10855 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 32.16 milliseconds.

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• WGS and RNA-Seq data from a GBM patient PT-PV2594

  WGS and RNA-Seq data from a GBM patient PT-PV2594

  Dataset EGAD00001008526

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• HV31 - De novo assembly of eight immune system regions

  De novo assembly of eight immune system regions for individual HV31, generated using a multi-platform pipeline. A full description of the generation of these assemblies can be found at https://doi.org/10.1101/2021.02.03.429586.

  Dataset EGAD00001007050

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Genome-Wide Association Study of Anorexia Nervosa (Price Foundation, Klarman Family Foundation, Center for Applied Genomics at the Children's Hospital of Philadelphia, Scripps Translational Sciences Institute Clinical Translational Science Award)

  Twin studies are consistent with substantial heritability in anorexia nervosa (AN), although detecting and confirming individual risk alleles has been difficult, due to small effects of single alleles and limited samples in prior studies. Methods: 1105 AN DNA samples obtained in a multisite study and 3733 pediatric patients of normal body weight were genotyped using the Illumina 610Q chip at The Center for Applied Genomics at The Children's Hospital of Philadelphia. Cases and controls were of European ancestry. Single nucleotide polymorphism (SNP) genotypes were subjected to quality control procedures, including elimination of SNPs with: call rates < 95%, minor allele frequency < 5%, and if Hardy-Weinberg equilibrium testing yielded p < 0.0001. Samples were removed if not of European ancestry or if showing cryptic relatedness. Eight AN DNA samples were deleted for low call rate, and 51 AN samples were deleted for cryptic relatedness. The statistical program, PLINK, was used to calculate a P value for each SNP passing quality control using the Cochran-Armitage trend test. The PennCNV program was used to define copy number variation (CNV). Results: We performed a genome-wide association study (GWAS) using with 1033 AN cases and 3733 controls (genomic inflation factor = 1.08). There were 11 SNPs with P<1X10-5 [(rsID, chromosome location, nearest gene, distance to nearest gene (base-pair), P value) rs6959888, 7q21.13, ZNF804B, 0, 1.63E-06; rs17725255, 20p11.23, CSRP2BP, 39396, 1.72E-06; rs10494067, 1p13.3, NTNG1, 0, 5.83E-06; rs2383378, 14q12, AKAP6, 0, 6.41E-06; rs410644, 5q14.1, SSBP2, 40462, 6.74E-06; rs4479806, 5p14.1, CDH9, 156926, 7.79E-06; rs957788, 13q33.3, FAM155A, 0, 8.11E-06; rs830998, 2q31.1, LRP2, 0, 8.68E-06; rs6782029, 3p25.3, VGLL4, 0, 9.04E-06; rs512089, 9p21.3, ELAVL2, 47984, 9.85E-06; rs3808986, 11q24.3, APLP2, 29217, 9.92E-6]. CNV analyses were performed on 1015 AN cases and 3532 controls. Overall frequencies of common or rare CNVs were similar between cases and controls. Specific rare and large (>500 kb, <1%) CNVs of interest included deletion of a large (~1.4Mbp) region of chr13q12 found in 2 AN samples and at a 10 fold lower frequency in a large sample (72,918) of subjects containing the genes SGCG, SACS, TNFRSF19, MIPEP, PCOTH, C1QTNF9B, SPATA13, MIR2276, and C1QTNF9, and an overlapping deletion and a duplication observed in 3 AN samples overlapping the CNTN6 and CNTN4 genes. Partially overlapping ~ 30 kb duplications were seen in 12 AN cases and in 1 control at the CDC5L gene on chromosome 6. Partially overlapping deletion of the 3' half of the PSTPIP1 gene was seen in 5 AN cases and no controls. Finally, a ~ 60 kb deletion of the PLEC1 gene was observed in 5 AN cases and in none of 3532 controls. Discussion: This is the first GWAS of AN. These preliminary results are consistent with absence of a major gene effect in AN. These results are consistent with genetic risk conveyed by multiple common alleles of small effect, as well as some uncommon CNVs of potentially larger effect. None of the implicated genes has a clear role in eating behavior. It must be emphasized that these results are preliminary and an additional ~ 400 AN cases will be analyzed as time and resources permit. These results require confirmation through study of independent populations of AN women.

  Study phs000679

• CIDR, NCI, NIDA Sequencing of Targeted Genomic Regions Associated with Smoking

  This study includes samples from two projects: Collaborative Genetic Study of Nicotine Dependence (COGEND; PI: Laura Bierut) and Genetic Study of Nicotine Dependence in African Americans (AAND; PI: Laura Bierut and Eric Johnson). The majority of the COGEND subjects included in the current study overlap with the two datasets already available on dbGaP. GWAS data are available for COGEND subjects through the Study of Addiction: Genetics and Environment (SAGE), dbGaP study accession phs000092. It should be noted that the case definition in the SAGE study is DSM-IV alcohol dependence. GWAS data are available for additional COGEND subjects through The Genetic Architecture of Smoking and Smoking Cessation, dbGaP study accession phs000404. The overall goal of this project is to apply deep sequencing to key genomic regions associated with nicotine dependence in order to accelerate the discovery of variation in molecular pathways that govern the development of nicotine dependence. The sample includes unrelated cases and controls of European American and African American descent. Cases are defined by a commonly used definition of nicotine dependence, a current score of 4 or more (maximum score of 10) on the Fagerstrom Test for Nicotine Dependence (FTND). Control status is defined as an individual who smoked at least 100 cigarettes during their lifetime, yet never became dependent (lifetime FTND<2). By selecting controls who smoked cigarettes, we focus on those genetic effects that are specific to the development of nicotine dependence. COGEND: COGEND was initiated in 2001 as a three-part program project grant funded through the National Cancer Institute (NCI; PI: Laura Bierut). The three projects included a study of the familial transmission of nicotine dependence, a genetic study of nicotine dependence, and a study of the relationship of nicotine dependence with nicotine metabolism. The primary goal was to detect, localize, and characterize genes that predispose or protect an individual with respect to heavy tobacco consumption, nicotine dependence, and related phenotypes and to integrate these findings with the family transmission and nicotine metabolism findings. The primary design was a community based case-control study. Nicotine dependent cases and non-dependent, smoking controls were identified and recruited from Detroit and St. Louis. More than 54,000 subjects aged 25-44 years were screened by telephone; more than 3,100 subjects were personally interviewed; and more than 2,900 subjects donated blood samples for genetic studies. AAND: AAND was initiated in 2009 to identify and characterize genetic determinants of nicotine dependence in a large African American population. Community-based recruitment of approximately 100,000 people was conducted to ascertain 1,000 African American nicotine dependent cases and 1,000 African American non-dependent, smoking controls. All subjects were between the ages of 25-44. Subjects were screened by telephone; if they qualified as a case or control, they completed the same interview that was used in COGEND and donated a blood sample. Both studies (COGEND and AAND) included measures of basic socio-demographic variables, including age, sex, race/ethnicity, family income, and educational attainment using the Semi-Structured Assessment for the Genetics of Nicotine Dependence. Information on nicotine dependence, as assessed by the Fagerstrom Test for Nicotine Dependence (FTND) is available for all subjects. In addition, participants also completed the Nicotine Dependence Syndrome Scale (NDSS; Shiffman et al., 2004) and the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68; Piper et al, 2004). All subjects were assessed in person by trained research assistants.

  Study phs000813

• National Cancer Institute (NCI) Adding Hispanics to Ongoing GWAS in Colorectal Cancer

  Genome-wide association studies (GWAS) of colorectal cancer (CRC) have been instrumental in identifying a number of common susceptibility loci in Non Hispanic (NH)-White populations, and a NCI priority is to extend GWAS findings to other populations to address racial/ethnic disparities in cancer susceptibility. Currently, GWA studies of CRC in NH-Whites, Japanese and African-Americans are ongoing. We propose a complementary study to address this critical research area in Hispanics. Hispanics represent the fastest growing ethnic population in the U.S. and have been largely understudied in terms of genetic susceptibility to cancer. There are noted differences in incidence, survival and mortality in CRC by ethnic/racial groups. Hispanics often present with CRC at a younger age and have a significantly greater incidence of stage IV tumors or metastatic disease compared to NH-Whites. We propose to conduct a large, cost-efficient, population-based GWAS in Hispanics by building upon existing NIH-funded resources, the Colon Cancer Family Registry (Colon CFR) and the Multiethnic Cohort Study (MEC). We plan to recruit 2,500 Hispanic men and women diagnosed with CRC between 01/2008 to present using cancer registries in California, physican referrals and familial referrals. Risk factor/diet questionnaires, pathology reports, Oragene saliva samples (for genotyping), optional blood samples (for genotyping and biometric analysis) and tumor blocks (for MSI testing) will be collected using methodologies developed in the Colon CFR/MEC. Cases of CRC in the MEC (currently 473; anticipated 600 at end) will also be included. Population-based Hispanic individuals without a diagnosis of CRC participating in other GWA studies in the MEC (n=3,900, U01HG004726, Haiman) will be used as controls. We will genotype all 3,100 cases using the Illumina 1M array and use available genotype and epidemiologic data collected on 3,900 controls. Our statistical analyses will include: single-SNP and haplotype effects, gene-environment interactions and heterogeneity by MSI, tumor subtype and family history of CRC. We will replicate findings in a second-stage using CRC cases and controls from Mexico (1,000 cases and 1,000 controls, EU FP7 funding, CHIBCHA, Carvajal-Carmona/Tomlinson). We will also examine heterogeneity of the risk estimates by ethnicity/race by leveraging GWA data on NH-Whites (2,142 cases, 1,909 controls, U01 CA122839, Casey), (4,000 cases, 6,000 NH-White controls, UK-CHIBCHA, Tomlinson), Colombians (2,000 cases and 2,000 controls, CHIBCHA), Japanese (1,000 cases and 1,000 controls) and African-Americans (1,500 cases and 1,500 controls, R01CA126895, Le Marchand). We will genotype replicated significant SNPs in our main and combined analysis in several Hispanic populations (note: studies funded by EU or NIH for data collection but not GWAS), including 800 Puerto Ricans, 2,000 Brazilians, 2,000 Argentineans and 3,000 Spanish/Portuguese, to assess generalizability of findings. We will examine the differences in inflammatory gene transcription dynamics in leukocytes (from blood sample collection) by fatigue level (as assessed from study questionnaire data). This study will have a high impact by addressing the key question of racial/ethnic disparities related to genetic susceptibility to CRC, will provide translational guidelines on biological mechanisms during the cancer survivorship period to increase quality of life among cancer survivors, and will enable further growth and investment into research among Hispanics by providing a resource of genetic data and biospecimens, which is lacking.

  Study phs001193

• Acute Respiratory Distress Network (ARDSNet) Studies 01 and 03 Lower Versus Higher Tidal Volume, Ketoconazole Treatment and Lisofylline Treatment (ARMA/KARMA/LARMA) (ARDSNet-ARMA/KARMA/LARMA-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Biospecimens Access to Biospecimens is through the NHLBI Biologic Specimen and Data Repository Information Coordinating Center (BioLINCC). Biospecimens from ARDSNet-ARMA/KARMA/LARMA include plasma, serum and urine. Please note that use of biospecimens in genetic research is subject to a tiered consent. Objectives The ARDS Network is a consortium of clinical centers and a coordinating center to design and test novel therapies for the treatment of Acute Lung Injury (ALI) and Acute Respiratory Distress Syndrome (ARDS). The primary objective of the KARMA trial was to investigate the efficacy and safety of Ketoconazole and Respiratory Management in the treatment of ALI and ARDS. The Ketoconazole arm of the study was later stopped due to an inability to show efficacy. Participants continued to be randomized to the respiratory management arms of the study (ARMA), which compared two ventilator strategies: a tidal volume of 6 mL/kg versus 12 mL/kg. The LARMA phase of the study investigated the efficacy of Lisofylline and Respiratory Management. Background Participants suffering from ARDS are extremely ill, require mechanical ventilation and, despite improvements in medical care and technology, had a mortality rate as high as 50 percent. An excessive inflammatory response is characteristic of ALI of which ARDS represents the most severe end of the pathophysiologic spectrum. The inflammatory response includes increased numbers of neutrophils activated to produce cytokines, proteases, and reactive oxygen intermediates. Pulmonary injury may also be enhanced by alveolar and tissue macrophages as a producer of vasoactive substances, neutrophil chemoattractants, and procoagulant substances. Ketoconazole, a synthetic antifungal imidazole, also has anti-inflammatory activities and may inhibit neutrophil recruitment via several different pathways known to be involved in the development of ALI and ARDS. Lisofylline causes a marked decrease in the circulating levels of the major oxidizable species of free fatty acids and also inhibits proinflammatory intracellular signaling. Mechanical ventilation in participants with ALI and ARDS have traditionally used tidal volumes of 10 to 15 ml per kilogram of body weight. These large tidal volumes are often necessary to achieve normal partial pressure of arterial carbon dioxide and pH, but may induce inflammatory responses through disruption of pulmonary epithelium and endothelium. Mechanical ventilation at lower tidal volumes may reduce injurious lung stretch and decrease the inflammatory response. Participants The Ketoconazole and Lisofylline trials were designed as 2 x 2 factorials and included 220 participants in each trial. A total of 860 participants were randomized into the ventilator management trial. Participants enrolled in the Lisofylline or Ketoconozole studies had to be concurrently enrolled in the ventilator management study and were first randomized into a ventilator strategy and then to drug or placebo. Conclusions Ketoconazole was found to be safe but did not reduce mortality, duration of mechanical ventilation, or improve lung function. Lisofylline was also found to be safe and to have no beneficial effect for participants with ALI or ARDS. Ventilation at lower tidal volumes resulted in reduced mortality and an increase in the number of days without ventilator support. (PMIDs: 10789668, 11902249, 10793162).

  Study phs003734

• Common Fund (CF) Genotype-Tissue Expression Project (GTEx)

  Lay Description The aim of the Genotype-Tissue Expression (GTEx) Project is to increase our understanding of how changes in our genes affect human health and disease with the ultimate goal of improving health care for future generations. GTEx will create a database that researchers can use to study how inherited changes in genes lead to common diseases. GTEx researchers are studying genes in different tissues obtained from many different people. The GTEx project also includes a study of the GTEx donor consent process - this study will help ensure that the consent process and other aspects of the project effectively address the concerns and expectations of participants in the study. GTEx is a pioneering project that uses state-of-the-art protocols for obtaining and storing a large range of organs and tissues, and for testing them in the lab. Until now, no project has analyzed genetic variation and expression in as many tissues from the same person in such a large population as planned for GTEx. Scientific Description Understanding the role of variation in the human genome is crucial to elucidating genetic contributions to human health and disease. Despite the results of genome-wide association studies (GWAS) documenting strong statistical associations between genetic variation and human traits, the functional role for most of these variants is largely unexplained. Nearly 90% of these GWAS-implicated sites lie outside of protein-coding sequences, suggesting that these variants might regulate gene expression. The goal of the Genotype-Tissue Expression (GTEx) project is to establish a resource database and tissue biobank in which to study the relationship between genetic variation and gene expression and other molecular phenotypes in reference/non-diseased tissues. The ultimate resource will include approximately 960 post-mortem donors with several dozen tissues from each, a resource large enough to study both cis- and trans- gene expression quantitative trait loci (eQTLs). Some tissue will also be banked for additional molecular analyses. To request biosamples, please see the Biobank page for more information. GTEx was initially funded as a 2-year pilot project by the NIH Common Fund (CF) in 2010, and has been scaled up after demonstration of feasibility. The project will collect and analyze RNA levels in many different human tissues and each donor will be characterized for germline genetic variation through dense genotyping arrays and sequencing of either whole exomes or whole genomes. By treating RNA expression levels as quantitative traits, eQTLs will be identified as sites containing genetic variation that correlate with changes in RNA expression. Such eQTLs have been associated with 4%-12% of expressed human genes, and with common complex human diseases, including obesity, atherosclerosis, type 2 diabetes, Crohn's disease, and asthma. Additionally, few studies have examined the tissue specificity of eQTLs. A subset of banked tissue samples will also be analyzed for other molecular phenotypes, such as DNA methylation, DNaseI hypersensitivity sites, and proteomics. The GTEx project will thus serve as a resource database and tissue bank for many future studies, especially for understanding the functional basis of inherited susceptibility to disease. All GTEx releases since Version 5 follow the NIH Genomic Data Sharing (GDS) Policy whereby there are no restrictions on use or publication after release. Additional information about the GTEx Data Release and Publication policy can be found on the GTEx Data Portal at www.gtexportal.org.

  Study phs000424

• Study on the Genetics of Alcoholism (COGA): African American Family GWAS

  COGA is a family study of alcoholism, in which the subjects have been drawn from the Collaborative Study on the Genetics of Alcoholism (COGA), a large, ongoing family-based study that includes subjects from seven sites around the US. COGA has gathered detailed, standardized data on study participants, including diagnostic and neurophysiological assessments. This project has already proved successful in identifying several genes that influence the risk for alcoholism and neurophysiological endophenotypes, which have been independently replicated. COGA data were included as part of two Genetic Analysis Workshops, and the phenotypes are familiar to the genetics community. Alcoholic probands were recruited from treatment facilities, assessed by personal interview, and after securing permission, other family members were also assessed. A set of comparison families was drawn from the same communities as the families recruited through an alcoholic proband. Assessment involved a detailed personal interview developed for this project, the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA), which gathers detailed information on alcoholism related symptoms along with other drugs and psychiatric symptoms. Many participants also came to the laboratories for electroencephalographic studies. Neurophysiological features that have been shown to be useful endophenotypes for which we have linkage and in some cases association results are included on a subset of the case-control sample: the beta power of the resting electroencephalogram (EEG), the P3(00) amplitude of the visual event-related potential (ERP), and the theta and delta event-related oscillations (EROs) underlying the P3. As part of COGA, a set of informative African American families were selected to have Genome-Wide Association data obtained within families. Genotyping was performed using the Illumina Omni2.5_080814_1 chip to genotype 3,438 subjects selected from densely affected families. Genotyping was performed at CIDR. This sample complements a set of densely affected European American families previously made available under dbGaP study accession phs000763. In addition, exome sequencing data on a subset of individuals with GWAS were added in version 2.For version 3, a subset had 30X Whole Genome Sequencing (WGS) as part of the NIDA Sequencing Initiative. The subset contained two distinct sets: Sibling pairs where one sibling had at least two dependence diagnoses in the set (alcohol, cannabis, cocaine, and opioid), and the other had none, and non-related Case-Control pairs matched for age and ethnicity where the cases had alcohol and at least 2 other dependence diagnoses and controls had none. After sequencing, some sibling pairs are re-classified as half siblings, Three VCF files (small variants, structural variants, and copy number variations) are provided. Additional substance abuse variables are made available in version 3. We note that the full sample data are deposited in four dbGaP submissions and the sequenced samples are split across all four: CIDR: Collaborative Study on the Genetics of Alcoholism Case Control Study (phs000125). GWAS data on cases (primarily probands) and controls drawn from the families. Families with highest density of alcohol dependence and/or extreme event-related oscillation data (phs000763). GWAS data on 119 extended families of European descent are available here, along with extensive documentation. Study on the Genetics of Alcoholism (COGA): African American Family GWAS (phs000976). GWAS data on all available COGA families of African descent are available. COGA: Smokescreen GWAS (phs001208). GWAS data on all remaining COGA DNA samples, primarily of other racial background, were genotyped on the Smoke Screen array. A listing of all sequenced pairs is provided in the documentation to facilitate the merging of these samples.

  Study phs000976

• Knoll et al.: The life-saving benefit of dexamethasone in severe COVID-19 is linked to a reversal of monocyte dysregulation

  Following the demonstration of its life-saving effect in clinical trials, dexamethasone quickly became standard-of-care in the treatment of severe COVID-19. Beneficial effects were reported for patients requiring supplemental oxygen or invasive mechanical ventilation. Yet, a substantial proportion of patients still progressed to a critical condition or succumbed to the disease, despite timely initiation of glucocorticoid treatment. No molecular or cellular correlate of this beneficial treatment response has been defined. Here, we identify distinct cellular and molecular changes in circulating immune cells in patients with COVID-19 elicited in response to dexamethasone treatment. The most profound transcriptional changes in response to dexamethasone treatment were noted in monocytes and in B cells. In monocytes, we observed a reversal of hallmark signatures previously associated with COVID-19 severity, and the induction of a specific monocyte substate enriched in glucocorticoid response gene expression which we here refer to as dexamethasone response cluster. Molecular responses to dexamethasone treatment were directly linked to clinical outcome, since the reversal of pathogenic signatures and induction of glucocorticoid response genes were enriched in patients who survived the disease in response to dexamethasone treatment. Cellular responsiveness of circulating monocytes was thus identified as a correlate of clinical response to dexamethasone treatment. Changes in monocyte transcriptomes could also be linked to epigenetic alterations highlighting early differences in monocytes of dexamethasone responders and non-responders. Further, monocyte single-cell transcriptome-derived signatures were enriched in whole blood transcriptomes from patients with fatal outcome in two independent cohorts, highlighting the potential clinical value for early identification of non-responders who are refractory to dexamethasone treatment. Overall, our findings indicate that the life-saving effects of dexamethasone in COVID-19 patients are linked to a specific immunomodulatory effect based on the reversion of monocyte dysregulation. Our study elucidates the potential mechanism of action of one of the most efficient and cost-effective drugs for the treatment of COVID-19. It further highlights the potential of single-cell omics for monitoring target engagement of immunomodulatory drugs and for the stratification of patients for precision medicine approaches.

  Study EGAS00001007461

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - RNAseq

  Ependymomas (EPN) are the third most common malignant brain cancer in children. Treatment strategies for pediatric EPN have remained unchanged over recent decades, with 10-year survival rates stagnating at just 67% for children aged 0-14 years. Moreover, patients who survive treatment for the most common subtype of pediatric EPN (posterior fossa A (PFA)), often suffer long-term neurological side effects as a result of therapy. It is evident that there is a need for safer, more effective treatments for pediatric EPN patients. There are ten distinct subgroups of EPN, each with their own molecular and prognostic features. To identify and facilitate the testing of new treatments for EPN, in vivo laboratory models representative of the diverse molecular subtypes are required. Here, we describe the establishment of a patient-derived orthotopic xenograft (PDOX) model of PFA EPN, derived from a metastatic cranial lesion. Patient and PDOX tumors were analyzed using immunohistochemistry, DNA methylation profiling, whole genome sequencing (WGS) and RNA sequencing. Both patient and PDOX tumors classified as PFA EPN by methylation profiling, and shared similar histological features consistent with this molecular subgroup. RNA sequencing revealed that gene expression patterns were maintained across the primary and metastatic tumors, as well as the PDOX. Copy number profiling revealed gains of chromosomes 7, 8 and 19, and loss of chromosomes 2q and 6q in the PDOX and matched patient tumor. No clinically significant single nucleotide variants were identified, consistent with the low mutation rates observed in PFA EPN. Overexpression of EZHIP RNA and protein, a common feature of PFA EPN, was also observed. Despite the aggressive nature of the tumor in the patient, this PDOX was unable to be maintained past two passages in vivo. Others who have successfully developed PDOX models report some of the lowest success rates for EPN compared to other pediatric brain cancer types attempted, with loss of tumorigenicity not uncommon, highlighting the challenge in propagating these tumors in the laboratory. Here, we discuss our collective experiences with PFA EPN PDOX model generation and propose potential approaches to improve future success in establishing preclinical EPN models

  Study EGAS00001006844

• UK Biobank whole cohort directly genotyped and imputed data (~500,000 participants)

  Genotype data is available for all 500,000 participants in the UK Biobank cohort. Genotyping has been performed using the Affymetrix UK BiLEVE Axiom array on an initial 50,000 participants and the remaining 450,000 participants have been genotyped using the Affymetrix UK Biobank Axiom® array. The two arrays are extremely similar (with over 95% common content).Quality control and imputation (to over 90 million SNPs, indels and large structural variants) has been performed by a collaborative group headed by the Wellcome Trust Centre for Human Genetics.The following data are available:* A clean set of QC’ed genotype calls* Confidence values that a genotype call is correct* Intensity data to generate cluster plots* Extensive QC information regarding SNPs and samples including SNP metrics, batch effects, population structure and relatedness* Imputed dataFor further information, please refer to the UK Biobank website

  Study EGAS00001002399

• Whole Genome Association Study of Bipolar Disorder

  The goal of the project is to identify genes that make individuals more susceptible to bipolar disorder (manic depressive illness) and to better understand the brain pathways involved in the disease. Dataset versioning Version 1: European-American (EA) ancestry only Version 2: Version 1 plus African-American (AA) ancestry Version 3: EA and AA samples plus updated diagnostic criteria Consent groups and participant set General research use (GRU): 1767 controls (1081 EA controls, 686 AA controls) This consent group includes all controls for the Bipolar study, which are a subset of controls for the Schizophrenia study (subset of Schizophrenia: GRU). Bipolar and related disorders (BARD): 841 cases (691 EA cases, 150 AA cases) This consent group includes a subset of the Bipolar cases. Bipolar disorder only (BDO): 653 cases (388 EA cases, 265 AA cases) This consent group includes a subset of the Bipolar cases.

  Study phs000017

• Center for Common Disease Genomics [CCDG] - Cardiovascular ATVB: Atherosclerosis Thrombosis and Vascular Biology

  Italian Atherosclerosis Thrombosis and Vascular Biology study is a prospective, nationwide, case-control study involving 125 coronary care units in Italy. The cases were patients who were hospitalised for a first MI before the age of 45 years and underwent coronary angiography. Acute MI was defined as resting chest pain lasting more than 30 minutes, accompanied by persistent electrocardiographic changes, and confirmed by an increase in total creatine kinase or in the MB fraction to more than twice the upper normal limits. The controls were healthy subjects without a history of thromboembolic disease who were unrelated to the patients, but individually matched with them by age, gender and geographical origin. They were enrolled from among the blood donors or staff of the same participating hospitals. Recruitment of cases and controls took place between 1994 and 2007. This site hosts data from ~60 whole exomes.

  Study phs001592

• HuBMAP: KULMAP - Human Kidney, Urinary Tract, and Lung Mapping Center

  The major goal of the Human Kidney, Urinary Tract, and Lung Mapping Center (KULMAP) is to generate multi-omic and spatially resolved molecular anatomical maps of the human bladder, ureter and kidneys (BUKMAP) and the lung airways and parenchyma (LAPMAP) at a single cell resolution. This entails sequencing of the transcriptomes and epigenomes of dissociated single cells in a massively parallel manner. These profiles will then inform on highly multiplexed RNA in situ imaging for spatial mapping of hundreds of molecular targets in the tissue sections, at a subcellular resolution. These spatial molecular maps will serve as scaffolds for computational registration of cell types and the associated transcriptome/chromatin maps to the tissue space. The combination of sequencing single dissociated cells and multiplexed in situ mapping will allow the construction of detailed spatial maps for these large organs.

  Study phs002249

• Rapid Acceleration of Diagnostics - Digital Health Technologies (RADx-DHT): NIH Digital Health Solutions for COVID-19: IBM Covid19 Contact Tracing and Data Exchange Tools

  The goal of this project is to develop both contact tracing and secure data exchange tools. The contact tracing solution securely combines data from a variety of sources (including manual self-report data and mobile device surveys) to enable tracing of contacts with individuals that have tested positive for COVID-19 or have been exposed to COVID-19. The data exchange solution is a secure mechanism that empowers users to control the data they share in the course of their return to work, including the ability to provide a verifiable health status claim. These tools are being used by an employer to evaluate the risk of allowing individuals to return to normal activities, and also the ability to trace user contact with individuals diagnosed with or suspected of having contracted COVID-19. DOI: https://rapids.ll.mit.edu/10.57895/h0an-m559

  Study phs002516

• Breast Cancer Susceptibility

  Genetic factors account for a large fraction of breast cancer risk and it is estimated that up to 30% of breast cancers have a heritable component. Inherited cancer susceptibility is associated with early-onset of malignancies in general. Although 20% of young women with breast cancer have germline mutations in the best understood breast cancer susceptibility genes, BRCA1, BRCA2 and TP53, in the remaining 80% of women with early-onset breast cancer, the genetic factors contributing to disease remain unexplained. By studying the extreme phenotype of women diagnosed at an early age there is enrichment for genetic factors that contribute to breast cancer. This study contains the whole exome sequence of 384 women diagnosed with invasive breast cancer prior to 40 years of age. Each of the subjects reported a family history of breast cancer and lacked mutations in BRCA1 and BRCA2.

  Study phs001017

• Deciphering Maternal-Fetal Crosstalk in the Human Placenta During Parturition Using Single-Cell RNA-Sequencing

  Labor is a complex physiological process requiring a well-orchestrated dialogue between the mother and fetus. However, the cellular contributions and communications that facilitate maternal-fetal crosstalk in labor have not been fully elucidated. In this latest version (#5), scRNA-seq was applied to decipher maternal-fetal signaling in the human placenta and chorioamniotic membranes during term labor. Samples were obtained from women who underwent spontaneous labor (n = 24) or who were delivered in the absence of spontaneous labor (n = 18) at term. Samples from previous versions (#1-3) of this study include the placental villous tree, basal plate, and chorioamniotic membranes of women across a range of pregnancy physiologic and pathologic conditions, including the processes of labor (term labor and preterm labor), and COVID-19 (version #3). Version #4 includes samples from the human myometrium during spontaneous term labor.

  Study phs001886

• Study of Adaptation to Hypoxia in Ethiopian Highlanders via Whole Genome Sequencing

  Although it has long been proposed that genetic factors contribute to adaptation to high altitude, such factors remain largely unverified. Recent advances in high-throughput sequencing have made it feasible to analyze genome-wide patterns of genetic variation in human populations. Since traditionally such studies surveyed only a small fraction of the genome (either exons or a subset of SNPs) or a group of candidate genes, interpretation of the results was limited. We focused our study on Ethiopian highlander populations, which have been found to be well adapted to high altitudes (~3500m). We sequenced and analyze the genomes of 13 high altitude native Ethiopians: 6 individuals of Oromo heritage living on Bale Plateau (labeled "Oromos"), and 7 individuals residing on the Chennek field in the Simien Mountains (labeled "Amhara"). Our study revealed evolutionarily conserved genes that modulate hypoxia tolerance.

  Study phs000647

• Genome-Wide Analysis of Splenic Marginal Zone Lymphoma

  Splenic Marginal Zone Lymphoma (SMZL) is a B-cell malignancy of unknown pathogenesis and thus orphan of targeted therapies. By integrating whole-exome sequencing and copy-number analysis of 8 paired tumor-normal DNAs from patients with SMZL, we show that the typical SMZL exome carries ~30 genetic alterations. Targeted resequencing of selected candidates in an extended panel of 40-117 samples revealed activating mutations of NOTCH2, a gene required for marginal-zone (MZ) development, as the most frequent and SMZL-specific lesion, accounting for approximately 20% of cases. Additional altered genes suggest that deregulation of signaling pathways normally involved in MZ development (NOTCH, NF-kappa B, and B-cell receptor) represents a critical event in SMZL pathogenesis. These findings have direct implications for the treatment of SMZL patients since drugs are available which can target NOTCH as well as other pathways deregulated in this disease.

  Study phs000502

• DAXX restoration suppresses alternative lengthening of telomeres in ATRX wild-type cells

  Many tumors maintain chromosome ends through a telomerase-independent, homologous recombination based mechanism called alternative lengthening of telomeres (ALT). While ALT occurs in only a subset of tumors, it is strongly associated with mutations in the genes encoding components of the histone H3.3 chaperone complex, ATRX and DAXX. To date the mechanistic role of ATRX and particularly DAXX mutations in potentiating ALT remains poorly understood. We identify an osteosarcoma cell line, G292, with a unique chromosomal translocation resulting in loss of DAXX function, while retaining functional ATRX. Using this distinctive resource, we demonstrate that introduction of wild type DAXX suppresses the ALT phenotype and restores localization of the ATRX/DAXX complex to PML bodies. This provides the first direct molecular evidence that ongoing DAXX deficiency is essential for maintenance of the ALT phenotype and highlights the potential for therapeutic targeting of this oncogenic pathway.

  Study phs001495

• Massachusetts General Hospital (MGH)/Broad Hurthle cell carcinoma whole exome sequencing study

  In this study, we performed whole-exome sequencing of 41 patients with Hurthle cell carcinoma, a thyroid cancer variant with abundant mitochondria. We were able to identify recurrent somatic mutations in both the nuclear and mitochondrial genomes of Hurthle cell carcinoma. Our study identifies mutations in DAXX (GeneID: 1616), TP53 ( GeneID:7157), NF1(GeneID:4763) , NRAS (GeneID:4893), CDKN1A (GeneID:1026), ARHGAP35 (GeneID:2909), the TERT (GeneID:7015) promoter, and mitochondrial-encoded complex I genes to be candidate driver events in Hurthle cell carcinoma. Furthermore, copy number analysis revealed widespread chromosomal losses, resulting in loss-of-heterozygosity and a near-haploid state, to be a defining feature of these tumors. Finally, by analyzing locoregional recurrences and metastases, we were able to identify that widespread chromosomal losses and mitochondrial complex I mutations appear to be early driver events that are selected during clonal evolution.

  Study phs001580

• National Heart, Lung, and Blood Institute SNP Health Association Asthma Resource Project (SHARP)

  SNP Health Association Resource (SHARe) Asthma Resource project (SHARP) is conducting a genome-wide analysis in adults and children who have participated in National Heart, Lung, and Blood Institute's clinical research trials on asthma. This includes 1041 children with asthma who participated in the Childhood Asthma Management Program (CAMP), 994 children who participated in one or five clinical trials conducted by the Childhood Asthma Research and Education (CARE) network, and 701 adults who participated in one of six clinical trials conducted by the Asthma Clinical Research Network (ACRN). There are three study types. The longitudinal clinical trials can be subsetted for population-based and/or case-control analyses. Each of the childhood asthma studies has a majority of children participating as part of a parent-child trio. The ACRN (adult) studies are probands alone. Control genotypes will be provided for case-control analyses.

  Study phs000166

• National Human Genome Research Institute Tumor Sequencing Project (TSP) - Lung Adenocarcinoma

  The Tumor Sequencing Project (TSP) Consortium is a collaboration among participants at the Baylor College of Medicine Human Genome Sequencing Center, the Broad Institute Genome Sequencing Platform, the Dana Farber Cancer Institute, the Memorial Sloan-Kettering Cancer Center, the Genome Sequencing Center and Siteman Cancer Center at Washington University, the M.D. Anderson Cancer Center and the University of Michigan Medical Center. The TSP Part A will pilot approaches to large-scale identification of genomic changes in tumors by sequencing the exonic regions of 623 genes in 188 specimens of adenocarcinoma of the lung, as well as using high density SNP genotyping arrays for high resolution identification of changes in chromosomal copy number. The TSP Part B will pilot approaches to tumor characterization of lung adenocarcinoma samples using next-generation sequencing technologies and benchmark those results against Part A data generated with ABI3730 instruments.

  Study phs000144