10984 results for "monedas ultimate team FC 26 Visité Buyfc26coins.com. Servicio premium a un precio estándar. Increíble..XLis"

in 25.10 milliseconds.

• Knoll et al.: The life-saving benefit of dexamethasone in severe COVID-19 is linked to a reversal of monocyte dysregulation

  Following the demonstration of its life-saving effect in clinical trials, dexamethasone quickly became standard-of-care in the treatment of severe COVID-19. Beneficial effects were reported for patients requiring supplemental oxygen or invasive mechanical ventilation. Yet, a substantial proportion of patients still progressed to a critical condition or succumbed to the disease, despite timely initiation of glucocorticoid treatment. No molecular or cellular correlate of this beneficial treatment response has been defined. Here, we identify distinct cellular and molecular changes in circulating immune cells in patients with COVID-19 elicited in response to dexamethasone treatment. The most profound transcriptional changes in response to dexamethasone treatment were noted in monocytes and in B cells. In monocytes, we observed a reversal of hallmark signatures previously associated with COVID-19 severity, and the induction of a specific monocyte substate enriched in glucocorticoid response gene expression which we here refer to as dexamethasone response cluster. Molecular responses to dexamethasone treatment were directly linked to clinical outcome, since the reversal of pathogenic signatures and induction of glucocorticoid response genes were enriched in patients who survived the disease in response to dexamethasone treatment. Cellular responsiveness of circulating monocytes was thus identified as a correlate of clinical response to dexamethasone treatment. Changes in monocyte transcriptomes could also be linked to epigenetic alterations highlighting early differences in monocytes of dexamethasone responders and non-responders. Further, monocyte single-cell transcriptome-derived signatures were enriched in whole blood transcriptomes from patients with fatal outcome in two independent cohorts, highlighting the potential clinical value for early identification of non-responders who are refractory to dexamethasone treatment. Overall, our findings indicate that the life-saving effects of dexamethasone in COVID-19 patients are linked to a specific immunomodulatory effect based on the reversion of monocyte dysregulation. Our study elucidates the potential mechanism of action of one of the most efficient and cost-effective drugs for the treatment of COVID-19. It further highlights the potential of single-cell omics for monitoring target engagement of immunomodulatory drugs and for the stratification of patients for precision medicine approaches.

  Study EGAS00001007461

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - RNAseq

  Ependymomas (EPN) are the third most common malignant brain cancer in children. Treatment strategies for pediatric EPN have remained unchanged over recent decades, with 10-year survival rates stagnating at just 67% for children aged 0-14 years. Moreover, patients who survive treatment for the most common subtype of pediatric EPN (posterior fossa A (PFA)), often suffer long-term neurological side effects as a result of therapy. It is evident that there is a need for safer, more effective treatments for pediatric EPN patients. There are ten distinct subgroups of EPN, each with their own molecular and prognostic features. To identify and facilitate the testing of new treatments for EPN, in vivo laboratory models representative of the diverse molecular subtypes are required. Here, we describe the establishment of a patient-derived orthotopic xenograft (PDOX) model of PFA EPN, derived from a metastatic cranial lesion. Patient and PDOX tumors were analyzed using immunohistochemistry, DNA methylation profiling, whole genome sequencing (WGS) and RNA sequencing. Both patient and PDOX tumors classified as PFA EPN by methylation profiling, and shared similar histological features consistent with this molecular subgroup. RNA sequencing revealed that gene expression patterns were maintained across the primary and metastatic tumors, as well as the PDOX. Copy number profiling revealed gains of chromosomes 7, 8 and 19, and loss of chromosomes 2q and 6q in the PDOX and matched patient tumor. No clinically significant single nucleotide variants were identified, consistent with the low mutation rates observed in PFA EPN. Overexpression of EZHIP RNA and protein, a common feature of PFA EPN, was also observed. Despite the aggressive nature of the tumor in the patient, this PDOX was unable to be maintained past two passages in vivo. Others who have successfully developed PDOX models report some of the lowest success rates for EPN compared to other pediatric brain cancer types attempted, with loss of tumorigenicity not uncommon, highlighting the challenge in propagating these tumors in the laboratory. Here, we discuss our collective experiences with PFA EPN PDOX model generation and propose potential approaches to improve future success in establishing preclinical EPN models

  Study EGAS00001006844

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-RW9277

  WGS and RNA-Seq data from a GBM patient PT-RW9277

  Dataset EGAD00001004259

• Genome and transcriptome sequence data from a diffuse aarge B-cell lymphoma (relapse) tumor patient

  Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015308

• Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm tumor patient

  Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015312

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor tumor patient

  Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015322

• Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour tumor patient

  Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015327

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Study of Melanoma Risk in Australia and the United Kingdom

  The results from a small number of melanoma GWAS have been published. Initial studies identified several pigmentation- and nevus-associated loci that mediate an effect on melanoma risk, however, these studies were somewhat limited in that sample number (hence power) was low, they used first-generation low density SNP arrays, or used pools of DNA samples. Subsequently, additional melanoma GWAS have been completed, including a "Phase 2" study by the International Melanoma Genetics Consortium (GenoMEL), a full GWAS of the Australian sample resource previously used in a pooled-DNA GWAS, and study conducted through the MD Anderson Cancer Center and the Brigham and Women's Hospital. The groups who performed these studies have recently shared data and replicated a number of new melanoma susceptibility loci. Aside from the identification of novel loci, there are two additional notable outcomes of these studies. Firstly, an examination of the observed versus expected test statistics (Q-Q plot) from the Australian study, even after removing data from SNPs within known replicated susceptibility loci, reveals that there remains an excess of positive results. Similarly, the latest GenoMEL study finds almost three times as many SNPs reaching p-values between 10-4 and 10-5 as would be expected by chance. In the light of other studies of complex traits [1], these data suggest that studies based on additional melanoma samples from the same population are likely to identify an even larger "polygenic tail" and should prove invaluable in identifying and characterizing the underlying loci. A second observation, is that the effect size for replicated associations differs very little between GWAS. Given the strong effect of ultraviolet radiation (UVR) on risk of melanoma this might be expected to affect penetrance, particularly in the Australian and English samples, which are ethnically similar, but have very different sun exposures. We hypothesize that those SNPs whose effects are strongly mediated by UVR exposure may have smaller marginal effects on risk and are therefore harder to detect initially, suggesting a whole category of genetic effects that are unexplored.Indeed, most melanoma GWAS performed to date used samples from both European and Australian populations in discovery and or replication, and thus, existing studies have been poorly powered to detect associations with a wide difference in effect between these low- and high-UVR populations. Here, we wish to pursue this hypothesis further and plan to genotype additional cases drawn from the English and Australian populations. This will serve two complementary objectives: firstly, it will greatly increase our collective power to detect additional new melanoma risk alleles; secondly, it will highlight associations that are stronger specifically within the context of either low-UVR or high-UVR exposure environments. We posit that these data will be invaluable, not just for identifying novel melanoma-associated loci, but also for addressing gene-environment interactions. We have available a collection of valuable resources to help fulfill our aims. These include a considerable number of well-characterized and ungenotyped Australian and UK melanoma cases, as well as existing genotype data from sets of Australian and UK cases and population-based controls. We propose the following Specific Aims: To extend our current collective melanoma GWAS by genotyping a large number of additional UK and Australian cases. To jointly analyze these data and identify new melanoma risk loci. To determine whether pre-existing and new melanoma risk alleles show different degrees of association between the English and Australian populations, and assess whether these differences might be due to differences in sunlight exposure.

  Study phs000519

• Genome-Wide Association Study of Breast Cancer in the African Diaspora - the ROOT study

  The paucity of data on the genetic epidemiology of breast cancer for racial/ethnic groups other than those of European ancestry hinders the development of innovative interventions to reduce health disparities. Women in the African Diaspora experience a disproportionate burden of pre-menopausal breast cancer in comparison to all other races for reasons that remain unknown and understudied. This higher proportion of early-onset breast cancer might suggest a stronger genetic component in these populations. Genome-wide association studies (GWAS) have revealed several genetic loci that confer risk of breast cancer. Because all GWAS started the discovery stage in women of European ancestry and replicated mainly in women of European ancestry, we propose a novel approach for a GWAS in indigenous African women to identify alleles associated with breast cancer risk which will then be replicated in other populations. This innovative design builds on our current understanding of the etiologic heterogeneity in breast cancer and the distribution of breast cancer molecular subtypes which differ between women of African ancestry and women of European ancestry. The major objective of the proposed studies is to get to the "root" causes of breast cancer by identifying breast cancer risk alleles in a pooled sample of women of African ancestry and to replicate our findings in other populations. To achieve this objective, we conducted a case control study of breast cancer in women of African ancestry, including Africans living in Nigeria, African Americans and African Barbadians. We will genotype ~3800 individuals using the Illumina HumanOmni2.5-Quad platform. We will conduct both standard and novel genetic analyses of the data to map genes associated with breast cancer susceptibility, verify genotyping and carry out fine-mapping studies in genes or regions showing association with breast cancer risk, and replicate in other African American and non-African American populations. By pooling unique resources from studies throughout the African Diaspora, this study has the potential to identify risk alleles in several genes that contribute to increased breast cancer risk and may have implications for early detection, prognosis and treatment of breast cancer in ALL women. This should ultimately lead to improved outcomes for those who suffer a disproportionate burden of early-onset breast cancer.

  Study phs000383

• Foregut Microbiome in Development of Esophageal Adenocarcinoma

  The distal esophagus is an important anatomical area where gastric acid reflux can cause reflux esophagitis (RE), Barrett's esophagus (BE) (intestinal metaplasia), and esophageal adenocarcinoma (EA). The incidence of EA has increased 6-fold in the U.S. since the 1970s, parallel to a significant increase in the prevalence of gastroesophageal reflux diseases (GERD). Although specific host factors might predispose one to disease risk, such a rapid increase in incidence must be predominantly environmental. The cause remains unknown. Our hypothesis is that changes in the foregut microbiome are associated with EA and its precursors, RE and BE in the GERD sequence. We will conduct a case control study to characterize the microbiome in every stage of the GERD sequence as well as analyze the trend in changes in the microbiome along disease progression toward EA. Specific Aim 1. To conduct a comprehensive population survey of the foregut microbiome and demonstrate its association with GERD sequence, by a 16S rRNA gene survey. We will analyze samples of the foregut microbiome at three anatomic loci: mouth, distal esophagus, and gastric corpus. Changes of the microbiota in the distal esophagus will be correlated with the phenotypes. Spatial relationship between the esophageal microbiota and upstream (mouth) and downstream (stomach) foregut microbiotas as well as temporal stability of the microbiome-disease association will also be examined. Specific Aim 2. To define distal esophageal metagenome and demonstrate its association with GERD sequence, by shotgun metagenomic analysis. We will first classify samples of the metagenome into metagenotypes by between-sample k-mer distance and correlate the metagenotypes with the four phenotypes. Subsequent detailed analyses will include pathway-disease and gene-disease associations. DNA viruses and fungi, if identified, also will be correlated with the phenotypes. A significant association between the foregut microbiome composition and GERD sequence, if demonstrated, will be the first step for eventually testing the causal hypothesis that an abnormal microbiome is required for the development of the sequence of phenotypic changes toward EA. If EA and its precursors represent a microbial ecological disease, treating the cause of GERD might become possible, for example, by normalizing the microbiome through use of antibiotics, probiotics, or prebiotics. Causative therapy for GERD could prevent its progression and reverse the current trend of increasing incidence of EA.

  Study phs000260

• Kids First: The Genomic Basis of Structural Birth Defects Associated with Chromosome 18 Copy Number Changes

  Chromosome abnormalities are a common cause of structural birth defects. Both childhood cancers and structural birth defects are critical and costly conditions associated with substantial morbidity and mortality. Elucidating the underlying genetic etiology of these diseases has the potential to profoundly improve preventative measures, diagnostics, and therapeutic interventions.However, because these genomic copy number changes involve multiple genes and because most of these conditions are individually rare, defining the specific causative genes behind specific phenotypes has been a challenge. We met that challenge by spending the last 28 years enrolling and evaluating anyone with a chromosome 18 abnormality. The cohort now includes over 700 individuals with a wide variety of chromosome 18 copy number changes (CNV), as well as their parents. Because the vast majority of these participants have individually unique CNVs, we have been able to perform extensive genotype-phenotype correlations resulting in 58 publications. Of the 263 genes on chromosome 18, 28 are linked to specific hemizygous phenotypes. However, most have low penetrance. Genomic sequence data could identify variants in the extant allele that are hypermorphic and compensate for hemizygosity, or are hypomorphic and exacerbate hemizygosity. Additionally, there are phenotypes within this cohort that are rare, or an extreme version of one of the more common phenotypes. Genomic sequence data could help discover new biallelic conditions by revealing functional sequence variants of the extant allele. In both of these cases, there could also be variants in other genes on other chromosomes that may be associated with the phenotype that confer susceptibility or resilience. Inclusion of this unique cohort in the Gabriella Miller Kids First Pediatric Research Program can advance the goals of the program in several ways. First, by adding known susceptibility loci to the existing Kids First cohorts for the structural birth defects that are also found in our cohort. Second, for those structural birth defects known to be polygenetic, this cohort has a single defined risk factor which can simplify the search for secondary factors. Third, these studies can also bring clarity to people with chromosome 18 conditions and help to make the genotype more accurately predict phenotype. This approach could be a model for understanding the many other rare chromosome abnormalities which collectively are a common cause of structural birth defects.

  Study phs002627

• Immune-Related Adverse Events after Immune Checkpoint Blockade-Based Therapy are Associated with Improved Survival in Advanced Sarcoma

  Immune activation after immune checkpoint blockade (ICB) can lead to a unique group of adverse events (AEs), which have been associated with improved outcome in many carcinomas. The association between immune-related AEs (irAEs) and outcome in patients with sarcoma is not well studied. This study has two components: (1) a retrospective clinical study of irAEs among 131 patients treated with ICB at Memorial Sloan Kettering Cancer Center and (2) an analysis of a subset of these patients who have whole transcriptome sequencing available for analysis. In the clinical study portion, we reviewed a cohort of patients with advanced sarcoma treated on prospective clinical trials utilizing ICB-based therapy between April 2017 and January 2020. The objectives were to pool the safety data from each trial, identify irAEs, and correlate them with best overall response by RECIST 1.1, progression-free survival (PFS) and overall survival (OS). Association of irAEs with response and survival was assessed using a Cox regression model. A total of 131 patients were included. Forty-two (32%) had at least one irAE of any grade and 16 (12%) had at least one Grade ≥ 3 irAE. On Cox analysis adjusting for clinical covariates that were significant in the univariate setting, the hazard ratio (HR) for an irAE (HR 0.662, 95% CI 0.421 - 1.041) approached, but did not reach statistical significance for PFS (P = 0.074), while patients had a significantly lower HR for OS (HR 0.443, 95% CI 0.246 – 0.798; P = 0.007) compared to those without or before an irAE. Tumor samples with available RNA sequencing data were stratified by presence of an irAE to identify patterns of differential gene expression. In total, 71 unique patients had RNA sequencing available for analysis. The transcriptomes of 31 of these patients have been previously uploaded to dbGaP (phs002852), leaving 36 unique transcriptomes that have not been previously publicly shared. Three patients did not agree for their sequencing to be publicly shared. Therefore, 33 unique patient samples will be uploaded to this dbGaP study. Overall, this study found that gene expression profiling on baseline tumor samples from patients who had an irAE had higher numbers of tumor-infiltrating dendritic cells, CD8+ T cells, and regulatory T cells as well as upregulation of immune and inflammatory pathways.

  Study phs003284

• Whole Blood Transcriptomics of Patients With Melioidosis

  Melioidosis is a neglected tropical infection caused by the Gram negative bacterium Burkholderia pseudomallei that is associated with high mortality rates in southeast Asia. The goal of this study was to a) identify human blood leukocyte transcriptomic features and pathways specific to melioidosis (vs other etiologies of infection), b) identify transcriptomic features and pathways specific to fatal melioidosis, and c) identify transcriptomic predictors of death in patients with melioidosis. This study used clinical data and whole blood leukocyte samples from a subset of participants in the Ubon Sepsis Study, a prospective single-center cohort study conducted at Sunpasitthiprasong Hospital, Ubon Ratchathani, Thailand between 2013 and 2017. Participants in the Ubon Sepsis Study had suspected or documented infection with accompanying systemic manifestations of infection and were enrolled, with blood sampling, within 24 hours of admission to the study hospital. Enrolled patients were followed over time and vital status was determined at 28 days after enrollment. The subset of participants from the parent Ubon Sepsis Study cohort selected for this study was comprised of 164 patients with melioidosis (defined as having a culture of clinical sample positive for B. pseudomallei), 35 patients with Gram negative bacteremia due to either Escherichia coli or Klebsiella pneumoniae, 16 patients with Gram positive bacteremia due to Staphylococcus aureus, and 19 patients who had negative blood cultures and no clinical sample culture-positive for B. pseudomallei. Fifty uninfected control patients with or without diabetes were recruited from the outpatient department and blood donation center at Udon Thani hospital, Udon Thani, Thailand from 2018 to 2019. Blood was collected at the time of enrollment in Tempus Blood RNA tubes. RNA was extracted using the Tempus Spin RNA Isolation kit. RNA sequencing (RNA-Seq) was performed at the University of Washington Northwest Genomics Center. Analysis was performed using a variety of statistical methods. The main finding of the study was that the transcriptomes of melioidosis patients, compared to patients with other infections, were characterized by upregulation of interferon signaling. The transcriptomes of patients with fatal melioidosis were notable for upregulation of inflammatory and type 2 immune responses and downregulation of genes related to T-cell function. A five-gene (EPHB1, SYCP2L, MERTK, IL5RA, and SPOCK1) predictive signature for death in melioidosis was developed.

  Study phs003724

• Kids First: Genetics of Pediatric Germ Cell Tumors

  The Gabriella Miller Kids First Pediatric Research Program (Kids First) is a trans-NIH effort initiated in response to the 2014 Gabriella Miller Kids First Research Act and supported by the NIH Common Fund. This program focuses on gene discovery in pediatric cancers and structural birth defects and the development of the Gabriella Miller Kids First Pediatric Data Resource (Kids First Data Resource). All of the genomic and phenotypic data from this study are accessible through dbGaP. The data is also available at the Kids First Portal, where other Kids First datasets can also be accessed in the cloud for data analysis, data visualization, collaboration and interoperability, open to all researchers and developers.Pediatric malignant germ cell tumors (GCTs) represent approximately 6% of childhood cancers, including 3% of tumors in children aged 0-14 years and 15% of tumors in adolescents. GCTs are heterogeneous and grouped together due to the presumed common cell of origin, the primordial germ cell (PGC). GCTs typically occur in the testes or ovaries; however, extragonadal GCTs can occur and are likely a result of abnormal germ cell migration during development. Evidence suggests that GCTs, including those diagnosed in adults, are initiated in utero. Thus, alterations in normal embryonic development are likely to be especially relevant to GCT etiology. Germline susceptibility has not been evaluated in an agnostic fashion in pediatric GCT, mainly due to a lack of an adequate number of samples; however, emerging evidence supports a genetic etiology.In the two Kids First GCT projects, we will evaluate genetic susceptibility to intracranial and extracranial GCT by sequencing probands and their unaffected parents. The goals of the project are to: 1) evaluate the contribution of rare genetic variants in GCT through the use of aggregate burden tests, focusing on genes and established regulatory regions; 2) identify de novo SNVs and CNVs in pediatric GCT using a case-parent triad design; and 3) identify molecular signatures in GCT tumor specimens, overall and by age group and tumor characteristics. Whole Genome Sequencing (WGS) data generated through the Gabriella Miller Kids First Pediatric Research Program will provide an opportunity to investigate the genetic origins of GCT in a diverse set of samples. Given the limited knowledge of GCT etiology and biology, the results of the proposed analyses are likely to have a big impact on the field.

  Study phs002322

• Sensitive and robust liquid biopsy-based detection of PIK3CA mutations

  Over the last years, the treatment of hormone receptor-positive metastatic breast cancer patients has dramatically changed. Combination strategies attempting to overcome resistance to endocrine therapy such as targeting the PI3 kinase pathway are gaining importance. The phase III SOLAR-1 trial demonstrated the benefit of the addition of alpelisib to fulvestrant, thereby providing further clinical evidence of the increasing importance of PIK3CA testing. Here, we performed a comparison of liquid biopsy and tissue-based detection of PIK3CA mutations in HR-positive metastatic breast cancer patients. Plasma samples and the latest available tumor tissue from 69 patients with metastatic hormone-receptor positive breast cancer were analyzed for PIK3CA hotspot mutations. A high-resolution NGS assay (SiMSen-Seq) was used for plasma samples covering 11 recurrent PIK3CA mutations, used for stratification in SOLAR-1. Additionally, mFAST-SeqS was used to estimate the tumor fractions in the plasma samples. For tumor tissue samples, targeted Ion Torrent NGS was employed. Matched tissue and plasma samples were available from 63 patients. PIK3CA mutations were detected in 46.1% of the tissue samples and in 50.7% of the plasma samples. The variant allele frequency (VAF) ranged from 4.36% to 72.93% with a median of 28.60% in tissue samples, and from 0.28% to 49.85% with a median of 1.17% in plasma samples. The most frequent variants in tissue and plasma were H1047R, E545K, and E542K. We detected at least one of 11 PIK3CA mutations from the SOLAR-1 trial in 51/63 patients, both in tissue and plasma. In 7 patients, such mutations were found only in plasma. In 5 patients, PIK3CA mutations found in tissue were not detectable in ctDNA, 2 of which had a low tumor fraction.Together, in 33/67 plasma samples without detectable PIK3CA mutations, 18 samples had elevated tumor fraction, implicating true negative results. In the remaining 15 patients with low tumor fraction, additional tissue analysis was needed. SiMSen-Seq-based detection of PIK3CA mutations in plasma shows advantageous concordance with the tissue analyses. A combination with an untargeted, mutation-independent approach for detecting ctDNA fractions may confirm a negative PIK3CA result and thereby enhance the performance of the SiMSen-Seq test. This combinatory approach for selecting suitable patients for alpelisib treatment should be validated in larger patient cohorts.

  Study EGAS00001004940

• Molecular_characterization_of_invasive_lobular_carcinoma

  Invasive lobular carcinoma (ILC) is the second most common histological subtype of breast cancer accounting for 10-15% of cases. ILC differs from invasive ductal carcinoma (IDC)with respect to epidemiology, histology, and clinical presentation. Moreover, ILC is lesssensitive to chemotherapy, more frequently bilateral, and more prone to form gastrointestinal, peritoneal, and ovarian metastases than IDCs. In contrast to IDC, the prognostic value ofhistological grade (HG) in ILC is controversial. One of the three major components of histological grading (tubule formation) is missing in ILC which hinders the process of gradingin this histological subtype and results in the classification of approximately two thirds of ILC as HG 2.Over the last decade, a number of gene expression signatures have shed light onto breast cancer classification, allowing breast cancer care to become more personalized. Withrespect to the management of estrogen receptor (ER)-positive breast cancer, several gene expression signatures provide prognostic and/or predictive information beyond what is possible with current classical clinico-pathological parameters alone. Nevertheless, most studies using gene expression signature have not considered different histologic subtypesseparately. Recently, a comprehensive research program has elucidated some of the biological underpinnings of invasive lobular carcinoma. Genetic material extracted from 200 ILC tumor samples were studied using gene expression profiling and identified ILCmolecular subtypes. These proliferation-driven gene signatures of ILC appear to have prognostic significance. In particular, the Genomic Grade (GG) gene signature improved upon HG in ILC and added prognostic value to classic clinico-pathologic factors. In addition this study demonstrated that most ILC are molecularly characterized as luminal-A (~75%)followed by luminal-B (~20%) and HER2-positve tumors (~5%). Moreover, we investigated the prognostic value of known gene signatures/ gene modules in the same cohort of ILC. As a second step within the scope of this project, we aim to investigate the interactionsbetween somatic ILC tumor mutations to observed transcriptome findings. To this end, we aim to perform somatic mutation analysis for the ILC tumors for which Affymetrix gene expression profiling is available. To this end, we will use a gene screen assay, which specifically interrogates the mutational status of a few hundreds of cancer genes. We believe that this pioneering effort will be fundamental for a tailored treatment of ILC withimprovement in patients' outcome.

  Study EGAS00001000292

• Multi-omics data of 1000 Inflammatory Bowel Disease patients

  Portal available at https://1000ibd.org Inflammatory bowel disease (IBD) is a chronic complex disease of the gastrointestinal (GI) tract. Patients with IBD can experience a wide range of symptoms, but the pathophysiological mechanisms that cause these individual differences in clinical presentation remain largely unknown. In consequence, IBD is currently classified into subtypes using clinical characteristics. If we are to develop a more targeted treatment approach, molecular subtypes of IBD need to be discovered that can be used as new drug targets. To achieve this, we need multiple layers of molecular data are generated from the same IBD patients.We initiated the 1000IBD project to prospectively follow more than 1000 IBD patients from the Northern provinces of the Netherlands. For these patients, we have collected a uniquely large number of phenotypes and generated multi-omics profiles. To date, 1,215 participants have been enrolled in the project and enrolment is on-going, with 609 patients being present in the first data release. Phenotype data collected for these participants includes information on dietary and environmental factors, drug responses, and adverse drug events. Genome information has been generated using genotyping (ImmunoChip, Global Screening Array and HumanExomeChip) and sequencing (whole exome sequencing and targeted resequencing of IBD susceptibility loci), transcriptome information generated using RNA-sequencing of intestinal biopsies and microbiome information generated using both sequencing of the 16S rRNA gene and whole genome shotgun metagenomic sequencing.All molecular data generated within the 1000IBD project will be shared in multiple data on the European Genome-Phenome Archive (www.ega-archive.org). The first data release, will contain basic phenotypes for 609 participants, genotypes of 314 participants, gut microbiome data generated by tag sequencing the 16S gene of feces from 315 participants and intestinal biopsies from 107 participants, and gut microbiome metagenomic sequencing of feces of 355 participants . Future releases will comprise many more additional phenotypes and -omics data layers. 1000IBD data can be used by other researchers as a replication cohort, a dataset to test new software tools, or a dataset for applying new statistical models.

  Study EGAS00001002702

• Defective Homologous Recombination DNA Repair as Therapeutic Target in Advanced-Stage Chordoma (HIPO_021)

  HIPO project: HIPO_021 Importance: Chordomas are rare tumors of the axial skeleton and skull base with few therapeutic options and no clinically validated molecular drug targets. The value of comprehensive genomic analyses for guiding medical therapy of patients with advanced-stage chordoma is unknown.Objective: To identify therapeutically tractable genetic lesions in a cohort of chordoma patients within a genomics-guided precision oncology program and to document the outcome of individualized, molecularly targeted chordoma therapy.Design, Setting, and Participants: We performed whole-exome sequencing of tumor and matched germline control samples from seven patients with locally advanced or metastatic chordoma who were enrolled in a cross-institutional molecular stratification registry trial for younger adults with advanced-stage cancer across all histologies and patients with rare tumors. All patients were heavily pretreated and had progressive disease prior to molecular analysis.Interventions: Individualized medical therapy was administered according to the patients’ molecular profiles.Main Outcomes and Measures: Candidate therapeutic targets identified by whole-exome sequencing and response to genotype-directed therapy.Results: All patients harbored alterations of two or more genes known to be involved in DNA repair via homologous recombination (HR), including heterozygous deletions of ERCC6, FANC family members, RAD51L (n = 6), BRCA2 (n = 5), ATR, CHEK2, RAD18, RAD51B, and XRCC3 (n = 4); inactivating PTEN mutations coupled with loss of heterozygosity (n = 2); and pathogenic germline variants in BRCA2 (n = 1), NBN (n = 1), and CHEK2 (n = 1) that were accompanied by somatic deletion of the corresponding wild-type alleles. Consistently, a mutational signature associated with defective HR was enriched in all samples and co-occurred with extensive genomic instability, as evidenced by HR deficiency scores and high numbers of large-scale state transitions. These results prompted off-label treatment with the poly(ADP-ribose) polymerase (PARP) inhibitor olaparib in a patient whose tumor was refractory to irradiation and systemic treatment with imatinib, which led to a prolonged response and substantial clinical improvement.Conclusions and Relevance: Advanced-stage chordomas are frequently characterized by genomic imprints of defective HR DNA repair. HR deficiency represents a new therapeutic opportunity in this intractable disease through repositioning of PARP inhibitors that warrants further exploration in clinical trials.

  Study EGAS00001002720

• CRCbiome: Gut metagenome of Norwegian screening participants using FIT sampling

  The study aims to characterize the gut metagenome of Norwegian screening participants and assess the ability of the gut metagenome to identify those at need for colonoscopy. Background: Colorectal cancer (CRC) screening reduces CRC incidence and mortality. However, current screening methods are either hampered by invasiveness or suboptimal performance, limiting their effectiveness as primary screening methods. To aid in the development of a non-invasive screening test with improved sensitivity and specificity, we have initiated a prospective biomarker study (CRCbiome), nested within a large randomized CRC screening trial in Norway. We aim to develop a microbiome-based classification algorithm to identify advanced colorectal lesions in screening participants testing positive for an immunochemical fecal occult blood test (FIT). We will also examine interactions with host factors, diet, lifestyle and prescription drugs. The prospective nature of the study also enables the analysis of changes in the gut microbiome following the removal of precancerous lesions. Methods: The CRCbiome study recruits participants enrolled in the Bowel Cancer Screening in Norway (BCSN) study, a randomized trial initiated in 2012 comparing once-only sigmoidoscopy to repeated biennial FIT, where women and men aged 50–74 years at study entry are invited to participate. Since 2017, participants randomized to FIT screening with a positive test result have been invited to join the CRCbiome study. Self-reported diet, lifestyle and demographic data are collected prior to colonoscopy after the positive FIT-test (baseline). Screening data, including colonoscopy findings are obtained from the BCSN database. Fecal samples for gut microbiome analyses are collected both before and 2 and 12 months after colonoscopy. Samples are analyzed using metagenome sequencing, with taxonomy profiles, and gene and pathway content as primary measures. CRCbiome data will also be linked to national registries to obtain information on prescription histories and cancer relevant outcomes occurring during the 10 year follow-up period. Discussion: The CRCbiome study will increase our understanding of how the gut microbiome, in combination with lifestyle and environmental factors, influences the early stages of colorectal carcinogenesis. This knowledge will be crucial to develop microbiome-based screening tools for CRC. By evaluating biomarker performance in a screening setting, using samples from the target population, the generalizability of the findings to future screening cohorts is likely to be high.

  Study EGAS50000000170

• NHLBI TOPMed: Defining the Time-Dependent Genetic and Transcriptomic Responses to Cardiac Injury Among Patients with Arrhythmias

  The UMMS miRhythm Study is an ongoing study of adult patients undergoing an elective electrophysiology study or arrhythmia ablation procedure for a supraventricular or ventricular arrhythmia, including atrial fibrillation (AF). Atrial fibrillation is a major clinical and public health problem that is related to atrial pathologic remodeling. Few tools are available to quantify the activity or extent of this remodeling, rendering it difficult to identify individuals at risk for AF. Previous studies have suggested an important role for miRNA in cardiovascular disease through gene expression regulation, making this a promising avenue for studying AF mechanisms. The aim of the study is to determine the time-dependent changes to key circulating miRNAs in a model of planned atrial injury and remodeling via ablation. Such knowledge might provide additional insight into the biology and activity of the acute atrial injury response, and furthermore, inform new targets for development of preventative interventions or allow for better AF risk stratification. To assess pathways regulating atrial pathological remodeling, patient blood samples are collected prior to their ablation procedures and also at a regularly scheduled 1-month follow-up appointment. Plasma expression of miRNA is measured using high-throughput quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), providing novel insights into the regulatory processes underlying AF, as well as acute atrial injury in vivo. Additionally, data collected from whole-genome sequencing (WGS) is used to supplement miRNA analyses and further explore new relations between genes and abnormal heart rhythm.

  Study phs001434

• Breast Cancer Family Registry

  The Breast Cancer Family Registry (BCFR) is a multi-center prospective cohort, comprised of over 30,000 women and men from nearly 12,000 families from the United States, Canada, and Australia. Our BCFR resource has been used, and continues to be used, by breast cancer researchers around the world in order to find new ways to prevent, diagnose, and treat cancer. The BCFR provides an extensive and diverse range of resources, expertise, and specialized skills, and has several unique strengths: 1) the collection of a large number of individuals and families across a wide spectrum of breast cancer risk, including both affected and unaffected individuals; 2) the large collection of families with early-onset breast cancer; 3) the large collection of racial/ethnic minority families not replicated elsewhere; 4) the extensive molecular characterization performed to date; and 5) active follow-up of both probands and family members. Thus, the BCFR comprises a unique cohort of probands and family members at familial/genetic risk of breast cancer that will continue to facilitate a wide range of research studies, such as gene discovery, examination of cancer-related outcomes and risk factors in high-risk subjects, investigation of novel behavioral interventions, and cancer prevention trials among at-risk family members. Consequently, the BCFR Cohort, as one of the few cohorts available worldwide with biospecimens and extensive molecular and genetic characterization, combined with epidemiologic data and long-term follow up, will be an invaluable resource for translational research in the genetic epidemiology of breast cancer.

  Study phs002835

• Clonally selected lines after CRISPR/Cas editing are not isogenic

  The CRISPR-Cas9 system has enabled researchers to precisely modify/edit the sequence of a genome. A typical editing experiment consists of two steps: (i) editing cultured cells and (ii) selection of clones, which are presumed to be isogenic, with and without the intended edit. The application of the CRISPR-Cas9 system may result in off-target edits, while cloning would reveal culture-acquired mutations. We analyzed the extent of the former and of the latter by whole genome sequencing (WGS) involving separate genomic loci in three experiments conducted by three independent laboratories. In all experiments we hardly found any off-target edits, while we detected hundreds to thousands of single nucleotide mutations unique to each clone after relatively short culture of 10-20 passages. Notably, clones also differed in copy number alterations that were several kb to several mb in size, representing the largest source of genomic divergence among clones. This study in dbGaP includes data from experiments carried out by investigators at the Oklahoma Medical Research Foundation and Baylor College of Medicine (OMRF/BCM) involving an iPSC line derived from fibroblasts of a female patient (line c7) carrying a constitutional heterozygous variant (chr1:1,464,679 C>T; GRCh37) in exon 15 of the ATPase family, AAA domain containing 3A (ATAD3A) gene. The parental line was edited by introducing a double stranded break at the variant allele to correct the variant by homology directed repair. Two unedited control clones (clone7 and clone8) and one edited clone (SC20) were selected for WGS.

  Study phs003110

• eMERGE: Genetics of Complex Pediatric Disorders from the Center for Applied Genomics

  The Center for Applied Genomics (CAG) is a specialized Center of Emphasis at the Children's Hospital of Philadelphia (CHOP) with the primary goal of translating basic research findings to medical innovations. The mission of CAG is to develop new and better ways to diagnose and treat children affected by rare and complex medical disorders. We aim to discover genetic causes for the most prevalent diseases of childhood including asthma, autism, diabetes, epilepsy, obesity, schizophrenia, pediatric cancer, and a range of rare diseases. Ultimately, our objective is to generate new diagnostic tests and to guide physicians to the most appropriate therapies. The CAG is one of the world's largest genetics research programs in pediatrics, and the only center at a pediatric hospital to have established a large-scale biobank of genotyped samples. The electronic Medical Records and Genomics (eMERGE) Network is a consortium of 9 clinical sites with EMR linked DNA biobanks, including Northwestern University and its NUgene biobank, funded by the NHGRI (National Human Genome Research Institute) to investigate the use of electronic medical record systems for genomic research. The goal of eMERGE is to conduct genome-wide association studies in approximately 100,000 individuals using EMR-derived phenotypes and DNA from linked biorepositories. Using electronic phenotyping methods, the consortium has been and is using DNA samples from all participating sites to explore the genetic determinants of approximately 80 phenotypes, including both diseases and traits, for which the electronic phenotyping algorithms have or are being published on PheKB.org.

  Study phs001165

• The Neonatal Microbiome and Necrotizing Enterocolitis

  The Neonatal Microbiome and Necrotizing enterocolitis (NEC) study is a multi-centered case control study testing the hypothesis that NEC is a direct or indirect consequence of the enteric biomass, its products, or both. Very low birth weight infants (VLBW; birth weight ≤ 1500 grams) admitted to the neonatal intensive care unit are prospectively followed over the first 5 week or until they reach 36 weeks gestation, whichever occurs later. VLBW infants with a lethal clinical condition are excluded. Over the course of the study period, prospective samples are obtained on all infants, and include all stools, and weekly blood samples, palm and oral swabs. Clinical data is collected over the course of the entire hospitalization. Cases are identified based on Bell's staging for NEC, requiring Bell's stage II (abdominal clinical signs and radiographic evidence of pneumatosis, portal venous gas or pneumoperitoneum). Controls are identified from the pool of prospectively enrolled subjects, matching for gestational age, birth weight, post-natal age and birth date. The microbial components of stool and its products before and at the onset of NEC, are then compared between cases and controls. The Aims of this proposal are to (1) conduct a case cohort study in which we compare clinical data and biological specimens from cases and well-matched controls; (2) determine if the kind and density of intestinal biomass, its gene content, and transcriptional activity are associated with, and potential determinants of, NEC; and (3) determine if host risk alleles for intestinal inflammation play a role in the development of NEC.

  Study phs000247

• Early Methamphetamine Abstinence: fMRI and Brain Function

  This study included two groups of subjects, methamphetamine-dependent and healthy control participants, with the purpose of characterizing brain structure and cognition during the first month of abstinence from methamphetamine. Participants were able to participate in one or both phases of the study. Methamphetamine abusers were held as inpatients and abstained from methamphetamine use during the entirety of the study. Phase I covered the 1st week of abstinence and Phase II covered the next 3-4 weeks of abstinence. Control subjects participated as outpatients at timeframes which corresponded to the assessments taken of methamphetamine users. The following outlines the procedures in more detail. After initial telephone screening, in-person screening and recruitment procedures took place at the UCLA Neuropsychiatric Institute. Each methamphetamine abuser subject entered the study after completing an interview and questionnaires on drug use history, and providing a positive urine test for methamphetamine. The evaluation included a psychiatric diagnostic interview according to the Structured Clinical Inventory for DSM-IV (SCID-IV), a medical history and physical examination, blood tests [including a complete chemistry panel, hepatic panel, and tests for hepatitis-C and HIV]. Urine samples were also taken for drug screening of illicit drugs, and to test for pregnancy (female subjects). The methamphetamine abusers were then admitted to the General Clinical Research Center (CRC) and participated on a residential basis, where they were administered daily questionnaires about drug craving, withdrawal and mood. The current study makes available phenotype and genotype data, and interested investigators may contact the principal investigator regarding potential sharing of fMRI data.

  Study phs001198

• Rare Diseases Clinical Research Network (RDCRN) Vasculitis Clinical Research Consortium (VCRC) Longitudinal Protocol for Polyarteritis Nodosa

  The development and validation of accurate biological markers and predictors of disease activity and outcome in Polyarteritis Nodosa (PAN), a form a idiopathic vasculitis, would have a major positive impact on the clinical care of patients with this rare disease, be an important advance in the design of clinical trials and feasibility of new drug development, and provide important insight into the pathogenesis of this condition. Current measures of disease activity, including erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP), while helpful in selected settings, are mostly considered highly flawed and markers whose poor correlation with disease flares makes them inadequate to help guide therapy. Similarly, ESR and CRP are clearly unhelpful as diagnostic tests for vasculitis. The current state of clinical investigation for vasculitis relies heavily upon determination of disease status solely by clinical presentation and investigator opinion. Thus, discovery and validation of more precise markers that quantifiably measure activity, predict disease course, and correlate with an important biological process, would be of great importance. Knowledge to be gained from this study could potentially be highly important. Discovery of effective biomarkers of vasculitis and assessment of long term disease course and complications by the collection of clinical and diagnostic imaging studies proposed could lead to better care and less toxic treatment regimens. Furthermore, insight into the pathophysiology of vasculitis could be gained and this might lead to better treatments and improved outcomes in terms of reduction of vascular and treatment related complications. Ideally, excellent biomarkers reflect a sophisticated understanding of the pathophysiology of a disease.

  Study phs000590

• Genetics of Mood Disorders: Aging and Emotion Regulation Brain Circuitry in Bipolar

  This single-site study is designed to investigate age-related changes in structure and function of a ventral prefrontal cortex (VPFC) neural system, that subserves emotion processing and regulation, during mid to later adulthood in individuals with bipolar disorder (BD), compared to healthy controls (HC). It is a 5-year study of age-related changes in mood, emotion regulation and related symptoms and behaviors using multimodality imaging measures [structural magnetic resonance imaging (MRI) of gray matter, diffusion tensor imaging (DTI) of white matter, and functional MRI measures of functional connectivity and of brain responses during implicit and explicit emotion regulation] comparing BD and HC groups ages 40-79 years, 50% female; a subgroup will be reassessed and rescanned after 2 years to study brain and associated behavioral changes over time. We will explore relationships between brain aging with risk factors implicated in progression. This will include genes, as well as adverse outcomes of progression such as suicide ideation and behavior. As there has been little study of effects of aging of the VPFC emotional circuitry in healthy individuals, findings could provide new insights into brain circuitry and emotional regulation in older adults. In addition to the importance of contributing to understanding BD, as BD is unique in having both elevated and depressive episodes, its study can provide a model for understanding progressive emotion dysregulation to both intervention and prevention that can be better targeted specifically for older individuals with BD. A de-identified blood sample will be sent to the Repository and Genomics Resource.

  Study phs001631

• Non-Coding Autoimmune Risk Variant Defines Role for ICOS in T Peripheral Helper Cell Development

  Our fine-mapping of 76 non-MHC loci associated with risk for rheumatoid arthritis (RA, 11,475 cases, 15,870 controls) has recently identified rs117701653, a non-coding single nucleotide polymorphism (SNP) in the CTLA4/CD28/ICOS locus, as the variant most likely to modulate RA risk within this region, with the minor allele C showing disease protection compared to the major allele A. We found that this SNP exhibits allele-specific protein binding and transcriptional modulation, further supporting its regulatory nature. Here, we aimed to determine whether the functional non-coding variant rs117701653 modulates the expression of genes within the CD28/CTLA4/ICOS locus. To address this question, we employed low-input RNA sequencing using the Illumina SmartSeq2 platform on resting total CD4+ T cells from the blood of 24 healthy subjects (8 AA, 8 AC, 8 CC) recruited based on genotype from the Mass General Brigham biobank. We performed a targeted cis-eQTL mapping analysis for protein coding genes with transcription start sites (TSS) within a 1MB window of SNP rs117701653. These genes included WDR12, NBEAL1, CYP20A1, ABI2, RAPH1, CD28, CTLA4, ICOS, and PARD3B. Surprisingly, allelic variation at rs117701653 correlated strongly with expression of ICOS. This suggests that individuals carrying the protective allele C at rs117701653 express lower levels of ICOS, implicating ICOS as a plausible target gene influenced by this protective allele. The raw sequence data from the 24 healthy individuals are available through dbGAP. Gene expression matrices have been deposited to GEO accession GSE235868.

  Study phs003448

• NCI Cancer Model Development for the Human Cancer Model Initiative (HCMI)

  The Cancer Model Development Center (CMDC) project is part of the Human Cancer Model Initiative (HCMI) and is managed by the Office of Cancer Genomics within the Center for Cancer Genomics at the National Cancer Institute (NCI). The goal of the HCMI is to generate approximately 1000 novel human "next generation" tumor-derived models as a community resource. The models aim to faithfully recapitulate the cellular complexity and heterogeneity of human tumors. The CMDCs are tasked by the NCI with producing a proportion of the cancer models. Wellcome Sanger Institute (WSI) is a contributing member of the HCMI. Models developed by HCMI are being derived from a number of tumor types and subtypes (see below), including rare adult, pediatric and understudied cancers. The number of models and the clinical sites from which patient samples are acquired is increasing. Normal tissue, originating tumor, and tumor-derived models are sequenced. The next generation cancer models are associated with rich clinical and genomic data through the NCI Genomic Data Commons for all researchers to advance cancer research. The CMDC and HCMI models will serve as excellent tools in research to provide insight into the pathways that influence tumor growth and progression, how tumors respond to therapy, etc. Ultimately, the data generated using these models will support the development of personalized oncology. There is a delay between registered IDs and model availability. The current model count is found in The HCMI Searchable Catalog which is updated when new models are available for distribution to the research community.

  Study phs001486

• PCPT and SELECT Cohorts: Core Infrastructure Support for Cancer Research

  SELECT study: SELECT was a phase III, double-blind, placebo-controlled 4-arm study of selenium, vitamin E, selenium and vitamin E together, and placebo designed to assess the effect of these supplements on the incidence of prostate cancer. Funded by the National Cancer Institute and conducted by SWOG, the study opened in August 2001 and quickly exceeded its accrual goal of 35,533 men.In the fall of 2008, the trial's Data Safety and Monitoring Committee recommended that participants discontinue taking study supplements due to convincing evidence (planned interim futility analysis) that neither vitamin E nor selenium supplements were associated with the prevention of prostate cancer. A subsequent analysis in 2011 showed a significant 17% increase in prostate cancer incidence in participants who were on the vitamin E only arm. Approximately 17,000 participants from the original trial recently completed an additional four years of centralized follow-up. This follow-up ended on May 31, 2014 and SELECT is now closed. PCPT study: The Prostate Cancer Prevention Trial (PCPT) was a SWOG Cancer Research Network-coordinated study designed to test whether the drug finasteride (Proscar®) would prevent prostate cancer in men ages 55 and older. This study was closed on June 24, 2003 because the study objective had been reached. The results of the study, which did find a preventive benefit for the drug, were published as "The Influence of Finasteride on the Development of Prostate Cancer," in the New England Journal of Medicine on July 17, 2003.

  Study phs003382

• Study on the Genetics of Alcoholism (COGA): Smoke Screen and Exome Sequencing

  This is a family study of alcoholism, in which the subjects have been drawn from the Collaborative Study on the Genetics of Alcoholism (COGA), a large, ongoing family-based study that includes subjects from seven sites around the US. COGA has gathered detailed, standardized data on study participants, including diagnostic and neurophysiological assessments. This project has already proved successful in identifying several genes that influence the risk for alcoholism and neurophysiological endophenotypes, which have been independently replicated. COGA data were included as part of two Genetic Analysis Workshops, and the phenotypes are familiar to the genetics community. Alcoholic probands were recruited from treatment facilities, assessed by personal interview, and after securing permission, other family members were also assessed. A set of comparison families was drawn from the same communities as the families recruited through an alcoholic proband. Assessment involved a detailed personal interview developed for this project, the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA), which gathers detailed information on alcoholism related symptoms along with other drugs and psychiatric symptoms. Many participants also came to the laboratories for electroencephalographic studies. Neurophysiological features that have been shown to be useful endophenotypes for which we have linkage and in some cases association results are included on a subset of the case-control sample: the beta power of the resting electroencephalogram (EEG), the P3(00) amplitude of the visual event-related potential (ERP), and the theta and delta event-related oscillations (EROs) underlying the P3.

  Study phs001208

• dbGaP Collection: Open Translational Science in Schizophrenia (OPTICS)

  Schizophrenia is a chronic, severe, disabling brain disorder that affects approximately 1% of the population worldwide. Epidemiologic studies have clearly demonstrated that genetics play a strong role in etiology, but the inheritance is very complex. Innovative analytic approaches and creative ways of combining disparate data sets will be necessary for making breakthroughs in identifying causal pathways and ultimately new drug targets. This dbGaP Collection consists of all genetic studies of schizophrenia available in dbGaP that have been consented for general research use. The goal is to facilitate identification of datasets with related scientific content in order to expedite the application process and ascertainment of datasets of interest for increased scientific discovery. The Open Translational Science in Schizophrenia (OPTICS) Project, was launched by Janssen Research & Development, LLC, part of the Janssen Pharmaceutical Companies of Johnson & Johnson, with a group of leading research organizations including the National Institutes of Health, Yale University School of Medicine, Rutgers University and the Harvard T.H. Chan School of Public Health, to create a new forum for collaborative analysis of Janssen's schizophrenia clinical trial data and other publicly available data about schizophrenia with the goal of creating new models for conducting research. The OPTICS project is one part of a larger effort at Janssen and other Johnson & Johnson research companies to share clinical trials data to enhance public health and advance science and medicine. Qualified investigators and physicians may apply for access to anonymized clinical trials data from Janssen, for more information please visit https://sites.google.com/site/opticsschizophrenia/.

  Study phs000887