captured 90% of SNVs and had similar CNA profiles as those seen in its paired tissue biopsies in all lesions. It was specific, as normal buccal mucosa did not share these genomic alterations. Interestingly, brush biopsy revealed shared SNVs and CNAs between the distinct OPMD and OSCC lesions from the same patient, indicating a common ancestral origin. Subclonal reconstruction confirmed this shared ancestry, followed by divergent evolution of the lesions. These findings highlight the potential of brush biopsies in accurately representing the genomic profile of OPL and OSCC, proving insight into reconstructing tumor evolution.

  Study EGAS50000000602

• Mutational Patterns in Metastatic Cutaneous Squamous Cell Carcinoma

  Cutaneous squamous cell carcinoma (cSCC) from the head and neck typically metastasizes to the lymph nodes of the neck and parotid glands. When a primary is not identified, they are difficult to distinguish from metastases of mucosal origin and primary salivary gland SCC. Ultraviolet radiation causes a mutation pattern that predominantly features cytosine to thymine transitions at dipyrimidine sites and has been associated with cSCC. In this study, we used whole genome sequencing data from 15 cSCC metastases and show that a UV signature mutation is pervasive across the cohort and distinct from mucosal SCC. The mutational burden was exceptionally high and concentrated in some regions of the genome, especially insulator elements (mean 162 mutations / Mb). We therefore evaluated the likely impact of UV-induced mutations on the dipyrimidine rich binding site of the main human insulator protein, CCCTC-binding factor (CTCF), and the possible implications on CTCF function and the spatial organization of the genome. Our findings suggest that mutation signature analysis may be useful in determining the origin of metastases in the neck and the parotid gland. Furthermore, UV-induced DNA damage to insulator binding sites may play a role in the carcinogenesis and progression of cSCC.

  Study EGAS00001003370

• Ethiopia_Genome_Project__low_coverage_

  The Ethiopian area stands among the most ancient ones ever occupied by human populations and their ancestors. Particularly, according to archaeological evidences, it is possible to trace back the presence of Hominids up to at least 3 million years ago. Furthermore, the present day human populations show a great cultural, linguistic and historic diversity which makes them essential candidate to investigate a considerable part of the African variability. Following the typing of 300 Ethiopian samples on Illumina Omni 1M (see Human Variability in Ethiopia project, previously approved by the Genotyping committee) we now have a clearer idea on which populations living in the area include the most of the diversity.This project therefore aims to sequence the whole genome of 300 individuals at low (4-8x) depth belonging to the six most representative populations of the Ethiopian area to produce a unique catalogue of variants peculiar of the North East Africa. Furthermore 6 samples (one from each population) will also be sequenced at high (30x) depth to ensure full coverage of the diversity spectrum.The retrieved variants will be of great help in evaluating the demographic dynamics of those populations as well as shedding light on the migrations out of Africa.

  Study EGAS00001000238

• The_Genomic_Advances_in_Sepsis__GAinS__RNA_seq

  Sepsis is defined as life-threatening organ dysfunction caused by a dysregulated host response to infection. This cohort comprises a subset of patients enrolled in the Genomic Advances in Sepsis (GAinS) study, an established biobank of adult sepsis patients. Patients with sepsis due to community acquired pneumonia or faecal peritonitis were recruited from 34 hospitals across the UK from 2005-2018, with samples for functional genomics and detailed clinical information collected on the first, third and/or fifth day following ICU admission. RNA was extracted from leukocytes isolated at the bedside using LeukoLOCK kits. We have previously identified sepsis response signatures (SRSs), transcriptomic endotypes that are associated with differential early mortality (Davenport et al, Lancet Respir Med, 2016; Burnham et al, AJRCCM, 2017) and response to treatment in a clinical trial (Antcliffe et al, AJRCCM, 2018). We generated RNA sequencing data on 903 samples, including 134 samples repeated from our previously released microarray data. Libraries were prepared using NEB Ultra II Library Prep kits (Illumina) and sequenced on a NovaSeq 6000. Reads were aligned to the reference genome (GRCh38) using STAR and gene counts quantified using featureCounts (annotation Ensembl v99). Counts were TMM-normalised and log-transformed. Following QC, processed data were available on 864 samples from 667 unique patients.

  Study EGAS00001003772

• This project aims to study human memory capacity, including short-term memory and long-term memory, systematically via genome-wide association studies

  Development of high-throughput genotyping platforms provides an opportunity to identify new genetic elements related to complex cognitive functions. Taking advantage of multi-level genomic analysis, here we studied the genetic basis of human short-term (STM, n=1,620) and long-term (LTM, n=1,526) memory functions. Heritability estimation based on single nucleotide polymorphism showed moderate heritability of short-term memory but very low heritability of long-term memory. In a two-step genome-wide association study, the markers rs13151012 and rs1558360 passed genome-wide significance (p < 5×10-8) in digit-span STM task and for the first principal component shared by two STM tasks; however, none of them survived the replication. In turn, we selected the ten most significant single nucleotide polymorphisms (SNPs) for replication tests. Among them, a SNP near ZFAT was significantly associated with STM performance in another independent population of 2,789; a polymorphism within BCAT2 was significantly associated with LTM in another independent population of 1,865. Furthermore, we performed a pathway analysis based on the current genomic data and found six pathways significantly associated with STM capacity and one pathway associated with LTM capacity.

  Study EGAS00001002875