17084 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..xwWa"

in 156.15 milliseconds.

• APCDR AGV Project: Whole genome sequencing of 3 African populations (curated data)

  The African Genome Variation Project (AGVP) provides a resource to help design, implement and interpret genomic studies in sub-Saharan Africa (SSA) and worldwide. The AGVP represents dense genotypes from 1,481 and whole genome sequences (WGS) from 320 individuals across SSA. As part of the AGVP we sequenced 3 African populations; Baganda from Uganda (4x), Zulu from South Africa (4x), Gumuz, Wolayta, Oromo, Somali and Amhara from Ethiopia (8x).

  Study EGAS00001000960

• SOFT_study___sequencing_premenopausal_breast_cancer

  Our project will examine the role of PIK3CA mutations and their sensitivity to endocrine therapies and its role, with the addition of complete ovarian suppression. We plan to test our hypotheses using tumour samples collected from patients enrolled in the SOFT/IBCSG24-02 clinical study (Suppression of Ovarian Function Trial – (NCT00066690). SOFT is a phase III trial that randomised 3066 premenopausal women to evaluate if adding ovarian suppression to adjuvant endocrine therapy will improve clinical outcomes.

  Study EGAS00001000983

• CML_blast_phase_rearrangement_screen

  Genomic libraries (500 bps) will be generated from total genomic DNA derived from 10 Chronic Myeloid Leukemia in blast phase samples and subjected to a total of two lanes of 50 bp, paired end sequencing on the llumina HiSeq. Paired reads will be mapped to build 37 of the human reference genome to facilitate the generation of genome wide copy number information, and the identification of novel rearranged cancer genes and gene fusions

  Study EGAS00001000191

• Whole genome sequencing of patients affected by acute intermittent porphyria

  Acute intermittent porphyria (AIP) is an hereditary rare metabolic disorder of incomplete penetrance, affecting the biosynthesis of heme. IAP is an autosomal dominant disorder, resulting in a substantial reduction of the activity of the hydroxymethylbilane synthase coding gene (HMBS). Most HMBS mutation carriers are asymptomatic and only between 10% and 20% of patients present acute attacks of the associated symptoms. Here, we sequenced whole genomes of 16 AIP patients.

  Study EGAS00001004999

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Genes___Health_imputed_genotype_dataset

  Genes & Health is a cohort of British Bangladeshi and British Pakistani individuals. In the Feb2020 data freeze, 28,022 individuals were genotyped on the Illumina Infinium Global Screening Array v3 chip (with the additional Multi-Disease variants). Imputation was performed using the Michigan Imputation Server with the GenomeAsia pilot reference panel, which contains 1,739 genomes and 642 from them are from South Asian groups. This dataset contains imputed SNPs with imputation accuracy >0.3 and MAF >0.1%.

  Study EGAS00001005373

• Single-cell RNA sequencing of 6 follicular lymphoma tumors

  Follicular lymphoma (FL) is an indolent cancer of mature B-cells but carries increased risk of transformation to a more aggressive histology over time. We present here comprehensive profiling both tumor and immune compartments in 6 diagnostic FL biopsies by single-cell RNA sequencing. This confirmed results from 155 FL tumors characterized by mass cytometry (CyTOF) which revealed two distinct evolutionary trajectories with disparate risk of transformation and alternate biologies.

  Study EGAS00001005257

• UROMOL 2020 - SNP data

  The molecular landscape in non-muscle-invasive bladder cancer (NMIBC) is characterized by large biological heterogeneity with variable clinical outcomes. Here, we performed a large integrative multi-omics analysis of patients diagnosed with NMIBC (n=834). Transcriptomic analysis identifies four classes (1, 2a, 2b and 3) reflecting tumor biology and disease aggressiveness. Both transcriptome-based subtyping and the level of chromosomal instability provide independent prognostic value beyond established prognostic clinicopathological parameters.

  Study EGAS00001004862

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  We investigated 10 female and 14 male SARS-CoV-2 positive children (age range: 0.8 to 18 years). Based on the WHO guidelines, 15 patients were classified as having mild COVID-19, while 7 children were classified as moderate COVID-19 cases. Two children were asymptomatic. 8 female and 10 male SARS-CoV-2 negative children were included as controls (age range: 4 to 16). 12 SARS-CoV-2 positive female and 9 male adults were included ( age range: 27 - 76) together with 13 female and 10 male SARS-CoV-2 negative adult controls (age: 24 - 77). 10 adult COVID-19 patients had mild disease, while 12 had moderate COVID-19. We performed single-cell RNA sequencing experiments.

  Dataset EGAD00001007969

• Single cell transcriptomic data of human gut macrophages

  Cellular suspensions (∼15000 cells, with expected recovery of ∼7500 cells) of sorted CD45+ HLA-DR+ CD14+ macrophages from colonic mucosa and muscularis propria were loaded on the 10X Chromium Controller instrument (10X Genomics) according to the manufacturer’s protocol using the 10X GEMCode proprietary technology. All samples from individual patients were loaded in one batch. The Chromium Single Cell 3´ v2 Reagent kit (10X Genomics) was used to generate the cDNA and prepare the libraries, according to the manufacturer’s protocol. The libraries were then equimolarly pooled and sequenced on an Illumina NextSeq500 using HighOutput flow cells v2.5. A coverage of 400M reads per sample was targeted, in order to obtain 50 000 reads per cell. The raw data were then demultiplexed and processed with the Cell Ranger software (10X Genomics) v2.1.1.

  Dataset EGAD00001007765

• Single nuclei sequencing of early, late-term, and early-onset pre-eclamptic decidua and villi.

  Hypertensive disorders in pregnancy, of which the multisystem syndrome pre-eclampsia is the most severe, leading to preterm delivery, maternal mortality, and life-long complications. To elucidate early disease dynamics, we present the first spatio-temporal study comparing single-nuclei transcriptomes of human preterm pre-eclamptic placentae and healthy controls, contextualizing this in a comprehensive study including early and late gestational placentae. This study includes early placentae samples from the fetal part (villi; n=10), maternal part (Decidua; n=3), late placentae samples from healthy pregnancies, villi (n=6), decidua (n=4), and late placentae samples from early-onset preeclamptic pregnancies, villi (n=5) and decidua (n=5).

  Dataset EGAD00001008273

• Disease specific alterations in the olfactory mucosa of patients with Alzheimer’s disease

  The sample AD_Library_1, AD_Library_2 and Control_Library were run on a Chromium Chip B with the Chromium Single Cell 3′ Library & Gel Bead Kit v3 kit (10x Genomics, CA, USA) . The 3’ gene expression libraries were sequenced at an approximate depth of 50,000 reads per cell using the NovaSeq 6000 S1 (Illumina, San Diego, CA, USA) flow cells. Cell Ranger v.3.0.2 was used to analyze the raw base call files. FASTQ files and raw gene-barcode matrices were generated and aligned human genome GRCh37 (hg19). The samples were integrated in R v.4.0.3 and generated Seurat objects, two related to AD samples and one to control samples, were analyzed using the Seurat package v.4.0.3 to perform downstream analysis, clustering of the cells and differential expression.

  Dataset EGAD00001008560

• Genomic Evolution of Breast Cancer Metastasis and Relapse

  Recurrent breast cancer is almost universally fatal. We characterize 170 patients locally relapsed or distant metastatic cancers using massively parallel sequencing. We identify that the relapse-seeding clone disseminates late from the primary tumor. TP53 and AKT1 appear to be enriched in ER-positive cancers predisposed to relapse. Mutation acquisition continues at relapse as the same mutation signatures continue to operate and new signatures, such as that caused by radiotherapy appear de novo. In 49% of cases we identify drivers mutations private to the relapse and these are sampled from a wider range of cancer genes, including SWI-SNF complex and JAK-STAT signaling.

  Dataset EGAD00001002696

• Genomic characterisation of SDH deficient renal cell carcinoma - WGS

  SDH deficient renal cell carcinomas are a rare and recently defined subtype of kidney cancer, often associated with an inherited mutation in one of the SDH gene subunits. This dataset sought to understand the genomic events that underpin tumour formation, from putative cell of origin, characterisation of the tumour microenvironment, to the genomic evolution of these rare tumours. We performed whole genome and RNA sequencing of 4 patients with SDH deficient renal cell carcinomas, including one patient who had an additional paraganglioma. An addition patient in this cohort had the initial diagnosis revised to a clear cell renal cell carcinoma.

  Dataset EGAD00001008469

• RNAseq data of polyA+ RNA from Leukocytes from 624 individuals of the ProgeNIA cohort.

  We sequenced the polyA+ fraction of the RNA of the leukocytes from 624 sardinian individuals with RNAseq. Prior to library preparation we added either ERCC ExFold RNA Spike-In. An average of 60M reads per samples with 51 bp paired-end reads were generated on a HiSeq 2000 (Illumina). Sequencing reads were then aligned using STAR-2.2.0c2 to the h37d5 reference genome supplemented with the ERCC spike-ins sequences. We further provided an exon-exon junction database that we generated from the GENCODE v14 annotation. In order to remove a contamination from a parallel experiment, we discarded any reads that mapped to the genomic regions of CBLB (chr3:105370773-105592330) and BCL11A (chr2:60672555-60784156). Filtered aligned reads (bam format) are shared.

  Dataset EGAD00001003102

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• A non-canonical lymphoblast in refractory childhood T cell leukaemia

  Refractory cancers may arise either through the acquisition of resistance mechanisms by cancer cells or represent distinct diseases. The origin of childhood T-cell acute lymphoblastic leukaemia (T-ALL) that does not respond to initial treatment, i.e. refractory disease, is unknown. Refractory T-ALL carries a poor prognosis and cannot be predicted at diagnosis. Here, we performed single cell mRNA sequencing of T-ALL from children who did or did not respond to initial treatment. We identified a transcriptionally distinctive blast population, exhibiting features of innate-like lymphocytes, as the major source of refractory disease. Evidence of such blasts at diagnosis heralded refractory disease across independent datasets and was associated with survival in a large, contemporary trial cohort. Our findings portray refractory T-ALL as a distinct disease. They may have immediate clinical utility.

  Dataset EGAD00001015381

• Direct transcriptional consequences of somatic mutation in breast cancer

  The disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription; co-ordinated secondary alterations in transcriptional pathways; and increased transcriptional noise. To catalogue the rules governing how somatic mutation Overall, 59% of 6980 exonic substitutions were expressed. Compared to other classes, nonsense mutations showed lower expression levels than expected with patterns characteristic of nonsense-mediated decay. 14% of 4234 genomic rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusion transcripts and premature poly-adenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes may drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data therefore reveals the rules by which transcriptional machinery interprets somatic mutation.

  Dataset EGAD00001002236

• Massive parallel RNA sequencing of highly purified mesenchymal cells derived from bone marrow specimens of 10 healthy donors

  Highly purified mesenchymal cells (CD45-/7AAD-/CD235a-/CD31-/CD271+/CD105+) were prospectively FACS-isolated from bone marrow specimens of 10 healthy donors (HDs). This data set is used as a baseline control to observe the differences between gene expression profiles (GEPs) of pre-leukemia cases (45 low-risk myelodysplastic syndrome, 4 Shwachman-Diamond and 3 Diamond-Blackfan anemia patients) and gene expression patterns observed in a normal, healthy context. Through differential expression and gene set enrichment analysis we determined that inflammatory signaling pathways are significantly more active in mesenchymal cells of pre-leukemia cases compared to their healthy counterparts. Finally, we determined through statistical modelling of healthy donor's GEPs which pre-leukemia cases have significantly more active inflammatory signaling and demonstrated a strong relation to survival statistics.

  Dataset EGAD00001002659

• Shot-gun stool metagenomics and colorectal cancer risk.

  This study aims to identify metagenomics biomarkers in colorectal cancer (CRC). The study includes 156 samples of shot-gun stool metagenomics, corresponding to 51 patients with CRC, 54 patients with high-risk adenoma, and 51 healthy controls. The sequencing libraries were prepared with 2 µg of total DNA using the Nextera XT DN Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing was performed at 150 nucleotides, paired-end, using an Illumina HiSeq 4000 platform.

  Study EGAS00001007025

• sWGS of Pap test smears from healthy donors and HGSOC patients and matched tumor tissue

  Shallow whole genome sequencing was performed on Pap test smears considering at least 10 M reads per sample. The cohort consists of 77 samples from healthy women, i.e. no tumor diagnosis, and 65 samples from women with a diagnosis of high-grade serous ovarian cancer (HGSOC) taken months or years before diagnosis. 44 primary tumor samples matched to the respective HGSOC patients were sequenced in the same manner as the Pap test smears.

  Study EGAS00001007084

• The genomic landscape of recurrent ovarian high grade serous carcinoma: the BriTROC-1 study

  The BriTROC-1 study, spanning 15 centres across the United Kingdom, is a prospective observational project investigating putative causes of relapse in high-grade serous carcinoma (HGSC). Potential genomic changes associated with disease recurrence are examined by studying paired tumour samples collected from patients at diagnosis and after relapse after receiving platinum based chemotherapy. Shallow whole genome sequencing and targeted amplicon sequencing are used to identify copy number aberrations and short variants respectively.

  Study EGAS00001007292

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• The Gut Microbiome of liver transplant recipients – Cross-sectional + Longitudinal (renal and liver)

  TransplantLines is designed as a single-center, prospective cohort study and biobank including all different types of solid organ transplant recipients as well as living organ donors. In the TransplantLines gut microbiome study the gut microbiome of solid organ transplant recipients is characterized and linked to clinical phenotypes. This batch contains the cross-sectional data from liver transplant recipients and longitudinal data from renal and liver transplant recipients.

  Study EGAS00001006258

• EGAD00010000628

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000628

• EGAD00010000630

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000630

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• Triple-negative breast cancer sequencing data

  Single-cell RNA sequencing and spatial transcriptomic sequencing data associated with manuscript 'Ectopic NMDAR expression in cancer unmasks germline-encoded autoimmunity'

  Dataset EGAD50000002266

• Analysis of the lung gene expression profile in COPD

  Samples obtained from patients with COPD and from controls by bronchoscopy from the lung were subjected to RNA seq.

  Study EGAS00001001472

• Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina

  Study the sub-continental origins of African, European and Native American genetic ancestries of Argentinean populations.

  Study EGAS00001004492

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Dataset contains Exome-seq and RNA-seq from 2 GBM patients, as well as RNA-seq from the derived cultured cells (GNS).

  Dataset EGAD00001001359

• analysis of T cell receptor repertoirs

  Full information about the T cell receptor (CR) variable regions found in the sequences of the vdj region. Columns: barcode is_cell contig_id high_confidence length chain v_gene d_gene j_gene c_gene full_length productive cdr3 cdr3_nt reads umis raw_clonotype_id raw_consensus_id

  Dataset EGAD00001008109

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• FFPE CPA Accreditation Study

  FFPE CPA accreditation of genome-scale sequencing in routinely collected formalin-fixed paraffin-embedded (FFPE) cancer specimens versus matched fresh-frozen samples using targeted pulldown capture prior to Illumina sequencing.

  Dataset EGAD00001000678

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Biological and Therapeutic Implications of a Unique Subtype of NPM1 Mutated AML (RNAseq Data)

  This dataset contains 91 RNAseq paired reads, in fastq format. Samples were collected from fresh bone marrow and peripheral blood sample from AML patients.

  Dataset EGAD00001006669

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853