16452 results for "sec+and+unspecified+malignant+neoplasm"

in 51.96 milliseconds.

• RRBS - MBD4-deficient AML

  Reduced Representation Bisulfite Sequencing for WEHI-AML-1 and WEHI-AML-2. RRBS libraries were made with the NuGEN Ovation RRBS Methyl-Seq System. Bisulfite conversion was performed with the Qiagen Epitect kit. Sequencing was performed on an Illumina HiSeq2500.

  Dataset EGAD00001003567

• WGS data of XPC-ko human small intestinal organoid cultures

  Whole genome sequencing (WGS) data of human small intestinal organoid cultures, which were deleted for the XPC gene using CRISPR-Cas9. Contains WGS data of 1 clone and 1 subclone.

  Dataset EGAD00001003779

• Hepatocellular adenomas samples

  Whole exome sequencing data from 30 donors (46 tumors and 30 non-tumoral whole exome sequencing, paired-end, HiSeq 2000, Illumina) collected by the Inserm U674, PI Jessica Zucman-Rossi - Institut National du Cancer (INCa), PI Fabien Calvo, France.

  Dataset EGAD00001000737

• ICGC-LIRI-JP Release 16

  RIKEN collection WGS reads for 100 HCC and matched blood samples from 50 donors submitted to ICGC for release 16

  Dataset EGAD00001000842

• TCS validation of 11 lung adenos

  This is the targeted capture deep sequencing (TCS) data for validation of the mutations discovered in the WES step. There are 58 bam files of TCS data including 48 tumor samples and 10 peripheral blood WBC samples.

  Dataset EGAD00001000985

• Genentech gastric cell line sequencing

  RNAseq and exome sequencing data of gastric cancer cell lines.

  Dataset EGAD00001001013

• Identifying novel DNA damage response genes in radiosensitive individuals

  Ionizing radiation is an effective therapeutic agent for cancer treatment as well as a potent carcinogen. Sensitivity to the cell-killing effects of radiation can vary across human population with a subset of individuals displaying extreme hypersensitivity. It is usually attributable to inherited defects in DNA damage response pathways. The present study was designed to elucidate the genetic basis of variation in hypersensitivity to radiation exposure through exome sequencing of radiosensitive individuals, with the ultimate goal of identifying genes with the most significant effects on cellular DNA damage responses. The study participants included subjects referred for clinical testing for Ataxia-telangiectasia (A-T), Nijmegen Breakage Syndrome (NBS) or Ligase IV Syndrome. These are rare, recessive genetic disorders and hypersensitivity to radiation exposure is a common phenotype among individuals affected by all the three disorders. The study participants exhibited phenotypic characteristics similar to individuals with A-T, NBS or Ligase IV Syndrome, but lacked the causative mutations in ATM (GeneID:472) or NBN (GeneID:4683) genes. For further validation of the radiation sensitivity phenotype among the enrolled subjects, B-lymphoblastoid cells lines were established for each subject from peripheral blood lymphocytes. Each cell line was evaluated for displaying impaired survival rates relative to normal controls after exposure to ionizing radiation. 53 subjects with validated phenotype were finally included in the study and DNA extracted from their B-lymphoblastoid cell lines was used for exome sequencing. This sequencing data for radiation sensitive subjects is being made available in the dbGaP. It is hoped that this resource will be beneficial for researchers who wish to further investigate components of human cellular DNA damage response pathways and/or genetic architecture underlying radiation hypersensitivity. This data may also aid in the rational design of new radiosensitizing or radioprotective agents.

  Study phs001911

• Long read transcriptome of DM1 patients whole blood

  DM1 is characterized by dysregulation of alternative mRNA splicing, to an quantitative as well as qualitative extend that is heterogenous between clinically similar patients. Hundreds of transcripts have been identified that can be misspliced in DM1, and for many of these it is still unclear whether they generate stable proteins in DM1 patients. We generated long-read transcriptome data of DM1 patients whole blood after hemoglobin depletion. Each sample is a mix of 5 patients of varying age.

  Study EGAS50000000196

• Endometrial Cancer Association Consortium - OncoArray Genotypes

  The data come from 9 studies participating in the Endometrial Cancer Association Consortium (ECAC). ECAC data included in this dbGaP submission include OncoArray data from 4486 endometrial cancer cases genotyped at the Center for Inherited Disease Research (CIDR). Samples were genotyped using the Illumina OncoArray beadchip 500K SNP custom array. Details of the genotyping process and sample selection are included in O'Mara et al, Identification of nine new susceptibility loci for endometrial cancer. Nature Communications (PMID:30093612).

  Study phs001885

• Next Generation Mendelian Genetics: Kabuki Syndrome

  The ultimate purpose of this research is to identify genes causing hereditary disorders. We are scaling a new approach to identify the candidate genes and gene mutations that underlie rare human Mendelian (a set of primary tenets relating to the transmission of hereditary characteristics from parent to child) diseases by using exome (protein coding segments of DNA) resequencing. The exome sequences of ten unrelated individuals with a diagnosis of Kabuki Syndrome (OMIM: 147920) were obtained by massively parallel DNA sequencing.

  Study phs000295

• Genome Instability in Mammary Cells of Pathogenic BRCA1/2 Mutation Carriers

  It remains unknown if inherited germline mutations in the BRCA1 or BRCA2 gene increase the risk of breast and ovarian cancer by elevating mutation rate in mammary cells. Here we show, using a single-cell whole genome sequencing approach, that mammary luminal epithelial cells isolated from tissues obtained from preventive mastectomy surgeries in women with a pathogenic BRCA1/2 germline mutation, exhibit a statistically significant, increased mutation frequency as compared to age-matched controls without genetic risk of breast cancer.

  Study phs002411

• Pharmacogenomics of Mercaptopurine Intolerance in Children with Acute Lymphoblastic Leukemia (AALL03N1)

  Mercaptopurine (MP) is the mainstay of curative therapy for acute lymphoblastic leukemia (ALL). We performed a genome-wide association study (GWAS) to comprehensively identify the genetic basis of MP intolerance in children with ALL in AALL03N1. MP dose intensity was defined as prescribed dose divided by the planned protocol dose during maintenance therapy.  Germline variants in NUDT15 and TPMT were found to be strongly associated with MP intolerance in childhood ALL, which may have implications for treatment individualization in this disease.

  Study phs002846

• Small Genomic Insertions Form Enhancers that Misregulate Oncogenes

  ChIP-Seq data from 102 cell lines were processed to identify insertions relative to the human reference genome. To confirm the ability of a computational pipeline to identify insertions that are actually present in these genomes, we PCR-amplified and deeply sequenced regions where insertions were predicted to exist in MOLT4 T-cell acute lymphoblastic leukemia cells. The current study release makes available sequences of amplicons from a tumor cell genome (MOLT4) where a computational pipeline predicted small insertions from orthogonal data.

  Study phs001242

• NCT03343197: Clinical Biomarker Data

  Patients with IDH1-mutated low-grade glioma were treated with AG-120 (ivosidenib), AG-881 (vorasidenib), or Placebo for 28 days before surgical resection. A portion of the surgical sample was submitted for exome capture-based transcriptome sequencing (Personalis ACE Whole Transcriptome). Following surgery, subjects had the option to continue (or initiate) treatment with AG-120 or AG-881.This dataset comprises next-generation sequencing data from biopsies obtained in the clinical trial: NCT03343197 (Study of AG-120 and AG-881 in Subjects with Low Grade Glioma).

  Study phs003148

• Genetic Effects on miRNA Expression During Mid-Gestation Neocortical Development

  In this study we aimed to find common genetic variants that influence miRNA expression during mid-gestation neocortical development. Small RNA-sequencing from 212 fetal cortical tissue samples between 14 and 21 weeks gestation were used to profile miRNA expression. Combined with donor genotypes, we were able to find miRNA-eQTLs during neocortical development. The dataset provided here includes 212 Small RNA-sequencing files in FASTQ format from cortical wall samples. Also provided here are 212 donor genotypes in PLINK format (hg19).

  Study phs003106

• Kids First: Genetic Basis of Fetal Alcohol Spectrum Disorders

  Fetal Alcohol Spectrum Disorder (FASD) is estimated to occur in at least 1-5% of all children in the USA and is a major public health issue. However, in addition to alcohol, other susceptibility factors, such as maternal or fetal genetic variation, must play a role as not all children prenatally exposed to alcohol are similarly affected. The proposed study will examine the role of genetic susceptibility for FASD. This work will help to inform more effective intervention efforts for this common congenital disorder.

  Study phs002594

• Metatranscriptomic Sequencing of Pre-Transplant Bronchoalveolar Lavage in Pediatric Stem Cell Transplant Patients

  Children with malignancies, immunodeficiencies, and other life-threatening diseases sometimes receive allogeneic hematopoietic cell transplantation (HCT) as a treatment for their disease. The HCT process can be complicated by the development of lung disease from infection, alloreactivity, or other causes. To identify patients at-risk for post-HCT lung disease, this study uses metatranscriptomic RNA sequencing of bronchoalveolar lavage (BAL) obtained prior to HCT. Sequencing results are associated with the development of post-HCT lung injury. 

  Study phs002208

• Single-Cell Genome Sequencing of Gastrointestinal Carcinomas

  We experimentally derived copy number profiles and transcriptome profiles of gastrointestinal cancers using single cell sequencing. Using a microfluidic droplet partitioning system, we isolated individual cells of a suspension from a primary solid tumor into droplets. These droplets tag the resultant genomic or transcriptomic material with an identifying barcode that enables bioinformatic single cell tracking. From this joint analysis, we determined the overall level of genomic instability for gastrointestinal cancers as well as transcriptomic consequences from these events.

  Study phs001711

• High-throughput determination of the antigen specificities of T cell receptors in single cells

  High-throughput linking of T cell receptor (TCR) sequences to their binding antigens is vital for immune profiling, yet challenging. We present Tetramer associated TCR Sequencing (TetTCR-Seq) to address this challenge. Binding is determined using a library of DNA-barcoded antigen tetramers that are rapidly and inexpensively generated using an in vitro transcription/translation platform. We included CMV+ donors (CMV seropositive donors who are infected with Cytomegalovirus) to screen for CMV specific TCRs.

  Study phs001678

• The Genetics of Lung Cancer Susceptibility in Smokers

  Over 85% of all patients diagnosed with lung cancer report a history of tobacco use, though only 10% of tobacco smokers eventually develop lung cancer. Epidemiologic studies have shown that family members of patients with lung cancer have a higher risk of developing lung cancer than controls. In an effort to identify variants associated with tobacco induced lung cancer, we have sequenced germline DNA from affected and unaffected members of families with strong histories of tobacco related lung cancer.

  Study phs000728

• The Role of GPD1L in the Pathogenesis of Brugada Syndrome

  This study performed exome sequencing on a proband with Brugada Syndrome, as well as high-density SNP array data from the proband, affected family members, and unaffected family members. The principal findings of this study were the identification of GPD1L-A280V as the only plausible variant present in a linkage region on chromosome 3, which co-segregated with the Brugada Syndrome phenotype in this family. Exome sequencing data of the proband, as well as SNP array data from the family, are available.

  Study phs003468

• A CCG expansion in ABCD3 causes oculopharyngodistal myopathy in individuals of European ancestry

  In this study we describe the identification of CCG expansions in ABCD3 in affected individuals across eight unrelated OPDM families of European ancestry. In two large Australian OPDM families, using a combination of linkage studies, short-read WGS and targeted ONT sequencing, we identified CCG expansions in the 5’UTR of ABCD3. Independently, the ABCD3 CCG expansion was identified through the 100,000 Genomics England Genome Project in three individuals from two unrelated UK families diagnosed with OPDM.

  Study EGAS50000000298

• Expression quantitative trait loci influence DNA damage-induced apoptosis in cancer

  The analysis of e2QTL allows for the identification of context-specific eQTL effects (Kim-Hellmuth et al. (2017), PMID: 28814792). To evaluate how inter-individual genetic variability influences the regulation of DNA damage-induced apoptosis, we performed e2QTL analysis of CD8+ T cells from 461 healthy European participants stimulated with high doses of 5 different carcinogens. These include Methyl-methanesulfonate (MMS), tert-butyl-hydroperoxide (TBOOH), benzo(a)pyrene-7,8-diol-9,10-epoxide (BPDE), 4-hydroxycyclophosphamide (HC) and UVC radiation.

  Study EGAS50000000666

• WGS data for EBiSC iPSC lines

  The European Bank for Induced Pluripotent stem cells (EBiSC) is designed to address the increasing demand by iPSC researchers for quality-controlled, disease-relevant research grade iPSC lines, data and cell services. In this study Whole Genome Sequencing was performed on a selection of lines from the project.

  Study EGAS50000000742

• analysis of immune infiltration in colorectal cancer metastasis

  Metastatic colorectal cancer (mCRC) is the main cause of CRC mortality, with limited treatment options. Although immunotherapy has benefited some cancer patients, mCRC typically lacks the molecular features that respond to this treatment. However, recent studies indicate that the immune microenvironment of mCRC may be modified to enhance the effect of immune checkpoint inhibitors. This study aimed to explore the metastatic immune microenvironment by comparing immune cell populations in colorectal liver (CLM), lung (mLu) and peritoneal (PM) metastases.

  Study EGAS50000000652

• Whole Exome Sequencing analysis of three tumor biopsies from a LUAD patient

  Whole Exome Sequencing (WES) analysis was performed on three distinct tumor biopsies collected at different time points, along with their matched germline non-tumor sample, from the same LUAD patient. DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD) according to the manufacturer’s instructions and quantified using the Qubit Fluorometer assay (Life Technologies, Carlsbad, CA). To minimize FFPE-related sequencing artifacts (e.g., C:G > T:A transitions), the extracted DNA was treated with the DNA repair enzyme Uracil-DNA-Glycosylase (UDG) following the manufacturer’s protocol (New England Biolabs, Ipswich, MA). Whole-exome capture was performed with the Twist Human Core Exome + RefSeq + Mito-Panel kit (Twist Bioscience), in accordance with the manufacturer’s guidelines. Sequencing generated paired-end 100-bp reads on the Illumina NovaSeq 6000 platform. The resulting reads were aligned to the reference human genome (GRCh38) using the Burrows-Wheeler Aligner (BWA, v0.7.12).

  Dataset EGAD50000001198

• Allogeneic induced pluripotent stem (iPS) cell-derived cartilage transplantation for articular cartilage damage in knee joints: a phase I, first-in-human study

  Damaged articular cartilage seldom heals due to a limited capacity for self-repair, frequently leading to osteoarthritis. Regenerative interventions are expected to heal the damage. We have recently established a method to produce cartilage from induced pluripotent stem cells (iPSCs) in a clinically applicable process. The primary aim of this study was to evaluate the safety including tumorigenesis and the subsequence efficacy of allogeneic iPSC-derived cartilage transplantation into damaged areas of knee articular cartilage.

  Study EGAS50000001167

• Genetic Legacy of Punan Hunter-Gatherer Groups in Indonesian Borneo

  Punan Batu (the “Cave Punan”), the last living nomadic hunter-gatherer (HG) group who still literally live under karst rock shelters in Borneo, is the least-known hunter-gatherer society in Asia. To provide insights on the origin and adaptation of the Cave Punan, here we present the autosomal genome-wide SNPs study of the Cave Punan, including other Punan groups who speak different language from the Cave Punan, which are transitioning into a more sedentary lifestyle.

  Study EGAS00001004471

• Genetic differences between primary colorectal cancer and its paired synchronous and metachronous metastases

  In this study we present for the first time the genetic differences associated with different chronicity of colorectal cancer liver metastases identified by whole-exome sequencing of 210 CRC samples. We focus on differences in primary tumors as we hypothesize that these are the cause of the differences in the time course of the disease. The results suggest that distinct tumor progression pathways account for different chronicity outcomes with ultimate impact on patient’s prognosis

  Study EGAS50000000996

• Filtered variants including SLC12A2 in patients with hearing loss

  Hereditary hearing loss is challenging to diagnose because of the heterogeneity of the causative genes. Further, some genes involved in hereditary hearing loss have yet to be identified. Using whole-exome analysis of three families with congenital, severe-to-profound hearing loss, we identified a missense variant of SLC12A2 in five affected members of one family showing a dominant inheritance mode, along with de novo splice-site and missense variants of SLC12A2 in two sporadic cases, as promising candidates associated with hearing loss.

  Study JGAS000379

• Targeted exome sequencing identify compound heterozygous TYK2 mutations in patients with primary immunodeficiency who developed EBV-associated lymphoma

  In this study, we evaluated 2 siblings with primary immunodeficiency who developed EBV-associated lymphoma. Immunophenotyping of PBMCs revealed that both patients had significant T cell lymphopenia characterized by low na?ve CD4+ T cell counts. To identify the causative genetic mutations in the patients, we performed targeted exome sequencing using the Illumina MiSeq on the patients and their parents. The results showed a novel compound heterozygous mutations in the gene encoding tyrosine kinase 2 (TYK2) in the patients.

  Study JGAS000098

• Immune Biomarkers in Metastatic Castration-resistant Prostate Cancer

  Background: Metastatic castration-resistant prostate cancer (mCRPC) is a heterogeneous disease in which molecular stratification is needed to improve clinical outcomes. The identification of predictive biomarkers can have a major impact on the care of these patients, but the availability of metastatic tissue samples for research in this setting is limited. Objective: To study the prevalence of immune biomarkers of potential clinical utility to immunotherapy in mCRPC by tumour RNA sequencing, and to determine their association with overall survival (OS).

  Study EGAS50000001269

• Transcriptome analysis of human iPSC-derived microglia in a novel human 3D cortical tissue model

  scRNA-seq analysis of human iPSC-derived microglia in a novel, human in vitro 3D cortical tissue model. Samples include three distinct conditions (each as biological duplicates): wild-type microglia extracted from cultures after 1 month (WT_1mo) and 3 months (WT_3mo) of culturing, as well as knock-in microglia extracted from cultures carrying three familial AD mutations in the APP gene (Swedish, Iberian, Arctic; introduced by CRISPR/Cas9-mediated knock-in) after 3 months of culturing (KI_3mo).

  Study EGAS50000000469

• LCM-ATACseq on human lung macrophages

  In this study we employed Laser Capture Microdissection (LCM) for the multimodal profiling of lung macrophages cell populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (~100 cells) were collected from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation), and processed for ATAC-seq.

  Study EGAS00001006167

• cfDNAme allows early prediction of PE

  Preeclampsia (PE) is a leading cause for peripartal morbidity, especially if developing early in gestation. To enable prophylaxis to prevent PE, it is essential that pregnancies at risk of PE are identified early, in the first trimester. To identify patients at risk, we profiled methylomes of plasma-derived cell-free DNA (cfDNA) from pregnant women. We detected DNA methylation differences between control and PE pregnancies that enable risk stratification of patients, at PE diagnosis but also presymptomatically, around 12 weeks of gestation.

  Study EGAS00001007071

• iNeuron_RNAseq

  Characterisation of a timecourse of differentiation of induced cortical excitatory neurons generated by overexpression of the Ngn2 transcription factor transgenically in BOB iPSCs. The aim is to understand the differentiation trajectory undergone in this process, and characterise the transcriptome in these cells for further disease modelling. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001004238

• Investigating genetic susceptibility to rheumatic heart disease in Oceania

  This case-control study investigated susceptibility to rheumatic heart disease in over 3,000 individuals recruited across eight Oceanian countries. Cases were patients with rheumatic heart disease and controls were members of the general population. In addition to the Illumina HumanCore-24 BeadChip genotyping, a subset of 128 samples were analysed using the higher density Illumina HumanOmniExpressExome BeadChip of which 64 were also analysed using low coverage sequencing with the Illumina HiSeq 4000 platform.

  Study EGAS00001001881

• Whole_genome_sequence_of__third_generation_family_member__SFHS_

  Previously we performed deep WGS on 6 parents and 13 children from 3 large families from the Scottish Family Health Study to identify de novo mutations. This prelim is cover the additional sequencing of one grandchild from one of these three families. The inclusion of a third generation individual will provide additional experimental validation for the de novo mutations found in the initial trio. As in the previous study, the DNA will be WGS to a depth of approximately 25X to achieve this purpose.

  Study EGAS00001000429

• AML_targeted_resequencing_study

  Genomic libraries will be generated from whole genome amplified genomic DNA derived from 3,000 myeloid neoplasms. Targeted capture will be performed by multiplexing 16 barcoded samples in each library. Pools of 96 DNA samples will be subjected to 1-2 lanes of HiSeq 75bp sequencing. Reads will be mapped to the current build of the human reference genome to facilitate the generation of a comprehensive catalog of somatic mutations associated with 116 known myeloid and cancer driver genes.

  Study EGAS00001000275

• Next generation sequencing of sporadic schwannomatosis samples

  Schwannomatosis (MIM #162091) is characterized by the development of multiple schwannomas without vestibular nerve involvement (which is a characteristic of neurofibromatosis type 2 - NF2). In an effort to detect novel genetic alterations predisposing to schwannomatosis, we sequenced eight tumor-blood DNA pairs from de novo schwannomatosis patients. The results of our study are present in the paper "Whole exome sequencing reveals that the majority of schwannomatosis cases remain unexplained after excluding SMARCB1 and LZTR1 germline variants" published in Acta Neuropathologica (PMID:25008767)

  Study EGAS00001000767

• Exome_sequencing_in_patients_with_Calcific_Aortic_Valve_Stenosis

  The objective is to identify new genes involved in calcific aortic valve stenosis (CAVS) by screening the exome of at least 20 patients with familial CAVS. The recruitment of patients with CAVS has been achieved by l’institut du thorax (Nantes, France). DNA from the selected patients has been analysed by exome capture (Agilent SureSelect) and massively parallel sequencing (Illumina). The data generated by this project will lead to the identification of candidate genes involved in CAVS, which can be further screened for mutation in additional patients with CAVS.

  Study EGAS00001000049

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML___part2

  Genomic libraries will be generated from total genomic DNA derived from 4000 samples with Acute Myeloid Leukaemia. Libraries will be enriched for a selected panel of genes using a bespoke pulldown protocol. 64 Samples will be individually barcoded and subjected to up to one lanes of Illumina HiSeq. Paired reads will be mapped to build 37 of the human reference genome to facilitate the characterisation of known gene mutations in cancer as well as the validation of potentially novel variants identified by prior exome sequencing.

  Study EGAS00001000570

• Gut microbiota analysis after 3months probiotic-like bacteria or placebo treatment in subjects with metabolic syndrome

  Background: Probiotic-like bacteria treatment has been described to be associated with gut microbiota modifications. Goal: To decipher if the effects of the tested probiotic-like bacteria are due to the bacteria itself or due to the effects of the bacteria on the gut microbiota. Methodology: In this study, gut microbiota has been analyzed from feces samples of subjects with metabolic syndrome and treated with one of the 2 tested probiotic-like bacteria or with the placebo during 3months.

  Study EGAS00001003585

• Mutations conferring differential treatment response in breast cancer

  Poor prognosis primary breast cancer patients usually receive cytotoxic chemotherapy as a component of treatment, but despite this aggressive therapy recurrences remain common. Improved understanding of chemoresistance pathways would allow better stratification of chemotherapy using predictive markers, and may allow therapeutic inhibition of resistance mechanisms in order to chemosensitise tumours. We aimed to identify molecular pathways that define chemoresponse using the novel approach of examining the selection exerted by neoadjuvant chemotherapy on sub-clonal somatic mutational profiles of cancer cells.

  Study EGAS00001003626

• Investigating_the_genetics_of_immunity_against_Salmonella_in_humans

  This study entails whole genome sequencing of an interleukin (IL)-12 b-1 receptor-deficient individual who presented with a chronic systemic Salmonella Enteritidis infection that did not resolve with standard IFNg and antibiotic treatment. Whole genome sequencing of the patient’s parents are also included.This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001001664

• We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas.

  Schwannomas are common peripheral nerve sheath tumors that can cause significant debilitating morbidities. We performed an integrative analysis to determine genomic aberrations common to sporadic schwannomas. Exome sequence analysis with validation by targeted DNA-sequencing of 125 samples uncovered, in addition to expected NF2 disruption additional recurrent mutations. RNA sequencing identified a recurrent in-frame SH3PXD2A-HTRA1 fusion in 12/125 (10%) cases, and genomic analysis demonstrated the mechanism as resulting from a balanced 19Mb chromosomal inversion on chromosome 10q.

  Study EGAS00001001886

• A_compendium_of_mutational_signatures_due_to_environmental_exposures

  Analysis of mutational signatures caused by exposure to known mutagens in human induced pluripotent stem (iPS) cells. A reference human iPS cell-line will be exposed to 100 chemicals known or proposed to be mutagenic. Following exposure to mutagen, cells will undergo a period of recovery before sub clones are generated and sequenced. The progenitor “parental” IPS cell-line will be used to generate reference sequence data, in order to determine the mutational signatures acquired as a result of exposure to different mutagens.

  Study EGAS00001002060

• The_British_Autozygosity_Populations_BioResource

  This data set contains whole exome sequences of individuals with self-stated parental relatedness from the East London Genes & Health cohort. Rare frequency functional variants in these healthy individuals will be studied with respect to the genetic health of the participants and loss-of-function analysis of human genes. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001002742

• Mutational_burden_in_human_hair_follicles

  We would like to dissect human hair follicles and assess the mutations found in diffferent parts of the follicle eg bulge, root etc. We can also compare this with mutations found in the surrounding epidermis of the same patients (this is done under a different study). This may provide insights into the origin of PTCH1 mutants frequently seen in basal cell carcinoma but so far not located in our whole epidermis work as well as defining the clonality of the hair follicle

  Study EGAS00001004462

• Genomewide copy number alteration screening of circulating plasma DNA

  Early cancer diagnosis might improve survival rates. As circulating tumor DNA (ctDNA) carries cancer-specific modifications, it has great potential as a noninvasive biomarker for detection of incipient tumors. We collected cell-free DNA (cfDNA) samples of 1002 elderly without a prior malignancy, carried out whole-genome massive parallel sequencing and scrutinized the mapped sequences for the presence of (sub)chromosomal copy number alterations (CNAs) predictive for a malignancy. When imbalances were detected, 6-monthly clinical follow-up was carried out.

  Study EGAS00001006031

• Molecular analysis of FIT interval colorectal cancers

  To optimize a fecal immunochemical test-based screening program, the rate of missed colorectal cancers (CRCs), so-called FIT-interval CRCs, should be minimized. A specific molecular make-up of those CRCs could be an explanation for those interval CRCs. Knowledge of the molecular make-up of these missed lesions could facilitate more accurate detection of all precursor lesions. In this study we aimed to compare the molecular make-up of FIT-interval CRCs and screen-detected CRCs (SD-CRCs).

  Study EGAS00001004683

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• Defining structural variation associated with breast cancer susceptibility by long-read genome sequencing

  Germline structural variants (SVs) are challenging to identify by conventional genetic testing assays. Long-read sequencing has improved the global characterization of SVs, but its sensitivity at genetic loci associated with high- and moderate-penetrance cancer susceptibility has not been reported. This study used long-read genome sequencing performed on the Oxford Nanopore Technologies' PromethION to resolve variants underlying breast cancer susceptibility in sixteen individuals with pathogenic germline SVs in BRCA1, BRCA2, CHEK2 or PALB2.

  Study EGAS00001005872

• Endothelium-derived stromal cells contribute to bone marrow niche formation

  Comprehensive transcriptional characterization of bone marrow stromal cells by RNA sequencing was performed to determine the molecular properties/signatures of endothelium during niche formation.Here, we identify a rare subset of cells in the human fetal BM that co-express endothelial and stromal markers, including low-affinity nerve growth factor receptor (LNGFR/CD271). They display transcriptional reprogramming consistent with endothelial-to-mesenchymal transition (EndoMT), reflected in their potential to generate stromal cells with in vivo BM niche forming capacity.

  Study EGAS00001004946

• Tumorigenic role of Musashi-2 in aggressive mantle cell lymphoma

  SOX11 is overexpressed in the highly aggressive conventional mantle cell lymphoma (MCL) but rarely in the indolent non-nodal MCL subtype. We performed RNA-seq of SOX11+ and SOX11- MCLs to search for SOX11-regulated genes that contributed to MCL clinical evolution, identifying Musashi-2 (MSI2) stem cell-related gene. By performing RNA-seq upon MSI2 knockdown or inhibition in MCL, we identified MSI2 as a potential target to inhibit drug resistance in aggressive MCLs.

  Study EGAS00001006613

• Cold Ischemia Study

  This study aimed to evaluate the impact of cold ischemia time on the expression of cancer-related genes, particularly those involved in hypoxia, apoptosis, and epithelial-to-mesenchymal transition (EMT). We performed RNA sequencing on 54 normal colon mucosa samples from nine patients undergoing colorectal cancer surgeries, freezing samples at predefined intervals ranging from 0 to 60 minutes. A total of 44 differentially expressed genes (DEGs) (p < 0.05) were identified when comparing samples frozen immediately (T0) with those frozen after 60 minutes (T5).

  Study EGAS00001008233

• ctDNA multigenic panel for non-small cell lung cancer

  Detection of actionable mutations in liquid biopsies constitute an important tool for management of non-small cell lung cancer (NSCLC) patients in the era of oncology precision medicine. We aimed to evaluate the actionable alterations using a commercial multi-gene panel in circulating tumor DNA (ctDNA) derived from plasma samples of treatment naïve and prior-treated non-small cell lung cancer (NSCLC) patients. For this, we analyze plasma samples of 30 subjects with non-small cell lung cancer.

  Study EGAS50000000643

• IMCISION RNAseq

  RNA sequencing of 32 primary head and neck squamous cell carcinoma (HNSCC) samples prior to treatment with neoadjuvant anti-PD-1 (n=6) or anti-PD-1 + anti-CTLA-4 (n=26) immunotherapy, and 30 paired on-treatment HNSCC samples (i.e. after neoadjuvant immunotherapy). RNA quantity used: 10ng. Library Preparation Kit: SMART Stranded Total RNA Seq Kit (Takara). Sequencing parameters: NovaSeq 6000, 2x 100 bp. File type: fastQ

  Dataset EGAD00001008127

• Single nuclei RNA-Seq from 5 regions of the human fetal brain

  Data generated through single nuclei RNA sequencing on 5 regions of the brain (frontal cortex, ganglionic eminence, hippocampus, thalamus and cerebellum) from 3 fetuses (two of 14 and one of 15 post-conception weeks, all female). Tissue was acquired from the MRC-Wellcome Trust Human Developmental Biology Resource (HDBR) with ethical approval. snRNA-seq libraries were prepared from ∼10,000 nuclei from each sample using Chromium Single Cell 3ʹ (v3) reagents (10X Genomics). Quality control of libraries was performed using the Agilent 5200 Fragment Analyzer before sequencing on an Illumina NovaSeq 6000 to a depth of at least 865 million (median = 1.01 billion) read pairs per library. Raw sequencing data were converted into FASTQ files. For a full description of data generation, please see Cameron et al, Biological Psychiatry 2022, https://doi.org/10.1016/j.biopsych.2022.06.033.

  Dataset EGAD00001009303

• Whole genome sequencing in prime-edited human organoids

  We performed whole genome sequencing to detect possible off-target mutations induced by prime editing. Liver organoids, derived from a healthy control, were transfected with either control (GFP) plasmids or prime editing plasmids (GFP+PE2+pegRNA+nickRNA) to induce a 6-bp deletion in CTNNB1. One control and two prime-edited organoid lines were clonally expanded from single cells. High-throughput sequencing was performed on the complete genomic DNA isolated from these clonal lines, as well as the starting culture (bulk). After correction for germline mutations in the starting culture, new mutations in the control and prime-edited lines were compared. The same approach was followed in small intestinal organoids, derived from a patient with disease-causing 3-bp deletion in DGAT1. In these small intestinal organoids, prime editing was used to insert the 3 missing nucleotides. Two corrected clones were compared to one control clone.

  Dataset EGAD00001006352

• scEC&T-seq manuscript data

  This dataset includes all data produced in the study describing "scEC&T-seq", a method for parallel sequencing of extrachromosomal circular DNA and transcriptome in single cells. This dataset includes: - Illumina scEC&T-seq Circle-seq data (scCircle-seq) for a total of 626 single cells / nuclei - bam files - Illumina scEC&T-seq RNA-seq data (scRNA-seq-Illumina) for the same single cells / nuclei - bam files - Nanopore scCircle-seq data for 18 single cells - bam files - Nanopore bulk WGS for 2 cell lines and 2 primary tumor samples - bam files - Illumina bulk WGS for 2 cell lines - bam files - Illumina bulk Circle-seq data from 1 cell line - bam file - Illumina ChIP-seq H3K27me3 data from 1 cell line - fasta files + peaks bed file + coverage bw file

  Dataset EGAD00001010071

• RNA-seq of high-grade serous ovarian cancer in long-term survivors (MOCOG study)

  RNA-seq dataset of high-grade serous ovarian cancer (HGSC) tumours from long-term survivors performed as part of the Multidisciplinary Ovarian Cancer Outcomes Group (MOCOG) study. The dataset includes fastq files from 56 HGSC tumours (53 primary tumours and 3 recurrent tumours) from 53 long-term survivor patients. Libraries were generated using the Illumina Stranded mRNA Prep and 150 bp paired-end sequencing was performed to a minimum of 100 million reads on Illumina NovaSeq 6000 instruments.

  Dataset EGAD00001008537

• Somatic L1 retrotransposition in normal colorectal epthelium

  Throughout an individual’s lifetime, genomic alterations accumulate in somatic cells. However, the mutational landscape induced by retrotransposition of long interspersed nuclear element-1 (L1), a widespread mobile element in the human genome, is poorly understood in normal cells. Here, we explored the whole-genome sequences of 406 normal colorectal clones, 12 MUTYH-associated adenomatous clones, and 19 matched colorectal cancer tissues. In addition, we analyzed promoter DNA methylation status of retrotransposition-competent L1 (in 139 clones) and read-through RNA expression profiles (in 116 clones) to investigate the epigenetic regulation of L1 activity.

  Dataset EGAD00001010183

• Rare Disease Synthetic Dataset

  The purpose of this project is to provide public human datasets for the study of rare diseases. The use of public human genomic background combined with the in-silico insertion of real disease-causing variants enable to have a representative dataset for testing purposes without facing ethical and legal issues associated with the use of human sensitive data. This project aims to help development of technical implementations for rare disease data integration, analysis, discovery, and federated access.

  Dataset EGAD00001008392

• Cancer-independent, second somatic NF1 mutation of normal tissues in neurofibromatosis type 1

  Cancer predisposition syndromes mediated by recessive cancer genes generate tumours via somatic variants (second hits) in the unaffected allele. Second hits may or may not be sufficient for neoplastic transformation. Here, we performed whole genome and exome sequencing on 479 tissue biopsies from a child with neurofibromatosis type 1, a multi-system cancer-predisposing syndrome mediated by constitutive monoallelic NF1 inactivation. We identified multiple independent NF1 driver variants in histologically normal tissues, but not in 610 biopsies from two non-predisposed children. We corroborated this finding using targeted duplex sequencing, including a further nine adults with the same syndrome. Overall, truncating NF1 mutations were under positive selection in normal tissues from individuals with neurofibromatosis type 1. We demonstrate that normal tissues in neurofibromatosis type 1 commonly harbour second hits in NF1, the extent and pattern of which may underpin the syndrome's cancer phenotype.

  Dataset EGAD00001015398

• Targeted sequencing of Human esophageal epithelium microbiopsies

  NOTCH1 mutant clones occupy the majority of normal human esophagus by middle age, but are comparatively rare in esophageal cancers, suggesting NOTCH1 mutations may promote clonal expansion but impede carcinogenesis. Here we test this hypothesis. Visualizing and sequencing NOTCH1 mutant clones in aging normal human esophagus, reveals frequent biallelic mutations that block NOTCH1 signaling.  In mouse esophagus, heterozygous Notch1 mutation confers a competitive advantage over wild type cells, an effect enhanced by loss of the second allele.  Notch1 loss alters transcription but has minimal effects on epithelial structure and cell dynamics. In a carcinogenesis model, Notch1 mutations were less prevalent in tumors than normal epithelium. Deletion of Notch1 reduced tumor growth, an effect recapitulated by anti-NOTCH1 antibody treatment.  We conclude that Notch1 mutations in normal epithelium are beneficial as wild type Notch1 promotes tumor expansion. NOTCH1 blockade has therapeutic potential in esophageal squamous tumors.

  Dataset EGAD00001006969

• Single-cell RNA sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell RNA sequencing (scRNA-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007015

• BE_screens_of_WRN_gene_in_MSI_models

  We will take advantage of a base-editing screening strategy to engineer mutations in the WRN gene by deep mutagenesis. Two MSI-H cell lines sensitive to WRNi will be genetically modified to express doxycycline-inducible ABE and CBE base editors through a knock-in strategy. Moreover, we will design a pooled library of ~4000 gRNAs targeting the WRN gene plus appropriate controls gRNAs. Library-transduced cells will be selected with WRNi to identify WRN mutations able to interfere with the activity of WRNi.

  Study EGAS00001006872

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• Effects of busulfan, fludarabine and clofarabine treatment on human small intestinal organoids generated from healthy donors

  The intestine is vulnerable to chemotherapy-induced toxicity due to its high epithelial proliferative rate, making gut toxicity an off-target effect in several cancer treatments, including conditioning regimens for allogeneic hematopoietic cell transplantation (HSCT). In HSCT, intestinal damage is an important factor in the development of Graft-versus-Host Disease (GVHD), an immune complication in which donor immune cells attack the recipient's tissues. Here, we developed a novel human intestinal organoid-based 3D model system to study the effects of chemotherapy-induced intestinal epithelial damage at the RNA level. We show that chemotherapy conditioning specifically reprograms the intestinal epithelial transcriptome after treatment with either busulfan (3.5μM), fludarabine (15μM) or clofarabine (0.5μM) for 24h. This knowledge can potentially enable us to understand which changes undergo in healthy tissues upon conditioning and how those are related with immune activation typical in GVHD.

  Study EGAS00001007550

• Tracking the evolution of esophageal squamous cell carcinoma under dynamic immune selection by multi-omics sequencing

  Intratumoral heterogeneity (ITH) has been linked to decreased efficacy of clinical treatments. However, although genomic ITH has been characterized in genetic, transcriptomic and epigenetic alterations are hallmarks of esophageal squamous cell carcinoma (ESCC), the extent to which these are heterogeneous in ESCC has not been explored in a unified framework. Further, the extent to which tumor-infiltrated T lymphocytes (TILs) are directed against cancer cells, but how the immune infiltration acts as a selective force to shape the clonal evolution of ESCC is unclear. In this study, we perform multi-omic sequencing on 186 samples from 36 primary ESCC patients. Through multi-omics analyses, it is discovered that genomic, epigenomic, and transcriptomic ITH are underpinned by ongoing chromosomal instability. Based on the RNA-seq data, we observe diverse levels of immune infiltrate across different tumor sites from the same tumor. We reveal genetic mechanisms of neoantigen evasion under distinct selection pressure from the diverse immune microenvironment. Overall, our work offers an avenue of dissecting the complex contribution of the multi-omics level to the ITH in ESCC and thereby enhances the development of clinical therapy.

  Dataset EGAD00001009482

• hereditary BrEAst Case CONtrol study (BEACCON)

  The BEACCON study aimed to address the lack of power of previous studies to identify novel BC predisposition genes by performing extensive sequencing in 12,000 women (11,511 analysed following exclusions) and further enhancing power by using an ‘extreme phenotype’ design with enrichment of familial non-BRCA1 and BRCA2 cases, compared with a control population of older women with ongoing confirmation of cancer-free status at June 2019. Three-quarters of the 1303 candidate genes screened were selected based on empiric evidence from local (69 multi-case BC families) or international whole exome sequencing studies, and the remainder were included to provide detailed coverage of functional pathways with established associations with BC.

  Dataset EGAD00001007025

• Molecular risk stratification in patients with T1 colorectal cancer_WES

  The introduction of bowel cancer screening has led to a significant increase in the proportion of patients being diagnosed with asymptomatic, early-stage colorectal cancer (CRC). Although the majority of these patients are successfully treated with surgery alone, a small proportion of patients have 'born-to-be-bad' aggressive lesions with early dissemination leading to distant metastases. Current standard of care histological assessment is unable to distinguish between these aggressive versus non-aggressive early lesions which is essential to provide appropriate clinical management decisions. This study aims to carry out molecular and histological profiling of approximately 300 T1 CRCs in order to develop a molecular stratifier based on the risk of relapse in early-invasive CRC. This novel T1 cohort will represent the world's largest molecularly characterised T1 cohort of samples, with digital pathology assessment alongside whole exome sequencing, copy number variation analysis and 3' RNA-seq. This data will be used to generate a robust panel of molecular and/or histological markers applicable to formalin-fixed paraffin embedded (FFPE) archival tissue which discriminates between T1 lesions based on risk of relapse, which will ultimately be used to inform clinical management of CRC at the earliest stages of the disease.

  Dataset EGAD00001010890

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. It seems plausible that rates of implantation would improve if we had a better understanding of molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to identify candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Dataset EGAD00001005044

• ChIIP-seq and RNA-seq

  epigenome profiling in tumor tissues and paired normal tissues of LUAD patients and transcriptome profiling in tumor tissues of LUAD patients.

  Dataset EGAD00001007066

• Breast Cancer FRT RNA seq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000338

• Exome sequencing for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome

  Exome sequencing was performed for paired tumor/normal samples from patients with corticotropin-independnet Cushing's syndrome. Tumor DNA was extracted from adrenocortical adenomas and normal DNA was extracted from adjacent adrenal tissues or periphral blood.

  Dataset EGAD00001000715

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• Pakistan_Damgaard2018

  Genotype data for 140 present-day individuals from five populations in Pakistan in The first horse herders and the impact of early Bronze Age steppe expansions into Asia DOI: 10.1126/science.aar7711. Sampling details are presented in supplementary section S2.1 Data generation

  Dataset EGAD00010001678

• Whole genome sequencing of Sinonasal hemangiopericytoma and patient derived cell line model

  Solitary fibrous tumor/Hemangiopericytoma (SFT/HPC) is a rare subtype of soft tissue sarcoma associated with NAB2-STAT6 gene fusions. In this study, a novel SFT/HPC was characterized using whole genome sequencing.

  Dataset EGAD50000000038

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• AmsterdamUMC Data Access Committee for the study "Multi-omic analysis of thyroid dysfunction in Down Syndrome"

  The current data access committee reviews and assesses data requests of researchers that seek to gain access to data acquired as part of the "Multi-omic analysis of thyroid dysfunction in Down Syndrome" study as performed at the AmsterdamUMC, Amsterdam, Netherlands.

  Dac EGAC50000000186

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• Raw ONT R10 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 207 samples sequenced using rapid-multiplexed barcoded library preparation on Nanopore PromethION R10 flow cells on P2 Solo and P24 systems. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000791

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• Tumor Profiler Project - AML bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 23 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000822

• Tumor Profiler Project - AML scDNA data

  The dataset contains single-cell DNA seq data from 21 patients with Acute Myeloid Leukemia (AML). Samples were collected from bone marrow or blood. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000824

• Tumor Profiler Project - MEL bulk transcriptomics data

  The dataset contains bulk transcriptomics data from 80 samples from 77 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000851

• Tumor Profiler Project - MEL scDNA data

  The dataset contains 10x Chromium single-cell DNA sequencing data from 63 samples from 60 different patients with melanoma. Samples were collected from the tumor. Sequencing was performed in paired-end mode and sequencing data is provided in fastq format.

  Dataset EGAD50000000852

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• Tumor Profiler Project - OV cell-free DNA data

  The dataset contains amplicon sequencing data from 48 samples from 35 different patients with ovarian cancers. Cell free DNA was collected from plasma. Sequencing was performed on an Ion Torrent platform and the sequencing data is provided in bam format.

  Dataset EGAD50000001410

• PRPH2-Related Retinal Dystrophies

  NGS dataset including patients affected by genomic variants at gene PRPH2. It includes NGS test using custom IRD gene panels, clinical exome sequencing (CES) and whole-exome sequencing (WES).

  Dataset EGAD50000001239

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971