16624 results for "sec+and+unspecified+malignant+neoplasm"

in 39.03 milliseconds.

• WTCCC3_Anorexia_Nervosa

  As part of the Genetic Consortium for Anorexia Nervosa (GCAN) and Wellcome Trust CaseControl Consortium 3 (WTCCC3), we have amassed the largest anorexia nervosa (AN)sample in the world (~4,000). Following the WTCCC3 GWAS, we secured funding from theKlarman Family Foundation to extend the genetic analyses to variants on the exome chip(CoreExome array). This pre-lim relates to carrying out genotyping on the CoreExome arrayon up to a maximum of 580 new samples.

  Study EGAS00001000913

• Genomic study of an AT-AML

  Ataxia Telangiectasia (A-T) is caused by biallelic mutations in ATM and confers predisposition to cancer, with acute myeloid leukaemia (AML) being rarely observed. We investigated an AML arising in an A-T patient for secondary genetic events by performing whole exome sequencing of serial samples over the disease course. AML samples were compared to a reference "germline" sample from a much earlier time point. Goldgraben et al 2020, Pediatric Blood & Cancer

  Study EGAS00001004392

• Colorectal_Adenoma_Gene_Screen

  A pilot to establish the feasability of using a custom Agilent targeted pulldown of 110 genes implicated in colorectal tumourigensis to sequence for driver mutations in a set of 30 FFPE colorectal adenomas. If successful, we propose to sequence an additional 350 adenomas as part of a MRC research study in order to define the pattern of driver mutations across the spectrum of pathological subtypes including coventional adenomas, serrated adenomas and hyperplastic polyps

  Study EGAS00001001261

• Korean Young Age Diffuse Gastric Cancers

  The incidence of diffuse gastric cancers (DGC) remains steadily high, but relatively small numbers of DGCs have been evaluated with whole exome sequencing (WES). Clinicopathological features of DGC vary according to age, but the molecular basis for these variations is unclear. To identify genomic alteration in this unique subset of gastric cancers, whole exome and SNP6 analyses were performed using frozen cancer tissue. The same analyses were also performed using blood of the same patients.

  Study EGAS00001001711

• To_profile_the_landscape_of_sebaceous_tumours_WES

  Sebaceous tumours are a rare cutaneous cancer with potential for aggressive behaviour. However, limited information is available on these cancers with few published cases. Here we wish to exome sequence these cancers to define the first genomic landscape for this malignancy. We will extract DNA from formalin-fixed, paraffin-embedded (FFPE) cores. Cores may be obtained from lesional and non-lesional tissues of primaries as well as matching metastases. The extracted DNA will be used for exome sequencing.

  Study EGAS00001003553

• Breast Cancer - immune clusters - RNA-seq

  In this study we use expression data from breast cancer tumors to define immune clusters in breast cancer. Immune clusters have gradual levels of immune infiltration. In the intermediate immune infiltration cluster, we found a worse prognosis which is independent of known clinicopathological features. We also found the immune clusters associated with treatment response. Further using gene expression data and deconvolution algorithms to dissect the immune contexture of the clusters.

  Study EGAS00001003631

• Deep_sequencing_analysis_of_human_iPSC_specific_SNVs_in_donor_cell_population

  CR products were obtained from each target loci using genomic DNA from human iPS cells. Subsequently, PCR products are pooled and subjected to Illumina library preparation. The library will be sequenced either by HiSeq or MiSeq. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001000373

• Circulating tumor cell copy-number heterogeneity in ALK-rearranged non-small-cell lung cancer resistant to ALK inhibitors

  Gatekeeper mutations are identified in only 50% of the cases at resistance to Anaplastic Lymphoma Kinase (ALK)-tyrosine kinase inhibitors (TKIs). Circulating tumor cells (CTCs) are relevant tools to identify additional resistance mechanisms and can be sequenced at the single-cell level. Here, we provide in-depth investigation of copy number alteration (CNA) heterogeneity in phenotypically characterized CTCs at resistance to ALK-TKIs in ALK-positive non-small cell lung cancer.

  Study EGAS00001005301

• Whole-exome sequencing of ovarian clear cell carcinoma in clinical outliers

  Whole-exome sequencing dataset for the Australian Ovarian Cancer Study (AOCS) and The Jikei University School of Medicine (JIKEI) ovarian clear cell carcinoma (OCCC) clinical outliers project, representing 10 donors. Although OCCC are commonly resistant to platinum based chemotherapy, good clinical outcomes are observed in a subset of patients. Exome sequencing was performed in 10 patients who had either unusually long survival (N=5) or had a very short time to progression (N=5).

  Study EGAS00001004248

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• Differential gene expression in the colon mucosa of irritable bowel syndrome patients with mixed type symptoms

  The aim of this study is to characterize the pathophysiology of the irritable bowel syndrome (IBS) on the functional level and in parallel on the gene expression level. For this purpose RNAseq of mucosal biopsies was performed. The data from the differential expression analysis will be further processed by Ingenuity Pathway Analysis (IPA) software to gather Information on activated or inhibited signaling pathways in the disease.

  Study EGAS00001004835

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Profiling of 27 type 2 diabetes GWAS loci using next-generation (NG) capture C in a human beta-cell model

  Most type 2 diabetes association signals are due to variants that impact gene regulation but identifying the genes they impact is challenging. We generated interaction profiles at 27 T2D GWAS loci using next-generation (NG) capture C in a human beta-cell model ( EndoC-betaH1) and contrasted our maps with public Hi-C/promoter capture Hi-C maps in EndoC-betaH1 cells or human islets.

  Study EGAS00001006105

• Whole-Exome Sequencing analyses in tamoxifen-associated endometrial cancer

  An increased incidence of endometrial cancer has been described for patients that have received tamoxifen to treat breast cancer. Using samples from endometrial tumors, isolated from surgivcal specimens of patients who previously received tamoxifen treatment for breast cancer, we aimed to identify whether there are specific somatic mutations enriched in this population, relative to endometrial tumors from the general population. For this, WES was performed on matched endometrial tumors and healthy tissue (n=21).

  Study EGAS00001006453

• Follicular lymphoma at diagnosis, treated in first line with immunochemotherapy

  We performed targeted NGS in Follicular lymphoma samples at diagnosis. Explored clinico-genetic correlations and assessed four clinical or clinicogenetic risk models (FLIPI, FLIPI-2, PRIMA-IP or m7-FLIPI-molecular score) in patients with symptomatic FL who received frontline immunochemotherapy. Out of 191 patients with FL grade 1-3a, 109 were successfully genotyped. Treatment consisted on rituximab (R) plus CVP/CHOP (72.5%) or R-bendamustine (R-B) (27.5%).

  Study EGAS00001006674

• Pre-diagnostic saliva microbiota of Finnish children with autoimmune diseases

  Pre-diagnostic saliva microbiota samples of Finnish children (aged 11/12 years). This is a case-control study, where case refers to the children who developed Type 1 DM or IBD later in life and control refers to the children who were free from these diseases. The aim of the study was to find biomarkers in saliva microbiota that may help us predict DM or IBD before the onset of these diseases.

  Study EGAS00001006949

• To_profile_the_landscape_of_sebaceous_tumours___RNA

  Sebaceous tumours are a rare cutaneous cancer with potential for aggressive behaviour. However, limited information is available on these cancers with few published cases. Here we wish to exome sequence these cancers to define the first genomic landscape for this malignancy. We will extract RNA from formalin-fixed, paraffin-embedded (FFPE) cores. Cores may be obtained from lesional and non-lesional tissues of primaries as well as matching metastases. The extracted RNA will be used for RNA sequencing.

  Study EGAS00001007803

• Single-cell antibody-derived tag sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell antibody-derived tag sequencing (scADT-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007017

• Data distribution Statistics

  EGA Statistics Bibliography Growth Community Archive Distribution Catalogue Here, we show the amount of data distributed by the EGA. Data Distributed / Live EGA Data Distribution / Live SFTP Aspera HTSGET lineChartLive("svg#ega-dist-live", document.querySelector("#ega-figure-dist-live figcaption")); Data Distributed The below figure represents the cumulative EGA data distribution via the download clients(v2 and v3.x api versions) using HTTPS, FTP, and download boxes using ASPERA. You can see cumulative values by clicking "Cumulative". EGA Data Distribution //lineChart('#ega-data-distribution svg.stats', 'https://stats.ega-archive.org/distribution', // ['Amount of Distributed Data', ['Aspera', 'Download Clients', 'Total']]) curveChart('#ega-data-distribution', [ { domId: 'stats-aspera', label: 'Aspera', url: 'https://stats.ega-archive.org/distribution/aspera' }, { domId: 'stats-sftp' , label: 'SFTP', url: 'https://stats.ega-archive.org/distribution/sftp' }, //{ domId: 'stats-htsget', label: 'HTSGET', url: 'https://stats.ega-archive.org/distribution/htsget' }, { domId: 'stats-streamer' , label: 'Download Client', url: 'https://stats.ega-archive.org/distribution/streamer' }, { domId: 'stats-total' , label: 'Total', url: 'https://stats.ega-archive.org/distribution/total' } ] );

  Documentation about/statistics/distribution

• Transcriptome analysis of a novel human iPSC-derived 3D cortical tissue model - WT, APP KI, Abeta-treated, Abeta/Aducanumab-treated

  Single-cell RNA-seq analysis of human iPSC-derived microglia/astrocytes/neurons in a novel, human in vitro 3D cortical tissue model. Samples include distinct conditions (each as biological duplicates): - wild-type cells from cultures after 1 month (WT_1mo, cell lines: A18, KOLF) and 3 months (WT_3mo, cell lines: SA2, KOLF, A18) of culturing - knock-in cells from cultures carrying three familial AD mutations in the APP gene (Swedish, Iberian, Arctic; introduced by CRISPR/Cas9-mediated knock-in) after 3 months of culturing (KI_3mo, cell lines: SA2, A18) - subset of WT 1 month-old samples were exposed to 500nM synthetic Abeta42 for 2 consecutive feeds, and a subset of these subsequently treated with 1µg/ml Aducanumab antibody for 14 days

  Dataset EGAD50000002031

• Targeted Sequencing of 52 Genes for Severe COVID-19

  This dataset comprises targeted sequencing data of 52 genes previously implicated in severe COVID-19 outcomes. The study includes samples from 764 individuals with severe COVID-19 and 3,939 population-based controls from the GCAT cohort (Spain). Molecular Inversion Probes (MIPs) were utilized for cost-effective and precise sequencing of the selected genes. The targeted genes include: Inflammasome/IL-1/TNF Pathway: NLRP3, CASP1, CASP8, IL1B, TNF, RIPK1, RIPK3, MYD88, TNFRSF13B SARS-CoV-2 Entry/Replication: ACE2, TMPRSS2, FURIN, SLC6A20, DDX1, DDX58, TLR4, FYCO1, CTSB, CTSL, ADAM17 Complement System: MBL2, CFH, CFI, CFB, ADAM10, CD46 Interferon Signaling: TLR3, IFIH1, IFITM3, TBK1, TLR7, IL10RB, IFNAR1, IFNAR2, SIGLEC1, MYD88, IFNGR1 Chemokine Receptor Signaling: CCR1, CCR3, CCR2, CCR9, IL8, CXCL3, CXCL10, CXCR6, XCR1, CCL2, CCL20 Immunodeficiency Genes: CASP8, CD46, CFB, CFH, CFI, IFNAR1, IFNAR2, IFNGR1, IFIH1, MYD88, NLRP3, RIPK1, TBK1, TLR3, TLR7

  Dataset EGAD50000001378

• CLUSTER Consortium RNAseq CD19 Dataset of pre-methotrexate UK JIA patients cohort

  This is the RNAseq CD19 dataset (paired FASTQ files, n = 83 paired files) generated from pre-methotrexate treatment JIA patients cohort samples. CD19 cells were sorted from isolated total PBMC by cell sorter (BD FACSAriaTM III, BD Biosciences). Clinical metadata is also included in this dataset. Samples were sequenced on the NovaSeq6000 instrument (Illumina, San Diego, US) at 300pM, using a 100bp paired read run with corresponding 8bp dual sample index and 5bp or 8bp unique molecular index reads. Run data were demultiplexed and converted to FASTQ files using Illumina’s BCL Convert Software v3.75.

  Dataset EGAD50000001459

• CLUSTER Consortium RNAseq CD14 Dataset of pre-methotrexate UK JIA patients cohort

  This is the RNAseq CD14 dataset (paired FASTQ files, n = 80 paired files) generated from pre-methotrexate treatment JIA patients cohort samples. CD14 cells were sorted from isolated total PBMC by cell sorter (BD FACSAriaTM III, BD Biosciences). Clinical metadata is also included in this dataset. Samples were sequenced on the NovaSeq6000 instrument (Illumina, San Diego, US) at 300pM, using a 100bp paired read run with corresponding 8bp dual sample index and 5bp or 8bp unique molecular index reads. Run data were demultiplexed and converted to FASTQ files using Illumina’s BCL Convert Software v3.75.

  Dataset EGAD50000001458

• CLUSTER Consortium RNAseq CD8 Dataset of pre-methotrexate UK JIA patients cohort

  This is the RNAseq CD8 dataset (paired FASTQ files, n = 85 paired files) generated from pre-methotrexate treatment JIA patients cohort samples. CD8 cells were sorted from isolated total PBMC by cell sorter (BD FACSAriaTM III, BD Biosciences). Clinical metadata is also included in this dataset. Samples were sequenced on the NovaSeq6000 instrument (Illumina, San Diego, US) at 300pM, using a 100bp paired read run with corresponding 8bp dual sample index and 5bp or 8bp unique molecular index reads. Run data were demultiplexed and converted to FASTQ files using Illumina’s BCL Convert Software v3.75.

  Dataset EGAD50000001456

• CLUSTER Consortium RNAseq CD4 Dataset of pre-methotrexate UK JIA patients cohort

  This is the RNAseq CD4 dataset (paired FASTQ files, n = 86 paired files) generated from pre-methotrexate treatment JIA patients cohort samples. CD4 cells were sorted from isolated total PBMC by cell sorter (BD FACSAriaTM III, BD Biosciences). Clinical metadata is also included in this dataset. Samples were sequenced on the NovaSeq6000 instrument (Illumina, San Diego, US) at 300pM, using a 100bp paired read run with corresponding 8bp dual sample index and 5bp or 8bp unique molecular index reads. Run data were demultiplexed and converted to FASTQ files using Illumina’s BCL Convert Software v3.75.

  Dataset EGAD50000001455

• Follow_up_for_second_tier_signals_from_the_arcOGEN_GWAS

  The arcOGEN UK nationwide consortium has been funded by the arc to undertake a genome-wide association scan in osteoarthritis. GWA genotyping has been carried out at the Sanger on the illumina 610k array. This replication study was desinged to follow-up second-tier signals from the arcOGEN GWS in 25 SNPs (1Sequenom iPLEX) with p<5x10^-6 on 6000 additional UK OA and control samples.

  Study EGAS00001001017

• Whole genome sequencing of pancreatic cystic fluid for early detection and diagnosis of pancreatic cancer

  Pancreatic cancer (PC) is a leading cause of cancer-related deaths globally. Accurate PC detection at early or premalignant stage, when surgery is effective, would increase survival rates and prevent unnecessary surgery or surveillance. Molecular diagnostic attempts using PCy fluid (PCyF), as a liquid biopsy, to analyze common mutations associated with PC development are yet to contribute to early diagnosis. Whole genome sequencing (WGS) is utilized in various cancers, PC inclusive, for detecting genetic changes associated with carcinogenesis, but not in PCyF due to technical limitations, including isolated DNA purity. The goal of the study was to achieve high quality of WGS from PCyF from 9 patients to enable development of signatures of malignancy. The WGS was performed using Illumina sequencing. Experimental design was at a 50x depth.

  Dataset EGAD50000000869

• Alpha synucleinopathy spectrum - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=44 samples. Tissue samples correspond to patients with different alpha synucleinopathies. Specifically, idiopathic Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=11). RNA seq was carried out using ribosomal depletion. The totality of these samples were also sequenced using single nucleus RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000430

• Complex-I stratification of Parkinson's disease - single nucleus RNAseq

  Single nucleus RNA seq dataset for CI stratification of Parkinson's disease Single nucleus RNA seq dataset of prefrontal cortex tissue from a total of N=18 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=12) and neurologically healthy controls (N=6). Single nucleus RNA seq was carried out using 10X Genomics Chromium. This dataset corresponds to a subset of the samples sequenced using conventional bulk tissue RNA seq and available within this Study as a separate Dataset.

  Dataset EGAD50000000432

• Complex-I stratification of Parkinson's disease in the prefrontal cortex - bulk RNA seq

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=98 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=79) and neurologically healthy controls (N=19). RNA seq was carried out using ribosomal depletion. A subset of these samples was additionally sequenced using single nucleus RNA seq and is available in the same Study as an additional Dataset.

  Dataset EGAD50000000433

• Sequencing data for oesophageal and related samples - Normals release 3 (RNA)

  Dataset EGAD00001003902

• Sequencing data for oesophageal and related samples - Normals release 5 (RNA)

  Dataset EGAD00001005384

• Sequencing data for oesophageal and related samples - Normals release 2 (RNA)

  Dataset EGAD00001003838

• Sequencing data for oesophageal and related samples - Normals release 4 (RNA)

  Dataset EGAD00001004022

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• RNA sequencing of AML with 3q26 rearrangements

  RNA sequencing of 44 AML cases with diverse 3q26 rearrangements. This dataset is complementary to EGAD00001000726 (which only contains t(3;3)/inv(3)) and to EGAD00001006123.

  Dataset EGAD00001015629

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• MDA whole exome sequencing data for bladder cancer

  46 BAM files from 23 urothelial bladder cancer patients on an immunotherapy clinical trial. PBMC normal samples and solid tumor samples are paired. Alignment was done by BWA with reference genome hg19.

  Dataset EGAD00001005712

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• scATAC sequence runs of 29 samples of RRMM (multiple myeloma) tumors

  scATAC sequencing was performed of 29 samples of RRMM tumors using 10xGenomics for the preparation and NovaSeq6000 for sequencing.

  Dataset EGAD00001009683

• Dataset for Transcriptomic sequencing data for neuroblastoma tumor samples

  Dataset Transcriptomic sequencing data of 42 neuroblastoma tumor samples. The sequencing was performed on Illumina HiSeq 2000 and Illumina HiSeq 4000. The sequencing was always paired.

  Dataset EGAD00001015812

• ADAPTeR Study: scRNA/TCRseq data from ccRCC patients

  ADAPTeR study scRNA and scTCR data from TILs from two ccRCC patients treated with nivolumab

  Dataset EGAD00001008166

• Whole-exome sequencing (WES) data of papillary thyroid cancer and adjacent normal tissues

  High-coverage WES sequencing of DNA samples from 50 PTCs was performed on the Illumina HiSeq 2500 or 4000 System

  Dataset EGAD00001003262

• miR-17-92 organoids

  Organoid cultures derived from colorectal adenomas were transduced with a miR-17-92 expressing vector. RNA from miR17-92-overexpressing organoids and respective non-transduced organoids (controls) was isolated for expression analysis.

  Dataset EGAD00001008480

• POPLAR clinical data

  Relevant clinical data for POPLAR including treatment arm, histology, overall survival, progression-free survival, and best confirmed overall response.

  Dataset EGAD00001008548

• High-resolution analysis for urinary DNA jagged ends

  consists 17 cases, 7 control cases and 10 cancer cases.

  Dataset EGAD00001008594

• OAK clinical data

  Relevant clinical data for OAK including treatment arm, histology, overall survival, progression-free survival, and best confirmed overall response.

  Dataset EGAD00001008549

• High-resolution lung adenocarcinoma expression subtypes

  High-resolution lung adenocarcinoma expression subtypes identify tumors with dependencies on MET, CDK4, CDK6, and PD-L1

  Dataset EGAD00001009339

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• WGS, RNA-seq and methyl-seq data for multiple tumour clones from a single glioblastoma case.

  10 bams of WGS data from HiSeqXTen platform; 10 bams of RNA-seq data from HiSeq2500 platform; 7 bams of TruSeq Methyl Capture EPIC sequencing data from HiSeq4000 platform

  Dataset EGAD00001004773

• Isala Cross sectional Flow Meta Data

  This meta data contains extensive meta data from the cross sectional flow of the Isala Citizen Science project. The meta data file contains ENA Accession numbers for 16S Microbiome data, and cleaned responses to questionnaires.

  Dataset EGAD00001009890

• Single-cell transcriptome of T-ALL PDX under drug treatment

  PDX model of T-ALL under treatment of CB-103 and Vehicle was analyzed by single-cell transcriptomics using 10X Genomics technology.

  Dataset EGAD00001009172

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• The Extracellular RNA Quality Control (exRNAQC) study (phase 2)

  mRNA capture sequencing and small RNA sequencing data (FASTQ files) of the exRNAQC study phase 2 (interaction study)

  Dataset EGAD00001009724

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• Strand-specific RNA sequencing of 16 pairs of primary and relapsed IDH-wt glioblastomas

  This dataset contains strand-specific RNA sequencing data from 16 primary/relapsed sample pairs of IDH-wt glioblastomas

  Dataset EGAD00001004564

• Chondromyxoid fibroma

  Chondromxoid fibroma is a benign tumour of bone with unknown underlying pathogenesis. To determine pathognomic genomic event in chondromyxoid fibroma whole genome sequencing will be undertaken to reconstruct rearrangements and find underlying mutations.

  Dataset EGAD00001001063

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Neuroblastoma WGS dataset

  Dataset with whole-genome sequencing tumor and normal samples from 14 neuroblastoma patients.

  Dataset EGAD00001010030

• Sequencing data for the manuscript "Early on-treatment changes in circulating tumor DNA fraction and response to enzalutamide or abiraterone in metastatic castration-resistant prostate cancer"

  This submission contains gzipped fastq files from paired-end targeted sequencing.

  Dataset EGAD00001010105

• Human serum small non-coding RNA sequencing

  Human small non-coding RNA sequencing of serum from sons of PCOS mothers (n=9) and sons of control mothers (n=9), see publication for details.

  Dataset EGAD00001010165

• Single-cell colony targeted DNAseq

  Targeted DNA sequencing was applied to colonies grown from single-cells of patient A.6. The protocol followed is described in https://doi.org/10.1038/s41467-021-21650-1 and the methods of the manuscript

  Dataset EGAD00001010193

• RNA-seq dataset of CD34+ HSPCs from LRMDS patients

  To profile transcriptional alterations of HSPCs in LR-MDS patients, 7AAD−CD45+Lin-CD235a−CD34+ cells were isolated from healthy donors and LR-MDS patients for RNA sequencing.

  Dataset EGAD00001015771

• Validation for human early embryonic substitutions (2017-05-11)

  PCR and MiSeq validation for early embryonic substitution candidates from 400 Breast cancer patients This dataset contains all the data available for this study on 2017-05-11.

  Dataset EGAD00001003332

• Multi-omics Profiling of Asian Breast Cancers

  186 tumor/normal matched samples from whole exome sequecing and 178 samples (168 tumors, 10 normals) from whole transcriptome sequencing

  Dataset EGAD00001003776

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Ewings Sarcoma RNA-seq drug sensitivity

  Illumina RNA-Seq will be performed on four Ewing's sarcoma cell lines and two control cell lines. RNA was extracted from all the lines using a basic Trizol extraction protocol.

  Dataset EGAD00001000337

• Exome sequencing of Congenital Heart Disease families Toronto

  The exome sequencing is performed using Agilent SureSelect 50Mb exome v3 and Hiseq 75bp paired reads with an mean sequencing coverage target of 50X.

  Dataset EGAD00001000799

• BRIDGE Bleeding and Platelet Disorders

  Whole exome sequencing BAM files for samples from the BRIDGE Consortium with pathogenic or likely pathogenic variants on genes linked to bleeding or platelet disorders.

  Dataset EGAD00001001333

• BLUEPRINT Gene expression profiles of human hematopoietic progenitors

  Gene expression was analyzed for stem/progenitor cell types and terminally differentiated cell types of the human blood lineage (HSC, MPP, CMP, GMP, CLP, MLP0, MLP1, MLP2, MLP3).

  Dataset EGAD00001002733

• Human Developmental Cell Atlas_HDCA - WGS (2019-04-11)

  Single cell + bulk genomics study for immune and hematopoietic organs during human fetal development . This dataset contains all the data available for this study on 2019-04-11.

  Dataset EGAD00001004953

• WGS datasets of pediatric glioblastoma

  WGS with linked reads of pediatric glioblastoma. For each patient, blood and tumor tissue were sequenced. For two patients, we also provide sequencing data for the blood of their parents.

  Dataset EGAD00001005212

• Wilms Tumour organoid sequencing WGS (2019-09-05)

  This study investigates the genomic and transcriptomic characteristics of Wilm's tumour organoids . This dataset contains all the data available for this study on 2019-09-05.

  Dataset EGAD00001005312

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• sWGS for genome-wide copy number profiling

  Shallow whole-genome sequencing (sWGS) data for the identification of somatic copy number alterations (SCNA) and the estimation of tumor fractions in plasma DNA of metastatic colorectal cancer patients (mCRC).

  Dataset EGAD00001006384

• Tumor Whole-exome sequencing

  20 tumor tissue WES data with paired cfDNA sWGS data. This data is used for concordance analysis between cfDNA-based and tissue-based CNA. The WES libraries were sequenced across 3 independent runs using multiple lanes.

  Dataset EGAD50000001864

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• Spatial transcriptomics analysis of triple negative breast cancers

  Spatial transcriptomics analysis of triple negative breast cancers Both bulk sequencing and ST were performed Counts, images etc are available at https://zenodo.org/doi/10.5281/zenodo.8135721

  Dataset EGAD50000000686

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• RNA-seq data for Heterogeneity of IKZF1 genomic alterations and risk of relapse in childhood BALL

  RNA-seq data for 14 samples with B-cell acute lymphoblastic leukemia

  Dataset EGAD50000000151

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• Pacbio_methylation_controls

  The PacBio control dataset for differential methylation analysis included 39 control samples without methylation disorders. All samples were sequenced using PacBio Revio® HiFi reads at a matched coverage of 15X, and methylation was called using pb-cpg-tools on aligned BAM files.

  Dataset EGAD00010002806

• Peru.mg.maf.subsetEGA

  Genotypes generated for study investigating signals of selection in Peruvians from three ecological regions. 96 genotypes in plink format after QC filtering (missingness per individual, per variant and minor allele freq). See publication for more details on QC filtering.

  Dataset EGAD00010002261

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716