11076 results for "monedas ultimate team FC 26 Visité Buyfc26coins.com. Servicio premium a un precio estándar. Increíble..XLis"

in 21.93 milliseconds.

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• non-malignant plasma cfRNA

  Dataset contains mRNA capture sequencing data from plasma of 125 different human donors: 88 patients with a non-malignant disease and 37 cancer-free controls. Samples were sequenced on a NovaSeq X and sequencing data is provided in FASTQ format.

  Dataset EGAD50000001806

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• MEC/SEF DNA-seq

  DNA sequencing of 27 MEC/SEF tumor samples. Whole exome sequencing was performed at Beijing Genomics Institute using a library preparation based on Agilent V6(60M). Sequencing was performed on the DNBseq platform sequencer with a read length of 100PE, producing ~12G raw data per sample.

  Dataset EGAD50000000762

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• Genome-Wide Association Study of Breast Cancer in the African Diaspora - the ROOT study

  The paucity of data on the genetic epidemiology of breast cancer for racial/ethnic groups other than those of European ancestry hinders the development of innovative interventions to reduce health disparities. Women in the African Diaspora experience a disproportionate burden of pre-menopausal breast cancer in comparison to all other races for reasons that remain unknown and understudied. This higher proportion of early-onset breast cancer might suggest a stronger genetic component in these populations. Genome-wide association studies (GWAS) have revealed several genetic loci that confer risk of breast cancer. Because all GWAS started the discovery stage in women of European ancestry and replicated mainly in women of European ancestry, we propose a novel approach for a GWAS in indigenous African women to identify alleles associated with breast cancer risk which will then be replicated in other populations. This innovative design builds on our current understanding of the etiologic heterogeneity in breast cancer and the distribution of breast cancer molecular subtypes which differ between women of African ancestry and women of European ancestry. The major objective of the proposed studies is to get to the "root" causes of breast cancer by identifying breast cancer risk alleles in a pooled sample of women of African ancestry and to replicate our findings in other populations. To achieve this objective, we conducted a case control study of breast cancer in women of African ancestry, including Africans living in Nigeria, African Americans and African Barbadians. We will genotype ~3800 individuals using the Illumina HumanOmni2.5-Quad platform. We will conduct both standard and novel genetic analyses of the data to map genes associated with breast cancer susceptibility, verify genotyping and carry out fine-mapping studies in genes or regions showing association with breast cancer risk, and replicate in other African American and non-African American populations. By pooling unique resources from studies throughout the African Diaspora, this study has the potential to identify risk alleles in several genes that contribute to increased breast cancer risk and may have implications for early detection, prognosis and treatment of breast cancer in ALL women. This should ultimately lead to improved outcomes for those who suffer a disproportionate burden of early-onset breast cancer.

  Study phs000383

• Foregut Microbiome in Development of Esophageal Adenocarcinoma

  The distal esophagus is an important anatomical area where gastric acid reflux can cause reflux esophagitis (RE), Barrett's esophagus (BE) (intestinal metaplasia), and esophageal adenocarcinoma (EA). The incidence of EA has increased 6-fold in the U.S. since the 1970s, parallel to a significant increase in the prevalence of gastroesophageal reflux diseases (GERD). Although specific host factors might predispose one to disease risk, such a rapid increase in incidence must be predominantly environmental. The cause remains unknown. Our hypothesis is that changes in the foregut microbiome are associated with EA and its precursors, RE and BE in the GERD sequence. We will conduct a case control study to characterize the microbiome in every stage of the GERD sequence as well as analyze the trend in changes in the microbiome along disease progression toward EA. Specific Aim 1. To conduct a comprehensive population survey of the foregut microbiome and demonstrate its association with GERD sequence, by a 16S rRNA gene survey. We will analyze samples of the foregut microbiome at three anatomic loci: mouth, distal esophagus, and gastric corpus. Changes of the microbiota in the distal esophagus will be correlated with the phenotypes. Spatial relationship between the esophageal microbiota and upstream (mouth) and downstream (stomach) foregut microbiotas as well as temporal stability of the microbiome-disease association will also be examined. Specific Aim 2. To define distal esophageal metagenome and demonstrate its association with GERD sequence, by shotgun metagenomic analysis. We will first classify samples of the metagenome into metagenotypes by between-sample k-mer distance and correlate the metagenotypes with the four phenotypes. Subsequent detailed analyses will include pathway-disease and gene-disease associations. DNA viruses and fungi, if identified, also will be correlated with the phenotypes. A significant association between the foregut microbiome composition and GERD sequence, if demonstrated, will be the first step for eventually testing the causal hypothesis that an abnormal microbiome is required for the development of the sequence of phenotypic changes toward EA. If EA and its precursors represent a microbial ecological disease, treating the cause of GERD might become possible, for example, by normalizing the microbiome through use of antibiotics, probiotics, or prebiotics. Causative therapy for GERD could prevent its progression and reverse the current trend of increasing incidence of EA.

  Study phs000260

• Kids First: The Genomic Basis of Structural Birth Defects Associated with Chromosome 18 Copy Number Changes

  Chromosome abnormalities are a common cause of structural birth defects. Both childhood cancers and structural birth defects are critical and costly conditions associated with substantial morbidity and mortality. Elucidating the underlying genetic etiology of these diseases has the potential to profoundly improve preventative measures, diagnostics, and therapeutic interventions.However, because these genomic copy number changes involve multiple genes and because most of these conditions are individually rare, defining the specific causative genes behind specific phenotypes has been a challenge. We met that challenge by spending the last 28 years enrolling and evaluating anyone with a chromosome 18 abnormality. The cohort now includes over 700 individuals with a wide variety of chromosome 18 copy number changes (CNV), as well as their parents. Because the vast majority of these participants have individually unique CNVs, we have been able to perform extensive genotype-phenotype correlations resulting in 58 publications. Of the 263 genes on chromosome 18, 28 are linked to specific hemizygous phenotypes. However, most have low penetrance. Genomic sequence data could identify variants in the extant allele that are hypermorphic and compensate for hemizygosity, or are hypomorphic and exacerbate hemizygosity. Additionally, there are phenotypes within this cohort that are rare, or an extreme version of one of the more common phenotypes. Genomic sequence data could help discover new biallelic conditions by revealing functional sequence variants of the extant allele. In both of these cases, there could also be variants in other genes on other chromosomes that may be associated with the phenotype that confer susceptibility or resilience. Inclusion of this unique cohort in the Gabriella Miller Kids First Pediatric Research Program can advance the goals of the program in several ways. First, by adding known susceptibility loci to the existing Kids First cohorts for the structural birth defects that are also found in our cohort. Second, for those structural birth defects known to be polygenetic, this cohort has a single defined risk factor which can simplify the search for secondary factors. Third, these studies can also bring clarity to people with chromosome 18 conditions and help to make the genotype more accurately predict phenotype. This approach could be a model for understanding the many other rare chromosome abnormalities which collectively are a common cause of structural birth defects.

  Study phs002627

• Immune-Related Adverse Events after Immune Checkpoint Blockade-Based Therapy are Associated with Improved Survival in Advanced Sarcoma

  Immune activation after immune checkpoint blockade (ICB) can lead to a unique group of adverse events (AEs), which have been associated with improved outcome in many carcinomas. The association between immune-related AEs (irAEs) and outcome in patients with sarcoma is not well studied. This study has two components: (1) a retrospective clinical study of irAEs among 131 patients treated with ICB at Memorial Sloan Kettering Cancer Center and (2) an analysis of a subset of these patients who have whole transcriptome sequencing available for analysis. In the clinical study portion, we reviewed a cohort of patients with advanced sarcoma treated on prospective clinical trials utilizing ICB-based therapy between April 2017 and January 2020. The objectives were to pool the safety data from each trial, identify irAEs, and correlate them with best overall response by RECIST 1.1, progression-free survival (PFS) and overall survival (OS). Association of irAEs with response and survival was assessed using a Cox regression model. A total of 131 patients were included. Forty-two (32%) had at least one irAE of any grade and 16 (12%) had at least one Grade ≥ 3 irAE. On Cox analysis adjusting for clinical covariates that were significant in the univariate setting, the hazard ratio (HR) for an irAE (HR 0.662, 95% CI 0.421 - 1.041) approached, but did not reach statistical significance for PFS (P = 0.074), while patients had a significantly lower HR for OS (HR 0.443, 95% CI 0.246 – 0.798; P = 0.007) compared to those without or before an irAE. Tumor samples with available RNA sequencing data were stratified by presence of an irAE to identify patterns of differential gene expression. In total, 71 unique patients had RNA sequencing available for analysis. The transcriptomes of 31 of these patients have been previously uploaded to dbGaP (phs002852), leaving 36 unique transcriptomes that have not been previously publicly shared. Three patients did not agree for their sequencing to be publicly shared. Therefore, 33 unique patient samples will be uploaded to this dbGaP study. Overall, this study found that gene expression profiling on baseline tumor samples from patients who had an irAE had higher numbers of tumor-infiltrating dendritic cells, CD8+ T cells, and regulatory T cells as well as upregulation of immune and inflammatory pathways.

  Study phs003284

• Whole Blood Transcriptomics of Patients With Melioidosis

  Melioidosis is a neglected tropical infection caused by the Gram negative bacterium Burkholderia pseudomallei that is associated with high mortality rates in southeast Asia. The goal of this study was to a) identify human blood leukocyte transcriptomic features and pathways specific to melioidosis (vs other etiologies of infection), b) identify transcriptomic features and pathways specific to fatal melioidosis, and c) identify transcriptomic predictors of death in patients with melioidosis. This study used clinical data and whole blood leukocyte samples from a subset of participants in the Ubon Sepsis Study, a prospective single-center cohort study conducted at Sunpasitthiprasong Hospital, Ubon Ratchathani, Thailand between 2013 and 2017. Participants in the Ubon Sepsis Study had suspected or documented infection with accompanying systemic manifestations of infection and were enrolled, with blood sampling, within 24 hours of admission to the study hospital. Enrolled patients were followed over time and vital status was determined at 28 days after enrollment. The subset of participants from the parent Ubon Sepsis Study cohort selected for this study was comprised of 164 patients with melioidosis (defined as having a culture of clinical sample positive for B. pseudomallei), 35 patients with Gram negative bacteremia due to either Escherichia coli or Klebsiella pneumoniae, 16 patients with Gram positive bacteremia due to Staphylococcus aureus, and 19 patients who had negative blood cultures and no clinical sample culture-positive for B. pseudomallei. Fifty uninfected control patients with or without diabetes were recruited from the outpatient department and blood donation center at Udon Thani hospital, Udon Thani, Thailand from 2018 to 2019. Blood was collected at the time of enrollment in Tempus Blood RNA tubes. RNA was extracted using the Tempus Spin RNA Isolation kit. RNA sequencing (RNA-Seq) was performed at the University of Washington Northwest Genomics Center. Analysis was performed using a variety of statistical methods. The main finding of the study was that the transcriptomes of melioidosis patients, compared to patients with other infections, were characterized by upregulation of interferon signaling. The transcriptomes of patients with fatal melioidosis were notable for upregulation of inflammatory and type 2 immune responses and downregulation of genes related to T-cell function. A five-gene (EPHB1, SYCP2L, MERTK, IL5RA, and SPOCK1) predictive signature for death in melioidosis was developed.

  Study phs003724

• Kids First: Genetics of Pediatric Germ Cell Tumors

  The Gabriella Miller Kids First Pediatric Research Program (Kids First) is a trans-NIH effort initiated in response to the 2014 Gabriella Miller Kids First Research Act and supported by the NIH Common Fund. This program focuses on gene discovery in pediatric cancers and structural birth defects and the development of the Gabriella Miller Kids First Pediatric Data Resource (Kids First Data Resource). All of the genomic and phenotypic data from this study are accessible through dbGaP. The data is also available at the Kids First Portal, where other Kids First datasets can also be accessed in the cloud for data analysis, data visualization, collaboration and interoperability, open to all researchers and developers.Pediatric malignant germ cell tumors (GCTs) represent approximately 6% of childhood cancers, including 3% of tumors in children aged 0-14 years and 15% of tumors in adolescents. GCTs are heterogeneous and grouped together due to the presumed common cell of origin, the primordial germ cell (PGC). GCTs typically occur in the testes or ovaries; however, extragonadal GCTs can occur and are likely a result of abnormal germ cell migration during development. Evidence suggests that GCTs, including those diagnosed in adults, are initiated in utero. Thus, alterations in normal embryonic development are likely to be especially relevant to GCT etiology. Germline susceptibility has not been evaluated in an agnostic fashion in pediatric GCT, mainly due to a lack of an adequate number of samples; however, emerging evidence supports a genetic etiology.In the two Kids First GCT projects, we will evaluate genetic susceptibility to intracranial and extracranial GCT by sequencing probands and their unaffected parents. The goals of the project are to: 1) evaluate the contribution of rare genetic variants in GCT through the use of aggregate burden tests, focusing on genes and established regulatory regions; 2) identify de novo SNVs and CNVs in pediatric GCT using a case-parent triad design; and 3) identify molecular signatures in GCT tumor specimens, overall and by age group and tumor characteristics. Whole Genome Sequencing (WGS) data generated through the Gabriella Miller Kids First Pediatric Research Program will provide an opportunity to investigate the genetic origins of GCT in a diverse set of samples. Given the limited knowledge of GCT etiology and biology, the results of the proposed analyses are likely to have a big impact on the field.

  Study phs002322

• CRCbiome: Gut metagenome of Norwegian screening participants using FIT sampling

  The study aims to characterize the gut metagenome of Norwegian screening participants and assess the ability of the gut metagenome to identify those at need for colonoscopy. Background: Colorectal cancer (CRC) screening reduces CRC incidence and mortality. However, current screening methods are either hampered by invasiveness or suboptimal performance, limiting their effectiveness as primary screening methods. To aid in the development of a non-invasive screening test with improved sensitivity and specificity, we have initiated a prospective biomarker study (CRCbiome), nested within a large randomized CRC screening trial in Norway. We aim to develop a microbiome-based classification algorithm to identify advanced colorectal lesions in screening participants testing positive for an immunochemical fecal occult blood test (FIT). We will also examine interactions with host factors, diet, lifestyle and prescription drugs. The prospective nature of the study also enables the analysis of changes in the gut microbiome following the removal of precancerous lesions. Methods: The CRCbiome study recruits participants enrolled in the Bowel Cancer Screening in Norway (BCSN) study, a randomized trial initiated in 2012 comparing once-only sigmoidoscopy to repeated biennial FIT, where women and men aged 50–74 years at study entry are invited to participate. Since 2017, participants randomized to FIT screening with a positive test result have been invited to join the CRCbiome study. Self-reported diet, lifestyle and demographic data are collected prior to colonoscopy after the positive FIT-test (baseline). Screening data, including colonoscopy findings are obtained from the BCSN database. Fecal samples for gut microbiome analyses are collected both before and 2 and 12 months after colonoscopy. Samples are analyzed using metagenome sequencing, with taxonomy profiles, and gene and pathway content as primary measures. CRCbiome data will also be linked to national registries to obtain information on prescription histories and cancer relevant outcomes occurring during the 10 year follow-up period. Discussion: The CRCbiome study will increase our understanding of how the gut microbiome, in combination with lifestyle and environmental factors, influences the early stages of colorectal carcinogenesis. This knowledge will be crucial to develop microbiome-based screening tools for CRC. By evaluating biomarker performance in a screening setting, using samples from the target population, the generalizability of the findings to future screening cohorts is likely to be high.

  Study EGAS50000000170

• Molecular_characterization_of_invasive_lobular_carcinoma

  Invasive lobular carcinoma (ILC) is the second most common histological subtype of breast cancer accounting for 10-15% of cases. ILC differs from invasive ductal carcinoma (IDC)with respect to epidemiology, histology, and clinical presentation. Moreover, ILC is lesssensitive to chemotherapy, more frequently bilateral, and more prone to form gastrointestinal, peritoneal, and ovarian metastases than IDCs. In contrast to IDC, the prognostic value ofhistological grade (HG) in ILC is controversial. One of the three major components of histological grading (tubule formation) is missing in ILC which hinders the process of gradingin this histological subtype and results in the classification of approximately two thirds of ILC as HG 2.Over the last decade, a number of gene expression signatures have shed light onto breast cancer classification, allowing breast cancer care to become more personalized. Withrespect to the management of estrogen receptor (ER)-positive breast cancer, several gene expression signatures provide prognostic and/or predictive information beyond what is possible with current classical clinico-pathological parameters alone. Nevertheless, most studies using gene expression signature have not considered different histologic subtypesseparately. Recently, a comprehensive research program has elucidated some of the biological underpinnings of invasive lobular carcinoma. Genetic material extracted from 200 ILC tumor samples were studied using gene expression profiling and identified ILCmolecular subtypes. These proliferation-driven gene signatures of ILC appear to have prognostic significance. In particular, the Genomic Grade (GG) gene signature improved upon HG in ILC and added prognostic value to classic clinico-pathologic factors. In addition this study demonstrated that most ILC are molecularly characterized as luminal-A (~75%)followed by luminal-B (~20%) and HER2-positve tumors (~5%). Moreover, we investigated the prognostic value of known gene signatures/ gene modules in the same cohort of ILC. As a second step within the scope of this project, we aim to investigate the interactionsbetween somatic ILC tumor mutations to observed transcriptome findings. To this end, we aim to perform somatic mutation analysis for the ILC tumors for which Affymetrix gene expression profiling is available. To this end, we will use a gene screen assay, which specifically interrogates the mutational status of a few hundreds of cancer genes. We believe that this pioneering effort will be fundamental for a tailored treatment of ILC withimprovement in patients' outcome.

  Study EGAS00001000292

• Multi-omics data of 1000 Inflammatory Bowel Disease patients

  Portal available at https://1000ibd.org Inflammatory bowel disease (IBD) is a chronic complex disease of the gastrointestinal (GI) tract. Patients with IBD can experience a wide range of symptoms, but the pathophysiological mechanisms that cause these individual differences in clinical presentation remain largely unknown. In consequence, IBD is currently classified into subtypes using clinical characteristics. If we are to develop a more targeted treatment approach, molecular subtypes of IBD need to be discovered that can be used as new drug targets. To achieve this, we need multiple layers of molecular data are generated from the same IBD patients.We initiated the 1000IBD project to prospectively follow more than 1000 IBD patients from the Northern provinces of the Netherlands. For these patients, we have collected a uniquely large number of phenotypes and generated multi-omics profiles. To date, 1,215 participants have been enrolled in the project and enrolment is on-going, with 609 patients being present in the first data release. Phenotype data collected for these participants includes information on dietary and environmental factors, drug responses, and adverse drug events. Genome information has been generated using genotyping (ImmunoChip, Global Screening Array and HumanExomeChip) and sequencing (whole exome sequencing and targeted resequencing of IBD susceptibility loci), transcriptome information generated using RNA-sequencing of intestinal biopsies and microbiome information generated using both sequencing of the 16S rRNA gene and whole genome shotgun metagenomic sequencing.All molecular data generated within the 1000IBD project will be shared in multiple data on the European Genome-Phenome Archive (www.ega-archive.org). The first data release, will contain basic phenotypes for 609 participants, genotypes of 314 participants, gut microbiome data generated by tag sequencing the 16S gene of feces from 315 participants and intestinal biopsies from 107 participants, and gut microbiome metagenomic sequencing of feces of 355 participants . Future releases will comprise many more additional phenotypes and -omics data layers. 1000IBD data can be used by other researchers as a replication cohort, a dataset to test new software tools, or a dataset for applying new statistical models.

  Study EGAS00001002702

• Defective Homologous Recombination DNA Repair as Therapeutic Target in Advanced-Stage Chordoma (HIPO_021)

  HIPO project: HIPO_021 Importance: Chordomas are rare tumors of the axial skeleton and skull base with few therapeutic options and no clinically validated molecular drug targets. The value of comprehensive genomic analyses for guiding medical therapy of patients with advanced-stage chordoma is unknown.Objective: To identify therapeutically tractable genetic lesions in a cohort of chordoma patients within a genomics-guided precision oncology program and to document the outcome of individualized, molecularly targeted chordoma therapy.Design, Setting, and Participants: We performed whole-exome sequencing of tumor and matched germline control samples from seven patients with locally advanced or metastatic chordoma who were enrolled in a cross-institutional molecular stratification registry trial for younger adults with advanced-stage cancer across all histologies and patients with rare tumors. All patients were heavily pretreated and had progressive disease prior to molecular analysis.Interventions: Individualized medical therapy was administered according to the patients’ molecular profiles.Main Outcomes and Measures: Candidate therapeutic targets identified by whole-exome sequencing and response to genotype-directed therapy.Results: All patients harbored alterations of two or more genes known to be involved in DNA repair via homologous recombination (HR), including heterozygous deletions of ERCC6, FANC family members, RAD51L (n = 6), BRCA2 (n = 5), ATR, CHEK2, RAD18, RAD51B, and XRCC3 (n = 4); inactivating PTEN mutations coupled with loss of heterozygosity (n = 2); and pathogenic germline variants in BRCA2 (n = 1), NBN (n = 1), and CHEK2 (n = 1) that were accompanied by somatic deletion of the corresponding wild-type alleles. Consistently, a mutational signature associated with defective HR was enriched in all samples and co-occurred with extensive genomic instability, as evidenced by HR deficiency scores and high numbers of large-scale state transitions. These results prompted off-label treatment with the poly(ADP-ribose) polymerase (PARP) inhibitor olaparib in a patient whose tumor was refractory to irradiation and systemic treatment with imatinib, which led to a prolonged response and substantial clinical improvement.Conclusions and Relevance: Advanced-stage chordomas are frequently characterized by genomic imprints of defective HR DNA repair. HR deficiency represents a new therapeutic opportunity in this intractable disease through repositioning of PARP inhibitors that warrants further exploration in clinical trials.

  Study EGAS00001002720

• Sensitive and robust liquid biopsy-based detection of PIK3CA mutations

  Over the last years, the treatment of hormone receptor-positive metastatic breast cancer patients has dramatically changed. Combination strategies attempting to overcome resistance to endocrine therapy such as targeting the PI3 kinase pathway are gaining importance. The phase III SOLAR-1 trial demonstrated the benefit of the addition of alpelisib to fulvestrant, thereby providing further clinical evidence of the increasing importance of PIK3CA testing. Here, we performed a comparison of liquid biopsy and tissue-based detection of PIK3CA mutations in HR-positive metastatic breast cancer patients. Plasma samples and the latest available tumor tissue from 69 patients with metastatic hormone-receptor positive breast cancer were analyzed for PIK3CA hotspot mutations. A high-resolution NGS assay (SiMSen-Seq) was used for plasma samples covering 11 recurrent PIK3CA mutations, used for stratification in SOLAR-1. Additionally, mFAST-SeqS was used to estimate the tumor fractions in the plasma samples. For tumor tissue samples, targeted Ion Torrent NGS was employed. Matched tissue and plasma samples were available from 63 patients. PIK3CA mutations were detected in 46.1% of the tissue samples and in 50.7% of the plasma samples. The variant allele frequency (VAF) ranged from 4.36% to 72.93% with a median of 28.60% in tissue samples, and from 0.28% to 49.85% with a median of 1.17% in plasma samples. The most frequent variants in tissue and plasma were H1047R, E545K, and E542K. We detected at least one of 11 PIK3CA mutations from the SOLAR-1 trial in 51/63 patients, both in tissue and plasma. In 7 patients, such mutations were found only in plasma. In 5 patients, PIK3CA mutations found in tissue were not detectable in ctDNA, 2 of which had a low tumor fraction.Together, in 33/67 plasma samples without detectable PIK3CA mutations, 18 samples had elevated tumor fraction, implicating true negative results. In the remaining 15 patients with low tumor fraction, additional tissue analysis was needed. SiMSen-Seq-based detection of PIK3CA mutations in plasma shows advantageous concordance with the tissue analyses. A combination with an untargeted, mutation-independent approach for detecting ctDNA fractions may confirm a negative PIK3CA result and thereby enhance the performance of the SiMSen-Seq test. This combinatory approach for selecting suitable patients for alpelisib treatment should be validated in larger patient cohorts.

  Study EGAS00001004940

• Study of Melanoma Risk in Australia and the United Kingdom

  The results from a small number of melanoma GWAS have been published. Initial studies identified several pigmentation- and nevus-associated loci that mediate an effect on melanoma risk, however, these studies were somewhat limited in that sample number (hence power) was low, they used first-generation low density SNP arrays, or used pools of DNA samples. Subsequently, additional melanoma GWAS have been completed, including a "Phase 2" study by the International Melanoma Genetics Consortium (GenoMEL), a full GWAS of the Australian sample resource previously used in a pooled-DNA GWAS, and study conducted through the MD Anderson Cancer Center and the Brigham and Women's Hospital. The groups who performed these studies have recently shared data and replicated a number of new melanoma susceptibility loci. Aside from the identification of novel loci, there are two additional notable outcomes of these studies. Firstly, an examination of the observed versus expected test statistics (Q-Q plot) from the Australian study, even after removing data from SNPs within known replicated susceptibility loci, reveals that there remains an excess of positive results. Similarly, the latest GenoMEL study finds almost three times as many SNPs reaching p-values between 10-4 and 10-5 as would be expected by chance. In the light of other studies of complex traits [1], these data suggest that studies based on additional melanoma samples from the same population are likely to identify an even larger "polygenic tail" and should prove invaluable in identifying and characterizing the underlying loci. A second observation, is that the effect size for replicated associations differs very little between GWAS. Given the strong effect of ultraviolet radiation (UVR) on risk of melanoma this might be expected to affect penetrance, particularly in the Australian and English samples, which are ethnically similar, but have very different sun exposures. We hypothesize that those SNPs whose effects are strongly mediated by UVR exposure may have smaller marginal effects on risk and are therefore harder to detect initially, suggesting a whole category of genetic effects that are unexplored.Indeed, most melanoma GWAS performed to date used samples from both European and Australian populations in discovery and or replication, and thus, existing studies have been poorly powered to detect associations with a wide difference in effect between these low- and high-UVR populations. Here, we wish to pursue this hypothesis further and plan to genotype additional cases drawn from the English and Australian populations. This will serve two complementary objectives: firstly, it will greatly increase our collective power to detect additional new melanoma risk alleles; secondly, it will highlight associations that are stronger specifically within the context of either low-UVR or high-UVR exposure environments. We posit that these data will be invaluable, not just for identifying novel melanoma-associated loci, but also for addressing gene-environment interactions. We have available a collection of valuable resources to help fulfill our aims. These include a considerable number of well-characterized and ungenotyped Australian and UK melanoma cases, as well as existing genotype data from sets of Australian and UK cases and population-based controls. We propose the following Specific Aims: To extend our current collective melanoma GWAS by genotyping a large number of additional UK and Australian cases. To jointly analyze these data and identify new melanoma risk loci. To determine whether pre-existing and new melanoma risk alleles show different degrees of association between the English and Australian populations, and assess whether these differences might be due to differences in sunlight exposure.

  Study phs000519

• A Genomic Atlas of Systemic Interindividual Epigenetic Variation in Humans (GTEx)

  Methylation of cytosines in CpG dinucleotides is an epigenetic mechanism with essential roles in mammalian development. To explore its functions in cellular differentiation, unbiased analysis of CpG methylation by whole genome bisulfite sequencing (WGBS) has been used to characterize epigenetic differences among different human tissues and cell types. Meanwhile, human interindividual variation in DNA methylation that is not cell-type specific has attracted relatively little attention. Systemic interindividual epigenetic variation is important, however, because like genetic variation it is a potential determinant of phenotypic variation and can be assessed in any easily obtainable DNA sample. Since systemic epigenetic variants originate in the preimplantation embryo, their establishment can be influenced by periconceptional environment, and potentially provide information about lifetime risks relevant to global health, obesity, and cancer. We elucidated systemic interindividual variation in CpG methylation in the human genome. We studied brain, heart, and thyroid tissues (representing all three germ layer lineages) from each of 10 donors in the NIH Gene-Tissue Expression (GTEx) project. We performed deep whole genome bisulfite sequencing for these 30 samples, achieving a sequencing depth of over 50x coverage per sample. We identified 9,926 correlated regions of systemic interindividual variation (CoRSIVs). These regions, comprising just 0.1% of the human genome, often correlate with one another over long genomic distances, are associated with transposable elements and subtelomeric regions, conserved across various human ethnic groups, and particularly sensitive to periconceptional environment. While genetic variation appears to influence methylation at most CoRSIVs, many show no evidence of genetic influence, suggestive of 'pure' epigenetic variation. At CoRSIVs, interindividual variation in DNA methylation in an easily biopsied tissue predicts expression in other tissues, and genes associated with these loci are implicated in a range of human disorders. In addition to charting a previously unrecognized molecular level of human individuality, this atlas of human CoRSIVs provides a resource for future population-based investigations into how interindividual epigenetic variation modulates risk of disease.Version 2 now also includes Target Capture Sequencing of CoRSIVs in 808 tissues (188 GTEx Donors). Focusing on the CoRSIVs identified by analyzing WGBS data, a Target Capture Bisulfite sequencing assay was developed. Using the genotype data of 188 GTEx donors, we assessed mQTL by capturing a 1MB region at each CoRSIV and quantifying methylation by Bisulfite-seq. The Target Capture Bisulfite sequencing data will be available to download via the AnVIL project.

  Study phs001746