12254 results for "fc coins kopen ps4 Besuche die Website Buyfc26coins.com. Coins in Minuten da..Gidj"

in 22.31 milliseconds.

• The_British_Autozygosity_Populations_BioResource

  This data set contains whole exome sequences of individuals with self-stated parental relatedness from the East London Genes & Health cohort. Rare frequency functional variants in these healthy individuals will be studied with respect to the genetic health of the participants and loss-of-function analysis of human genes. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001002742

• Exploring_the_landscape_of_somatic_mutations_in_normal_tissue___BD___WGS

  The aim of this project is to investiagte somatic mutations, including rates of mutations and signatures, and clonal dynamics in normal (non-cancerous) human tissues from the biliary tree. The project will involve the studyof normal tissues from healthy individuals and those with specific candidate diseases. We are utilising laser capture microscopy to idnetifiy and isolate specific cell populations which are then subjected to whole genome sequencing to estimate mutational burdens and begin to understand clonal structures across the normal tissues.

  Study EGAS00001003014

• Exploring_the_landscape_of_somatic_mutations_in_normal_tissue___GI___TPS___WGS

  The aim of this project is to investigate somatic mutations, including rates of mutations and signatures, and clonal dynamics in normal (non-cancerous) human tissues from the gastrointestinal tract. The project will involve the study of normal tissues from healthy individuals and those with specific candidate diseases. We are utilising laser capture microscopy to identify and isolate specific cell populations which are then subjected to whole genome sequencing to estimate mutational burdens and begin to understand clonal structures across the normal tissues.

  Study EGAS00001003089

• The WID-CIN test identifies women with, and at risk of, cervical intraepithelial neoplasia grade 3 and invasive cervical cancer (CIN3+)

  We analysed DNA methylation at >850,000 CpG sites across the genome using the Illumina EPIC array in a total of 1,254 cervical liquid-based cytology samples from cases of screen-detected histologically verified CIN1-3+ (98% hrHPV-positive) and population-based control women free from any cervical disease (100% hrHPV-positive). We developed the WID-CIN-test which is a DNA methylation signature consisting of 5,000 CpG sites.

  Study EGAS00001005078

• Whole genome sequencing of multiple myeloma identifies novel structural and non-coding mutations.

  The coding region of the myeloma genome is well understood with key mutations having been identified. However, the non-coding regions of the myeloma genome are yet to be analyzed. Here we have performed whole genome sequencing of myeloma patient samples to identify structural abnormalities including chromothripsis and chromoplexy, as well as gene dysregulation through super-enhancer juxtaposition with key oncogenes. We have also identified non-coding region hotspots of mutation, especially in promoter regions, that affect gene expression.

  Study EGAS00001003164

• Molecular analysis of FIT interval colorectal cancers

  To optimize a fecal immunochemical test-based screening program, the rate of missed colorectal cancers (CRCs), so-called FIT-interval CRCs, should be minimized. A specific molecular make-up of those CRCs could be an explanation for those interval CRCs. Knowledge of the molecular make-up of these missed lesions could facilitate more accurate detection of all precursor lesions. In this study we aimed to compare the molecular make-up of FIT-interval CRCs and screen-detected CRCs (SD-CRCs).

  Study EGAS00001004683

• scRNAseq of human primary nasal epithelium differentiated at air-liquid interface exposed to SARS-CoV2

  The nasal epithelium is a plausible entry point for SARS-CoV-2, a site of pathogenesis and transmission, and may initiate the host response to SARS-CoV-2. Antiviral interferon responses are critical to outcome of SARS-CoV-2. Yet little is known about the interaction between SARS-CoV-2 and innate immunity in this tissue. Here we applied single-cell RNA sequencing and proteomics to a primary cell model of human primary nasal epithelium differentiated at air-liquid interface.

  Study EGAS00001005633

• Transcriptome profiling of three giant cell tumour of bone cell lines

  Transcriptome profiling of three established giant cell tumour of bone (GCTB) cell lines on the BGISEQ-500 platform (PE100). Cell lines consist of neoplastic "stromal" cells harboring a heterozygous H3F3A p.G34W mutation. Data was used in a study (Venneker et al., Histone deacetylase inhibitors as a therapeutic strategy to eliminate neoplastic “stromal” cells from giant cell tumors of bone, 2022) to determine H3F3A-WT/MT expression ratios, to identify pathogenic variants, and to examine the expression levels of epigenetic modifiers and regulators.

  Study EGAS00001006441

• Characterization of MCSP+ melanoma DCC and MelDCC lines

  To dissect the sequence of genotypic and phenotypic progression during early metastatic colonization, we searched for the earliest detectable disseminated cancer cells (DCC) and identified MCSP+ melanoma cells as strong candidates for metastasis founder cells (MFC) in lymph nodes. We isolated MCSP+ DCC from various stages of metastatic colony-formation, performed scRNA-seq and unravelled their phenotypic progression. Further we performed bulk sequencing on patient-derived DCC models (MelDCC) and showed that they exhibit an immunosuppressive activity on CD8 T cells.

  Study EGAS00001006702

• Human pan-cancer plasma cfRNA study - raw data

  This study contains mRNA capture sequencing data from plasma of 266 different human donors. The first, pan-cancer, cohort covers 25 high-grade to metastatic cancer types (8 cancer patients per type) and a control group (8 healthy donors). The validation cohort comprises additional plasma samples from ovarian, prostate and uterine cancer patients (12 per type) as well as additional samples from controls (22 new and 8 repeated). Samples were sequenced on a NovaSeq 6000 and are provided in FASTQ format.

  Study EGAS00001006755

• Whole Genome Sequencing Data of High Grade Serous Ovarian Cancer

  Longitudinal whole genome sequencing data to study chemoresponse in ovarian cancer. These samples belong to an ongoing sample collection and the data already includes hundreds of samples from over 200 patients. Samples are from primary and metastatic tissues and ascites. All patients have been treated with platinum-taxane based chemotherapy and majority of them are diagnosed with high-grade serous ovarian cancer.

  Study EGAS00001006775

• This study aims to evaluate the relationship between cardiometabolic risk factors and the most common genetic variation (SNPs)

  Comprehensive data on lifestyle-related modifiable factors, sociodemographic, anthropometric, economic, biochemical, and genetic markers related to the occurrence of cardiometabolic diseases as part of the observational cross-sectional survey “2015 Health Survey of Sao Paulo with Focus on Nutrition (2015 ISA-Nutrition)”, a population-based study. Data of 805218 SNPs for 841 individuals was genotyped using the Axiom™ 2.0 Precision Medicine Research Array in the Thermo Fisher Scientific laboratory (Affymetrix Inc, Santa Clara, CA).

  Study EGAS00001007818

• Cold Ischemia Study

  This study aimed to evaluate the impact of cold ischemia time on the expression of cancer-related genes, particularly those involved in hypoxia, apoptosis, and epithelial-to-mesenchymal transition (EMT). We performed RNA sequencing on 54 normal colon mucosa samples from nine patients undergoing colorectal cancer surgeries, freezing samples at predefined intervals ranging from 0 to 60 minutes. A total of 44 differentially expressed genes (DEGs) (p < 0.05) were identified when comparing samples frozen immediately (T0) with those frozen after 60 minutes (T5).

  Study EGAS00001008233

• Guardians of the genome: protecting DNA from endogenous sources of damage

  Mutational signatures are imprints of cell-intrinsic and extrinsic pathophysiological processes that have occurred through tumorigenesis. Experimental efforts to explore signature etiologies have produced a compendium of signatures of exogenous mutagens previously. Here, we unearth major sources of endogenous DNA damage and the genes that are critical to mitigating this innate stream of DNA damage under normal, physiological circumstances. We performed whole genome sequencing of 173 subclones of CRISPR-Cas9 knockouts of 43 genes in a human induced pluripotent stem cell system, in the absence of any added DNA damage. We reveal substitution and indel signatures that arise from those genes which are essential guardians of the genome. By detailed dissection and comparisons to cancer-derived signatures, we demonstrate interminable sources of constitutive DNA damage, and some mechanistic knowledge into how guardian genes preserve the genome. Based on these experimental insights, we develop and benchmark a tool for clinical classification of tumor samples.

  Dataset EGAD00001006055

• RNA-Seq dataset for Genomic rearrangements in Pediatric Cancer

  RNA-Seq data for systematic gene fusion detection in Pediatric Cancer

  Dataset EGAD00001008152

• Targeted DNA panel sequencing analysis of PanNEN tumors of varying grades using custom and commercial panels

  Targeted panel sequencing data from PanNEN samples. Sample ID is annotated in the following manner: each patient is given a number and "P" is appended to the patient number if it is a primary tumor, "M” if it is metastasis and "N" if it is normal (healthy tissue) sample. All NETG1 and NETG2 samples underwent panel sequencing using a custom panel (in-house PanNEN panel). All NEC and NETG3 samples (except PNET2, PNET77P and PNET77M) underwent panel sequencing using a commercial CCP panel.

  Dataset EGAD00001008432

• Prediction of HLA genotypes using NGS data

  High-precision human leukocyte antigen (HLA) genotyping is crucial for anti-cancer immunotherapy, but existing tools predicting HLA genotypes using next-generation sequencing (NGS) data are insufficiently accurate. We compared the availability and accuracy of eight HLA genotyping tools (OptiType, HLA-HD, PHLAT, seq2HLA, arcasHLA, HLAscan, HLA*LA, and Kourami) using 1,275 cases from the 1000 Genomes Project data and created a new HLA-genotyping algorithm combining tools. Then, we assessed the new algorithm’s performance in 39 in-house samples with normal whole-exome sequencing (WES) data and polymerase chain reaction–sequencing-based typing (PCR-SBT) results.

  Dataset EGAD00001007733

• scEC&T-seq manuscript data

  This dataset includes all data produced in the study describing "scEC&T-seq", a method for parallel sequencing of extrachromosomal circular DNA and transcriptome in single cells. This dataset includes: - Illumina scEC&T-seq Circle-seq data (scCircle-seq) for a total of 626 single cells / nuclei - bam files - Illumina scEC&T-seq RNA-seq data (scRNA-seq-Illumina) for the same single cells / nuclei - bam files - Nanopore scCircle-seq data for 18 single cells - bam files - Nanopore bulk WGS for 2 cell lines and 2 primary tumor samples - bam files - Illumina bulk WGS for 2 cell lines - bam files - Illumina bulk Circle-seq data from 1 cell line - bam file - Illumina ChIP-seq H3K27me3 data from 1 cell line - fasta files + peaks bed file + coverage bw file

  Dataset EGAD00001010071

• 16S-based fecal microbiota composition

  The dataset reports the 16S rRNA gene sequencing of the fecal microbiota of donors from the Milieu Intérieur Cohort. The Milieu Intérieur cohort includes a total of 1,000 healthy individuals of western European ancestry, recruited in France as part of the Milieu Intérieur project. To assess their fecal microbiota composition, 16S rRNA profiles were generated from stool samples of 863 of the 1,000 donors. Human stool samples were produced at home no more than 24 hours before the scheduled medical visit and collected in a double-lined sealable bag maintaining strict anaerobic conditions. Upon reception at the clinical site, the fresh stool samples were aliquoted and stored immediately at -80°C. DNA was extracted from stool and barcoding PCR was carried out using indexed primers targeting the V3-V5 region of the 16S rRNA gene. Equal volumes of normalized PCR reaction were pooled and thoroughly mixed. The amplicon libraries were sequenced on Illumina MiSeq.

  Dataset EGAD00001004979

• Spatial multi-omic map of human myocardial infarction

  We applied an integrative single-cell genomics strategy with single nucleus RNA sequencing (snRNA-seq) and single nucleus Assay for Transposase-Accessible Chromatin sequencing (snATAC-seq) together with spatial transcriptomics from the same tissue mapping human cardiac cells in homeostasis and after myocardial infarction (MI) at unprecedented spatial and molecular resolution. We profiled in total 31 samples from 23 patients including four non-transplanted donor hearts as controls and samples from tissues with necrotic tissue areas (ischemic zone, IZ), border zone (BZ), and the non-affected left ventricular myocardium (remote zone, RZ) of patients with acute MI.

  Dataset EGAD00001008952

• Platelets contain a repertoire of DNA fragments that map over the human nuclear genome, including tumour-derived DNA in patients with active malignancy.

  This dataset consists of WGS from six patients with a recent diagnosis of gastrointestinal adenocarcinoma. DNA-Seq libraries were prepared from platelet DNA (pDNA) and plasma cfDNA obtained from the same peripheral blood sample. pDNA was size selected into 2 groups (small, s-pDNA: less than 600 bp and long, b-pDNA: greater than 600 bp). The short fragments were further cleaned to remove <100 bp fragments and large platelet fragments were fragmented via sonication. Libraries were then prepared using the NEBNext Ultra II DNA Sample Preparation Kit for Illumina according to the manufacturer’s protocol and sequenced on an Illumina NextSeq 500 (300 cycle PE) at low-pass (0.1X) for all samples, and 10X for the cfDNA and s-pDNA, using four lanes in each sample.

  Dataset EGAD00001009856

• Ither2 WXS dataset - Implementation of pediatric precision oncology into clinical practice: The individualized Therapies for Children with cancer program “iTHER”

  iTHER is a prospective national precision oncology program aiming to define tumor molecular profiles in children and adolescents with primary very high-risk, relapsed, or refractory pediatric tumors in order to identify relevant aberrations to inform treatment.

  Dataset EGAD00001010178

• Ither2 RNA-Seq dataset - Implementation of pediatric precision oncology into clinical practice: The individualized Therapies for Children with cancer program “iTHER”

  iTHER is a prospective national precision oncology program aiming to define tumor molecular profiles in children and adolescents with primary very high-risk, relapsed, or refractory pediatric tumors in order to identify relevant aberrations to inform treatment.

  Dataset EGAD00001010179

• RNA-seq profiling of NKX6.1 reporter iPSC lines for isolation and analysis of functionally relevant neuronal and pancreas populations

  We generated human induced pluripotent stem cell (iPSC) lines with a GFP reporter inserted in the endogenous NKX6.1 locus. Characterisation of the reporter lines demonstrated faithful GFP labelling of NKX6.1 expression during pancreas and motor neuron differentiation. We performed three independent in vitro differentiations towards the pancreatic endocrine lineage. We FACS-purified GFP positive and negative cells from stage 7 cultures, and generated Smart-Seq2 RNA-sequencing libraries for the pre-sorted cells, as well as the two GFP-sorted cell populations. Gene expression profiling by RNA-sequencing reveals that the NKX6.1-positive population closely resembles mature human beta cells and the functional evaluation of purified populations shows that the glucose-responsive beta-like cells are enriched within the NKX6.1-positive population. These reporter lines provide a valuable resource to the scientific community for the derivation of functional relevant pancreas and neuronal cell subtypes.

  Dataset EGAD00001003911

• Genetics of gene expression in human macrophage response to Salmonella

  Understanding how cells sense and respond to their environment, and how these responses are modulated by genetic variation, are fundamental biological problems, particularly for understanding how pathogenic organisms invade and manipulate the cells of the human immune system. Macrophages recognize and respond to many important human pathogens including HIV-1, Mycobacteria tuberculosis and Salmonella. This study will focus on the cellular response of human macrophages to Salmonella infection and how this response is modulated by the genetic bacground of the individual as well as additional pro-inflammatory stimulus (interferon-gamma priming). We will acquire 100 human induced pluripotent stem cell lines from the HipSci project, differentiate the cells in vitro into macrophages and expose them to four environmental conditions: (i) no stimulation, (ii) interferon-gamma (18h), (iii) Salmonella typhimurium SL1344 (5h), (iv) interferon-gamma (18h) + Salmonella (5h).Subsequently, we will isolate RNA from the samples for sequencing.

  Dataset EGAD00001003204

• Subclonal diversification of primary breast cancer

  Cancers are ecosystems of genetically related clones, competing across space and time for limited resources. To understand the clonal structure of primary breast cancer, we applied genome and targeted sequencing to 295 samples from 49 patients’ tumors. The extent of subclonal diversification varied considerably among patients and encompassed many spatial patterns, including local growth, intraductal dissemination and clonal intermixture. Landmarks of disease progression, such as acquiring invasive or metastatic potential, arose within detectable subclones of antecedent lesions, suggesting that subclonal mutations could be relevant if actionable. No defined temporal order of mutation was evident, with the commonest genes, including PIK3CA, TP53, BRCA2, PTEN and MYC, mutated early in some, late in others, often exhibiting parallel evolution across subclones. Signatures of homologous recombination deficiency correlated with response to neoadjuvant chemotherapy. Thus, the interplay of mutation, growth and competition drives clonal structures of breast cancer that are complex, variable across patients and clinically relevant.

  Dataset EGAD00001000965

• Next Generation Sequencing in an IBD Pedigree Whole Genome Data

  In 2009 we identified a four-generation family with over 700 members and 41 affected with Crohn's disease (CD). At the time we sequenced the exome of 6 affected individuals but did not identify any coding variants which appear to explain the high prevalence of disease. Since then we have collected DNA from a large number of additional family members, genotyped linkage arrays on the entire family to refine genomic regions shared by identity by descent and genotyped affected and unaffected members at known CD risk loci identified by Genome Wide Association Studies (GWAS). These analyses have confirmed that a significant unexplained excess of disease remains after accounting for all known genetic factors, and that several regions of the genome are shared by a large fraction of affected individuals. We therefore perform whole genomes sequencing from 8 individuals which will allow us to impute the complete sequence of nearly all the members of the two largest and most severely affected branches of the family.

  Dataset EGAD00001000399

• Functional genomics approaches to understand osteoarthritis (2019-08-01)

  The aim of this work is to apply an integrated systems approach to understand the biological underpinnings of large joint (hip and knee) osteoarthritis which culminates in the need for total joint replacement (TJR). We will obtain diseased and non-diseased cartilage as well as other disease-relevant tissue following TJR, coupled with a blood sample. We will generate genotype data and will characterise the pairs of diseased and non-diseased tissue samples in terms of methylation, transcription (RNASeq) and expression (quantitative proteomics). We will apply integrative approaches to combine information across the omics levels to characterise genes, pathways, and networks that underlie osteoarthritis progression. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ . This dataset contains all the data available for this study on 2019-08-01.

  Dataset EGAD00001005215

• INSPIRE multi-timepoint cfMeDIP dataset

  This dataset contains raw sequencing data from multi-timepoint cell-free methylated DNA immunoprecipitation and sequencing (cfMeDIP-seq) of plasma samples from the INSPIRE study (NCT02644369). Details about the study, including inclusion/exclusion criteria and interventions are available at https://clinicaltrials.gov/study/NCT02644369. Briefly, five cohorts were included, INS-A (head & neck squamous cell carcinoma), INS-B (triple-negative breast cancer), INS-C (high-grade serous ovarian cancer), INS-D (melanoma), and INS-E (mixed solid tumors). All patients in the study were diagnosed with advanced cancer and received treatment with pembrolizumab. Plasma samples were collected at baseline and every 3 cycles until disease progression, death, loss of follow-up, or completion of the study. Plasma samples were first processed for cell-free DNA mutations and remaining samples were then processed by cfMeDIP-seq, prioritizing baseline and post-cycle 3 samples. In total, data from 204 timepoints from 87 distinct patients are deposited.

  Dataset EGAD00001011312

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Tetralogy of Fallot Exome Trios

  Exome sequencing of 30 parent-offspring trios to >50X mean depth, where the offspring has sporadic TOF, to identify potential causal de novo mutations. We will use the exome plus design for pulldown that incorporates ~6.8Mb of additional regulatory sequences in addition to the ~50Mb GENCODE exome.

  Dataset EGAD00001000344

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• Genotype data for 4607 Greenlandic samples (MEGA array)

  This file fileset has 4607 Greenlanders scored on the Illumina MEGA array (1,622,813 sites), and has been put on the plus strand. The data is in PLINK bed/bim/fam format. The Greenlandic individuals originate from two population surveys, B99 and IHIT.

  Dataset EGAD00010002057

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• Transcriptome-wide gene expression analysis of cocaine use disorder in postmortem human brain tissue

  Dataset contains raw fastq-files from RNA-sequencing analysis of total RNA extracted from Brodmann Area 9 human postmortem brain tissue samples.

  Dataset EGAD50000000212

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Patient-derived xenograft models of head and neck cancers

  Establishment and characterization of two patient-derived xenograft models from HNSCC patients , initiatlly treatment-naive, and for which cetuximab-acquired resistant model couterparts have been generated. All models have been characterized at genomic level. HNSCC tissues were obtained from surgical resections at Cliniques universitaires St Luc in Brussels (Belgium).

  Dac EGAC50000000502

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415