16624 results for "sec+and+unspecified+malignant+neoplasm"

in 89.63 milliseconds.

• Hospital for Sick Children Infant Glioma RNA Sequencing

  Whole transcriptome (n=4) and targetted RNA sequencing (n=15) .bam files of infantile glioma samples reported on at the Hospital for Sick Children

  Dataset EGAD00001005092

• Somatic genetic basis of Wilms' tumour

  We investigated the somatic genetic basis of Wilms' tumour and found complex phylogenetic relations between tumours

  Dataset EGAD00001005134

• ChIP-seq for GOF p53

  This dataset includes ChIP-seq data from two cell lines (HKCI-11 (GOFp53) and MIHA(WT p53)). All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005449

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• BAM files of evolution T-ALL adults project

  WGS BAMs of 19 adult patients with T-acute lymphoblastic leukemia with primary, remission and relapse sample per patient. Total = 58 samples sequenced with HiSeq 4000 or NovaSeq 6000 (Illumina).

  Dataset EGAD00001006543

• Single-cell CITE-seq from MDS patients with SF3B1 mutations

  Single-cell CITE(cellular indexing of transcriptomes and epitopes)-seq from MDS (n = 2, MDS02 in 2 replicates). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011281

• ARIC

  Bam files are from matched normal + "very early" plasma (diagnostic) samples, sequenced on Illumina NovaSeq 6000 instrument. After bwa alignment, duplicates were removed by picard markduplicate, and base quality scores recalibrated using gatk baserecalibrator + apply bqsr.

  Dataset EGAD00001015603

• De novo metastatic prostate cancer cohort

  Fastq files from RNA sequencing of normal and tumor samples from 16 patients from the de novo metastatic prostate cancer cohort.

  Dataset EGAD50000002381

• Pan Prostate Cancer Group DK BAM files

  This dataset contains the BAM files from 32 Danish patients with prostate cancer, both germline and tumor tissues. These samples are part of the Pan Prostate Cancer Genome project.

  Dataset EGAD50000002318

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Enzymatic methylation sequencing of intestinal metaplasia

  We perform genome-wide EM-seq of 14 patients with concurrent matched normal, dysplasia and early gastric samples from South Korea. The dataset contains cram files from 38 samples.

  Dataset EGAD50000001538

• Holistic ends analysis

  This dataset comprises fastq or bam files derived from sequencing data of dsDNA and ssDNA libraries from 138 plasma cfDNA samples.

  Dataset EGAD50000001737

• Single cell transcriptomes from vascularized human retinal organoids

  Both control and vascularized organoids were processed using the 10x Chromium 3' RNA method. Sequencing reads were aligned with STARsolo.

  Dataset EGAD50000001216

• Dataset of Clonal Evolution of PPM1D Mutations in the Spectrum of Myeloid Disorders

  This dataset contains genomic profiles of 7 PPM1D-mutated patients across the spectrum of myeloid disorders using single-cell analyses (Tapestri technology) on diagnostic and longitudinal samples.

  Dataset EGAD50000001229

• SCLC MeDIP-seq

  Methylation profile of 33 patients with small cell lung cancer (SCLC) for both, tumour and normal lung samples using MeDIP-seq.

  Dataset EGAD50000000724

• Short-read transcriptomic data

  Short-read transcriptomic data of unaffected control, expansion negative, and expansion positive FECD CECs

  Dataset EGAD50000000436

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• SECRETO Oral metagenome

  The dataset comprises data for n=329 participants who underwent saliva sampling. Shotgun metagenomic paired-end sequencing was conducted using the Illumina NovaSeq 6000 platform, and the resulting files are in FASTQ format.

  Dataset EGAD50000000283

• PCA Atlas donor genotyping arrays (Axiom UK Biobank v2.0)

  Raw Axiom v2.0 UK Biobank Array CEL files for PCA Atlas donor buffy-coat DNA, used to generate SNP genotypes for demultiplexing single-cell and spatial transcriptomics libraries.

  Dataset EGAD00010002818

• OncoScan SNP data set for localized follicular lymphoma (lFL)

  149 unpaired initial tumor samples (133/149 FFPE and 16/149 fresh frozen samples) of lFL patients measured with OncoScan SNP microarrays, Affymetrix CEL intensity data file types (Thermo Fisher Scientific, Waltham, Massachusetts, USA)

  Dataset EGAD00010002593

• H3Africa EPIGEN EWAS

  Data from 59 whole blood samples from pregnant mothers, unexposed and exposed to the Rwandan genocide, was generated using Infinium MethylationEPIC BeadChip Kit.

  Dataset EGAD00010002383

• H3Africa SIREN GWAS Stroke

  3421 Samples from Nigeria and Ghana, genotyped with the Illumina NestSeq 500

  Dataset EGAD00010002551

• eMERGE Genome-Wide Association Studies of Obesity (Metabochip)

  The Geisinger eMERGE Genome Wide Association Studies of Obesity (Metabochip) Project is a genetic study of a cohort of primarily Caucasian patients with extreme obesity who have undergone bariatric surgery. Roux-en-Y gastric bypass (RYGB) surgery, in which intestinal anatomy is altered, dramatically ameliorates and/or eliminates Type 2 diabetes mellitus (T2D) in 50-80% of patients within hours to days following surgery, well before significant weight loss, in contrast to other types of bariatric surgeries, such as gastric banding, that attenuate insulin resistance as a result of substantial weight loss that occurs over months to years. The molecular mechanism by which RYGB exerts this clinical phenomenon is not known. The goal of this project was to conduct a genome wide association study (GWAS) to identify genetic variants associated with amelioration in T2D defined by medication independence. Identifying genetic variants that influence the dramatic resolution of T2D from RYGB may identify novel targets for pharmacological T2D therapies and/or identify patients in whom RYGB may not be effective.

  Study phs000380

• Pharmacogenetics of Efavirenz Discontinuation for Reported Central Nervous System Symptoms Appears to Differ by Race

  This is an evaluation of genetic associations with efavirenz (EFV) discontinuation for central nervous system (CNS) symptoms within 12 months of treatment. Patients were treated at an HIV primary care clinic in Nashville TN from 1998 to 2012. Previously known SNPs in CYP2B6 and CYP2A6 were used to define metabolizer genotypes (extensive, intermediate, slow metabolizer). Over 500,000 SNPs from genome-wide genotyping were used to define MDS (Multidimensional Scaling) coordinates to account for population stratification. Patients were defined as cases if they discontinued EFV for CNS symptoms within 12 months, otherwise they were defined as controls if they did not stop treatment. Among 563 evaluable participants, the hazard ratio for EFV discontinuation for CNS symptoms was 4.9 (95% C.I. 1.9 TO 12.4, p=0.001) in slow metabolizers compared to extensive metabolizers. This association was very significant in Whites 6.5 (95% CI: 2.3 to 18.8; p = 0.001), but not in Blacks 2.6 (95% C.I. 0.5 to 14.1; p = 0.27). The reason for this difference by race is not clear and warrants further investigation.

  Study phs001253

• CD4+ cell transcriptional profiling by RNA sequencing

  We use next generation sequencing to investigate the different transcriptomes of closely related CD4+ T-cells from healthy human donors to elucidate the genetic programs that underlie their specialized immune functions. Six cell types were included: Regulatory T-cells (CD25hiCD127low/neg with >95% FOXP3+ purity), regulatory T-cells activated using PMA/ionomycin, CD25-CD45RA+ ('naive' helper T-cells), CD25-CD45RO+ ('memory' helper T-cells), activated Th17 cells (>98% IL17A+ purity) and activated IL17-CD4+ T-cells (called 'ThPI'). Poly-T capture beads were used to isolate mRNA from total RNA, and fragment sizes of ~200 were sequenced from both ends on Illumina's genome analyzer. We confirm many of the canonical signature genes of T-cell populations, but also discover new genes whose expression is limited to specific CD4 T-cell lineages, including long non-coding RNAs. Additionally, we find that genes encoded at loci linked to multiple human autoimmune diseases are enriched for preferential expression upon T-cell activation, suggesting that an aberrant response to T-cell activation is fundamental to pathogenesis.

  Study phs000626

• Whole Exome Sequencing Study of TGFΒ Pathway Genes in HCV Liver Fibrosis

  Despite the astonishing progress in treating chronic hepatitis C virus (HCV) infection with direct-acting antiviral agents, liver fibrosis remains a major health concern in HCV infected patients, in particular due to the treatment cost and insufficient HCV screening in many countries. Only a fraction of patients with chronic HCV infection develop liver fibrosis. While there is evidence that host genetic factors are involved in the development of liver fibrosis, the common variants identified so far, in particular by genome-wide association studies, were found to have limited effects. Here, we conducted an exome association study in 88 highly selected HCV-infected patients with and without fibrosis. A strategy focusing on TGF-β pathway genes revealed an enrichment in rare variants of the endoglin gene (ENG) in fibrosis patients. Replication studies in additional cohorts (617 patients) identified one specific ENG variant, Thr5Met, with an overall odds ratio for fibrosis development in carriers of 3.04 (1.39-6.69). Our results suggest that endoglin, a key player in TGF-β signaling, is involved in HCV-related liver fibrogenesis.

  Study phs001902

• eMERGE Genome-Wide Association Studies of Obesity

  The Geisinger eMERGE Genome-Wide Association Studies of Obesity Project is a genetic study of a cohort of primarily Caucasian patients with extreme obesity who have undergone bariatric surgery. Roux-en-Y gastric bypass (RYGB) surgery, in which intestinal anatomy is altered, dramatically ameliorates and/or eliminates Type 2 diabetes mellitus (T2D) in 50-80% of patients within hours to days following surgery, well before significant weight loss, in contrast to other types of bariatric surgeries, such as gastric banding, that attenuate insulin resistance as a result of substantial weight loss that occurs over months to years. The molecular mechanism by which RYGB exerts this clinical phenomenon occurs is not known. The goal of this project was to conduct a genome-wide association study (GWAS) to identify genetic variants associated with amelioration in T2D defined by medication independence. Identifying genetic variants that influence the dramatic resolution of T2D from RYGB may identify novel targets for pharmacological T2D therapies and/or identify patients in whom RYGB may not be effective.

  Study phs000408

• Hofer et al., A specific subpopulation of cancer-associated fibroblasts promotes resistance to chemotherapy in triple-negative breast cancer by upregulating G0S2 protein

  Chemotherapy is the standard of care for patients with triple-negative breast cancer (TNBC), but the mechanisms of chemoresistance remain poorly understood. Here, we investigated the role of cancer associated fibroblasts (CAFs) in the chemotherapy response of TNBC, by combining in vivo analyses of TNBC patients with ex vivo cancer modeling, using tumor-on-chip (ToC) technology. Transcriptomic analysis revealed that the proportion of a specific CAF population, the extracellular matrix-producing myofibroblasts (ECM-myCAFs), is reduced after chemotherapy in chemo-sensitive, but not in chemo-resistant TNBC patients. In ToC devices, primary ECM-myCAFs promoted TNBC cell survival under Doxorubicin and Paclitaxel treatment. The mechanism of chemoresistance was elucidated by using single-cell RNA sequencing, advanced cell imaging and functional assays: ECM-myCAFs upregulate the G0/G1 switch 2 (G0S2) protein in TNBC cells, via activation of SRC family kinases. Altogether, our work identifies G0S2 as a new player in CAF mediated chemotherapy resistance in TNBC.

  Study EGAS50000000886

• Clonal hematopoiesis is associated with adverse outcomes in patients with COVID-19

  Clonal hematopoiesis of indeterminate potential (CHIP) is defined as the occurrence of an expanded proportion of mature blood cells derived from a mutant hematopoietic precursor without evidence of hematological malignancies. The principle behind this is that the somatic mutation confers a fitness advantage to the cell in which it arose. Different clinical consequences are linked with this expansion. Early evidence of an association with higher mortality risk was provided. This was not related to higher rates of cancer but was associated in particular with increased cardiovascular mortality. Mechanistically, inflammatory processes are not only related to the development of clonal hematopoiesis, but in turn it is also a driver of inflammation. Besides pulmonary symptoms, COVID-19 evokes complex extra-pulmonary manifestations driving the pathophysiology. Among them, both inflammatory and cardiac-associated mechanisms have been deciphered. With the aim of assessing the impact of clonal hematopoiesis on the pathophysiology of COVID-19, hospitalized patients with severe or critical course were evaluated for the presence of CHIP driver mutations and, more importantly, the association with the clinical picture.

  Study EGAS00001006218

• Recursive splicing in long vertebrate genes

  Recent studies have shown that expression of many genes with exceptionally long introns in the mammalian brain can be perturbed by regulatory factors linked to neurodevelopmental or neurodegenerative disorders1-3, suggesting unique regulatory mechanisms. Here we identify functional recursive splice sites (RSS) in long introns of genes expressed in the brain. These RSS are highly conserved in genes with extreme length across diverse vertebrate species and permit step-wise removal of long introns via recursive splicing. Recursive splicing requires initial definition of a “recursive exon” that is located downstream of RSS, and most often contains premature stop codons. Moreover, we show that RSS create a splicing switch driven by splice site competition in order to distinguish primary mRNA isoforms from alternative isoforms that are prevalent in long genes. The recursive exon is not detectable in the dominant mRNA isoform due to recursive splicing, but is completely included when cryptic promoters or other cryptic exons are used. Thus, by coupling inclusion of recursive exons with the use of cryptic elements, RSS act to distinguish new mRNA isoforms emerging from long genes.

  Study EGAS00001001170

• BLUEPRINT DNA methylation profiles of graft donors in allogenic hematopoietic stem cell transplantation

  Allogenic hematopoietic stem cell transplantation (HSCT) is a curative treatment for many hematological conditions. Acute graft-versus-host disease (aGVHD) is a prevalent immune-mediated complication following HSCT. Current diagnostic biomarkers that correlate with aGVHD severity, progression, and therapy response in graft recipients are insufficient. We investigated whether epigenetic marks measured in peripheral blood of healthy graft donors stratify aGVHD severity in HLA-matched sibling recipients prior to HSCT. We measured genome-wide DNA methylation levels in peripheral blood of 91 HSCT donors using Illumina Infinium HumanMethylation450 BeadChips. We showed that epigenetic signatures underlying aGVHD severity in recipients correspond to immune pathways relevant to aGVHD etiology. We identified distinct DNA methylation marks in graft donors that are associated with aGVHD severity status in recipients. Together, our findings suggest that ‘epigenetic matching’ of HSCT donor-recipient pairs in a clinical setting may be used in conjunction with genetic matching to inform both donor selection and transplantation strategy, with the ultimate aim of improving patient outcome.

  Study EGAS00001001287

• CD8-targeted IL-2 unleashes tumor-specific immunity in human cancer tissue by reviving the dysfunctional T cell pool

  Tumor-specific CD8+ T cells are key effectors of antitumor immunity but are often rendered dysfunctional in the tumor microenvironment. Immune checkpoint blockade can restore antitumor T cell function in some patients, however most do not respond to this therapy, often despite T cell infiltration in their tumors. We here explored a CD8-targeted IL-2 fusion molecule (CD8-IL2) to selectively reactivate intratumoral CD8+ T cells in patient-derived tumor fragments. Treatment with CD8-IL2 broadly armed intratumoral CD8+ T cells with enhanced effector capacity, thereby specifically enabling reinvigoration of the dysfunctional T cell pool to elicit potent immune activity. Notably, the revival of dysfunctional T cells to mediate effector activity by CD8-IL2 depended on simultaneous antigen recognition and was quantitatively and qualitatively superior to that achieved by PD-1 blockade. Finally, CD8-IL2 was able to functionally reinvigorate T cells in tumors resistant to anti-PD-1, underscoring its potential as a novel treatment strategy for cancer patients.

  Study EGAS00001007712

• An essential role for MYB in driving oncogenic EVI1 expression in enhancer-rearranged leukemias

  In acute myeloid leukemia (AML) with inv(3)(q21;q26) or t(3;3)(q21;q26), a translocated GATA2 enhancer drives oncogenic expression of EVI1. We generated an EVI1-GFP AML model and applied an unbiased CRISPR/Cas9 enhancer scan to uncover sequence motifs essential for EVI1 transcription. Using this approach, we pinpoint a single regulatory element in the translocated GATA2 enhancer that is critically required for aberrant EVI1 expression while being dispensable for GATA2 expression from its endogenous locus. This element contains a DNA binding motif for the transcription factor MYB that heavily occupies this site specifically at the translocated allele. MYB knockout as well as peptidomimetic blockade of p300-dependent MYB function resulted in downregulation of EVI1 but not of GATA2. Targeting MYB or mutating its DNA-binding motif within the GATA2 enhancer resulted in myeloid differentiation and cell death, suggesting that interference with MYB-driven EVI1 transcription provides a potential entry point for therapy of inv(3)/t(3;3) AMLs.

  Study EGAS00001004839

• Intratumoral plasma cells predict outcomes to PD-L1 blockade in non-small cell lung cancer

  Inhibitors of the programmed cell death-1 (PD-1/PD-L1) signaling axis are approved to treat non-small cell lung cancer (NSCLC) patients, based on their significant overall survival (OS) benefit. Using transcriptomic analysis of 891 NSCLC tumors from patients treated with either the PD-L1 inhibitor atezolizumab or chemotherapy from two large randomized clinical trials, we found a significant B cell association with extended OS with PD-L1 blockade, independent of CD8+ T cell signals. We then derived gene signatures corresponding to the dominant B cell subsets present in NSCLC from single-cell RNA-seq data. Importantly, we found increased plasma cell signatures to be predictive of OS in patients treated with atezolizumab, but not chemotherapy. B cells were also associated with the presence of tertiary lymphoid structures and organized lymphoid aggregates. Our results suggest an important contribution of B and plasma cells to PD-L1 blockade efficacy in NSCLC.

  Study EGAS00001005013

• An instructive role for IL7RA in the development of human B-cell precursor leukemia

  Kinase signaling fuels growth of B-cell precursor acute lymphoblastic leukemia (BCP-ALL). Yet its role in leukemia initiation is unclear and has not been shown in primary human hematopoietic cells. We previously described activating mutations in interleukin-7 receptor alpha (IL7RA) in poor-prognosis “ph-like” BCP-ALL. Here we show that expression of activated mutant IL7RA in human CD34+ hematopoietic cells creates a preleukemic state in transplanted NOD/LtSz-scid IL2Rγnull mice, characterized by persistence of self-renewing Pro-B cells with non-productive V(D)J gene rearrangements. Preleukemic CD34+CD10highCD19+ cells evolved to a BCP-ALL with spontaneously acquired CDKN2A deletions as commonly observed in primary human BCP-ALL. CRISPR mediated silencing of CDKN2A in primary human CD34+ cells transduced with activated IL7RA resulted in robust development of BCP-ALLs in-vivo. Thus, we demonstrate for the first time that constitutive activation of IL7RA can initiate preleukemia in primary human hematopoietic progenitors and cooperates with CDKN2A silencing in progression into BCP-ALL.

  Study EGAS00001005347

• RNA-seq of M-CSF differentiated human peripheral monocyte-derived macrophages (MDMs) - Validation macIDR

  Macrophages represent multifunctional leukocytes defined by their stimulus-specific transcriptional reprogramming. As in vivo macrophages are often difficult to obtain, in vitro macrophage models are often used. We aggregated public expression data to define consensus expression profiles for eight commonly-used in vitro macrophage models and built the classifier macIDR, capable of distinguishing macrophage subsets with high accuracy (>0.95). Classification of in vivo macrophages suggested that alveolar macrophages resembled interleukin-10 activated macrophages in general whereas chronic obstructive pulmonary disease patients displayed decreased similarity to interferon-γ stimulated macrophages. Adipose tissue-derived macrophages were classified as unstimulated macrophages, but would resemble LPS-stimulated macrophages more in diabetic-obese patients. Rheumatoid arthritic synovial macrophages were similar to macrophages stimulated with interleukin-10 or interferon-γ. Altogether, our results suggest that macIDR is capable of identifying in vitro macrophages. By projecting in vivo macrophages onto the in vitro macrophages, we were capable of elucidating macrophage-specific changes as a result of tissue and disease.

  Study EGAS00001003451

• Understanding_Self__Organising_Capacity_of_Stem_Cells_during_Implantation_and_Early_Post_implantation_Development_in_vitro_and_in_vivo__Implications_for_Human_Development_

  The aim of this project is to differentiate human embryonic stem cells to an extra-embryonic fate, specifically the hypoblast. This is of uttermost importance given the current lack of human hypoblast stem cells. We hypothesized that the pluripotent characteristics of the starting human embryonic stem cell population may dictate the competency for extra-embryonic cell fate specification. Based on this hypothesis and using human embryonic stem cells maintained in different naïve-like culture regimes, we have now developed conditions that allow the differentiation of human embryonic stem cells to a stable GATA6+ SOX2- population. This suggests that these cells may be putative human hypoblast stem cells. To validate this finding here we propose to perform RNA sequencing experiments of the differentiated human embryonic stem cells. By comparing their RNA expression profile to the single cell sequencing data of the human embryo that we are currently generating, we will be able to determine the identity of our GATA6+ SOX2- cells, and establish whether they represent the in vivo human hypoblast.

  Study EGAS00001003571

• Multidimensional and Longitudinal Immune Profiling of Sepsis in Uganda

  We conducted a prospective, observational cohort study of adults (RESERVE-U-2-TOR) admitted to Tororo General Hospital in eastern Uganda with severe, undifferentiated infection (i.e., suspected sepsis). Briefly, whole-blood samples were collected in PAXgene blood RNA tubes (PreAnalytiX, Qiagen, Germantown, MD, USA), from which RNA was extracted using PAXgene Blood RNA Kits (cat. no. 762164) (Qiagen). Sequencing libraries were constructed with the NEBNext Ultra II RNA Library Preparation Kit for Illumina, after which libraries were multiplexed and sequenced on the Illumina NovaSeq X Plus platform (Illumina, Inc, San Diego, CA). Data from this study available through dbGaP include raw RNA-Seq data generated from whole-blood samples collected upon RESERVE-U-2-TOR study enrollment (N=274).

  Study phs003914

• Molecular profiling of tissue autopsies and ctDNA

  The dataset contains high-throughput sequencing data derived from a cancer autopsy series of 10 patients. As part of this study, whole-exome sequencing and RNA-seq were performed for spatially distinct tissue biopsies from the patients. In addition, plasma samples from the patients were sequenced using a custom panelt to profile ctDNA. There are 106 files containing whole-exome sequencing data, 107 files containing RNA-seq data, and 9 files containing plasma sequencing data.

  Dataset EGAD00001007040

• RNA-seq data

  RNAseq FASTq files of 181 bulk pre-treatment and 14 post-treatment tumors from GO30140 Ph1b group A and F and 177 bulk pre-treatment tumors of IMbrave150 PhIII

  Dataset EGAD00001008128

• Targeting PTPRK-RSPO3 colon tumours promotesdifferentiation and loss of stem-cell function

  Colorectal cancer remains a major unmet medical need, promptinglarge-scale genomics efforts in the field to identify moleculardrivers for which targeted therapies might be developed. Wepreviously reported the identification of recurrent translocationsin R-spondin proteins present in a subset of colorectal tumours.Here we show that targeting RSPO3 in PTPRK-RSPO3-fusion positivehuman tumour xenografts inhibits tumour growth andpromotes differentiation. Notably, genes expressed in the stem-cellcompartment of the intestine were among those most sensitive toanti-RSPO3 treatment. This observation, combined with functionalassays, suggests that a stem-cell compartment drives PTPRK-RSPO3colorectal tumour growth and indicates that the therapeutictargeting of stem-cell properties within tumours may be a clinicallyrelevant approach for the treatment of colorectal tumors.

  Study EGAS00001001462

• Sequencing data for oesophageal and related samples - Normals release 3 (RNA)

  Dataset EGAD00001003902

• Sequencing data for oesophageal and related samples - Normals release 5 (RNA)

  Dataset EGAD00001005384

• Sequencing data for oesophageal and related samples - Normals release 2 (RNA)

  Dataset EGAD00001003838

• Sequencing data for oesophageal and related samples - Normals release 4 (RNA)

  Dataset EGAD00001004022

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Identification of biomarkers for prediction of efficacy of microtubule inhibitors and antifolates in non-small cell lung cancer

  Identification of predictive markers based on transcriptome modules for microtubule inhibitors of lung adenocarcinoma patients

  Study JGAS000267

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• RNA sequencing of AML with 3q26 rearrangements

  RNA sequencing of 44 AML cases with diverse 3q26 rearrangements. This dataset is complementary to EGAD00001000726 (which only contains t(3;3)/inv(3)) and to EGAD00001006123.

  Dataset EGAD00001015629

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• MDA whole exome sequencing data for bladder cancer

  46 BAM files from 23 urothelial bladder cancer patients on an immunotherapy clinical trial. PBMC normal samples and solid tumor samples are paired. Alignment was done by BWA with reference genome hg19.

  Dataset EGAD00001005712

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• scATAC sequence runs of 29 samples of RRMM (multiple myeloma) tumors

  scATAC sequencing was performed of 29 samples of RRMM tumors using 10xGenomics for the preparation and NovaSeq6000 for sequencing.

  Dataset EGAD00001009683

• Dataset for Transcriptomic sequencing data for neuroblastoma tumor samples

  Dataset Transcriptomic sequencing data of 42 neuroblastoma tumor samples. The sequencing was performed on Illumina HiSeq 2000 and Illumina HiSeq 4000. The sequencing was always paired.

  Dataset EGAD00001015812

• ADAPTeR Study: scRNA/TCRseq data from ccRCC patients

  ADAPTeR study scRNA and scTCR data from TILs from two ccRCC patients treated with nivolumab

  Dataset EGAD00001008166

• Whole-exome sequencing (WES) data of papillary thyroid cancer and adjacent normal tissues

  High-coverage WES sequencing of DNA samples from 50 PTCs was performed on the Illumina HiSeq 2500 or 4000 System

  Dataset EGAD00001003262

• miR-17-92 organoids

  Organoid cultures derived from colorectal adenomas were transduced with a miR-17-92 expressing vector. RNA from miR17-92-overexpressing organoids and respective non-transduced organoids (controls) was isolated for expression analysis.

  Dataset EGAD00001008480

• POPLAR clinical data

  Relevant clinical data for POPLAR including treatment arm, histology, overall survival, progression-free survival, and best confirmed overall response.

  Dataset EGAD00001008548

• High-resolution analysis for urinary DNA jagged ends

  consists 17 cases, 7 control cases and 10 cancer cases.

  Dataset EGAD00001008594

• OAK clinical data

  Relevant clinical data for OAK including treatment arm, histology, overall survival, progression-free survival, and best confirmed overall response.

  Dataset EGAD00001008549

• High-resolution lung adenocarcinoma expression subtypes

  High-resolution lung adenocarcinoma expression subtypes identify tumors with dependencies on MET, CDK4, CDK6, and PD-L1

  Dataset EGAD00001009339

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• WGS, RNA-seq and methyl-seq data for multiple tumour clones from a single glioblastoma case.

  10 bams of WGS data from HiSeqXTen platform; 10 bams of RNA-seq data from HiSeq2500 platform; 7 bams of TruSeq Methyl Capture EPIC sequencing data from HiSeq4000 platform

  Dataset EGAD00001004773

• Isala Cross sectional Flow Meta Data

  This meta data contains extensive meta data from the cross sectional flow of the Isala Citizen Science project. The meta data file contains ENA Accession numbers for 16S Microbiome data, and cleaned responses to questionnaires.

  Dataset EGAD00001009890

• Single-cell transcriptome of T-ALL PDX under drug treatment

  PDX model of T-ALL under treatment of CB-103 and Vehicle was analyzed by single-cell transcriptomics using 10X Genomics technology.

  Dataset EGAD00001009172

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• The Extracellular RNA Quality Control (exRNAQC) study (phase 2)

  mRNA capture sequencing and small RNA sequencing data (FASTQ files) of the exRNAQC study phase 2 (interaction study)

  Dataset EGAD00001009724

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• Strand-specific RNA sequencing of 16 pairs of primary and relapsed IDH-wt glioblastomas

  This dataset contains strand-specific RNA sequencing data from 16 primary/relapsed sample pairs of IDH-wt glioblastomas

  Dataset EGAD00001004564

• Chondromyxoid fibroma

  Chondromxoid fibroma is a benign tumour of bone with unknown underlying pathogenesis. To determine pathognomic genomic event in chondromyxoid fibroma whole genome sequencing will be undertaken to reconstruct rearrangements and find underlying mutations.

  Dataset EGAD00001001063

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Neuroblastoma WGS dataset

  Dataset with whole-genome sequencing tumor and normal samples from 14 neuroblastoma patients.

  Dataset EGAD00001010030

• Sequencing data for the manuscript "Early on-treatment changes in circulating tumor DNA fraction and response to enzalutamide or abiraterone in metastatic castration-resistant prostate cancer"

  This submission contains gzipped fastq files from paired-end targeted sequencing.

  Dataset EGAD00001010105

• Human serum small non-coding RNA sequencing

  Human small non-coding RNA sequencing of serum from sons of PCOS mothers (n=9) and sons of control mothers (n=9), see publication for details.

  Dataset EGAD00001010165

• Single-cell colony targeted DNAseq

  Targeted DNA sequencing was applied to colonies grown from single-cells of patient A.6. The protocol followed is described in https://doi.org/10.1038/s41467-021-21650-1 and the methods of the manuscript

  Dataset EGAD00001010193

• RNA-seq dataset of CD34+ HSPCs from LRMDS patients

  To profile transcriptional alterations of HSPCs in LR-MDS patients, 7AAD−CD45+Lin-CD235a−CD34+ cells were isolated from healthy donors and LR-MDS patients for RNA sequencing.

  Dataset EGAD00001015771

• Validation for human early embryonic substitutions (2017-05-11)

  PCR and MiSeq validation for early embryonic substitution candidates from 400 Breast cancer patients This dataset contains all the data available for this study on 2017-05-11.

  Dataset EGAD00001003332

• Multi-omics Profiling of Asian Breast Cancers

  186 tumor/normal matched samples from whole exome sequecing and 178 samples (168 tumors, 10 normals) from whole transcriptome sequencing

  Dataset EGAD00001003776

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Ewings Sarcoma RNA-seq drug sensitivity

  Illumina RNA-Seq will be performed on four Ewing's sarcoma cell lines and two control cell lines. RNA was extracted from all the lines using a basic Trizol extraction protocol.

  Dataset EGAD00001000337

• Exome sequencing of Congenital Heart Disease families Toronto

  The exome sequencing is performed using Agilent SureSelect 50Mb exome v3 and Hiseq 75bp paired reads with an mean sequencing coverage target of 50X.

  Dataset EGAD00001000799

• BRIDGE Bleeding and Platelet Disorders

  Whole exome sequencing BAM files for samples from the BRIDGE Consortium with pathogenic or likely pathogenic variants on genes linked to bleeding or platelet disorders.

  Dataset EGAD00001001333

• BLUEPRINT Gene expression profiles of human hematopoietic progenitors

  Gene expression was analyzed for stem/progenitor cell types and terminally differentiated cell types of the human blood lineage (HSC, MPP, CMP, GMP, CLP, MLP0, MLP1, MLP2, MLP3).

  Dataset EGAD00001002733

• Human Developmental Cell Atlas_HDCA - WGS (2019-04-11)

  Single cell + bulk genomics study for immune and hematopoietic organs during human fetal development . This dataset contains all the data available for this study on 2019-04-11.

  Dataset EGAD00001004953

• WGS datasets of pediatric glioblastoma

  WGS with linked reads of pediatric glioblastoma. For each patient, blood and tumor tissue were sequenced. For two patients, we also provide sequencing data for the blood of their parents.

  Dataset EGAD00001005212

• Wilms Tumour organoid sequencing WGS (2019-09-05)

  This study investigates the genomic and transcriptomic characteristics of Wilm's tumour organoids . This dataset contains all the data available for this study on 2019-09-05.

  Dataset EGAD00001005312

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• sWGS for genome-wide copy number profiling

  Shallow whole-genome sequencing (sWGS) data for the identification of somatic copy number alterations (SCNA) and the estimation of tumor fractions in plasma DNA of metastatic colorectal cancer patients (mCRC).

  Dataset EGAD00001006384

• Tumor Whole-exome sequencing

  20 tumor tissue WES data with paired cfDNA sWGS data. This data is used for concordance analysis between cfDNA-based and tissue-based CNA. The WES libraries were sequenced across 3 independent runs using multiple lanes.

  Dataset EGAD50000001864

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121