16624 results for "sec+and+unspecified+malignant+neoplasm"

in 35.35 milliseconds.

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792

• Genetic factors underlying premature MI in Greek families without vessel disease

  The study will analyse by exome sequencing 8 Greek family members with an excess of potentially damaging mutations relating to premature MI and no vessel disease, to identify genetic factors underlying this condition. This is a follow on from project GPMI-NVD

  Dataset EGAD00001002178

• MDS primary and xenografted samples

  This dataset contains bam files mapped to hg19 that either were primary bone marrow cells or sorted human cells after long term engraftment in NSG mice.

  Dataset EGAD00001007760

• Somatic mutations of 256 whole-genome sequenced colorectal cancer tumors.

  Somatic mutations of 256 whole-genome sequenced colorectal tumors. 234 MSS, 19 MSI and 3 POLE mutants. See Katainen R. et al. CTCF/cohesin-binding sites are frequently mutated in cancer, Nature Genetics 2015. doi:10.1038/ng.3335

  Dataset EGAD00001004329

• Long-read sequencing for cell-free DNA analysis (human)

  31 pregnant women at different trimesters, 6 hepatitis B carriers, and 8 patients with hepatocellular carcinoma

  Dataset EGAD00001008980

• Whole Transcriptome Sequencing

  RNA-seq data of 15 snap-frozen tissue of peritoneal mesothelioma. The strand specific RNA library prepared using TruSeq (Illumina) and pair-end sequencing performed in Illumina HiSeq 4000. The datasets contains paired fastq files for each of 15 tumor samples.

  Dataset EGAD00001004504

• Gene expression profile of mesothelial cells from peritoneal adhesion biopsies

  RNA-sequencing analysis was carried out on mesothelial cells isolated from peritoneal adhesion biopsies and compared to control human peritoneal mesothelial cells to identify a mesothelial-to-mesenchymal transition (MMT)-related gene signature in patients.

  Dataset EGAD00001008324

• Whole exome sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region WES from 4 NSCLC patients, totaling 12 tumor samples and 4 matched control samples. The files were submitted as bam files.

  Dataset EGAD00001008382

• TRACERx pilot study, phase 2

  Multi-region Illumina whole-exome and/or whole-genome sequencing on tumor regions collected from early-stage NSCLC patients who underwent definitive surgical resection prior to receiving adjuvant therapy.Patients covered by this dataset: L012, L013, L015, L017

  Dataset EGAD00001001918

• Whole genome sequencing of RIKEN liver cancers

  RIKEN collection of WGS reads of 530 liver cancer and matched blood samples from 260 donors.

  Dataset EGAD00001001642

• Deep-Seq: Resistance to anti-EGFR therapy in colorectal cancer

  In this study we performed ultra deep sequencing of genes associated with anti-EGFR resistance, such as KRAS, BRAF, PIK3CA, and EGFR in 17 plasma-DNA samples from a total of 10 patients treated with anti-EGFR therapy.

  Dataset EGAD00001000688

• 2017_ AML WGS analysis result

  This data is belong to 2017 AML genome data which is aligned to human reference(human_g1k_v37.fasta). There are 10 paired tumor/normal samples from SNUH. All samples has passed QC and recalibration steps while aligning to reference.

  Dataset EGAD00001003599

• NKI-AvL OpACIN DNA-seq of stage III melanoma patients

  The dataset “NKI-AvL OpACIN DNA-seq of stage III melanoma patients" includes 2 x 18 normal and 2 x 18 tumor FASTQ files from paired-end whole exome sequencing on Illumina HiSeq2500 for 18 stage III melanoma patients.

  Dataset EGAD00001004217

• ICGC-LIRI-JP Release 15

  RIKEN collection WGS reads for 321 HCC and blood matched samples from 158 donors submitted to ICGC for release 15

  Dataset EGAD00001000808

• Metastatic breast cancer targeted gene screen (2014-09-24)

  The samples will be sequenced for a targeted panel of cancer relevant genes (n ~ 370) and analysed for somatic mutations. This dataset contains all the data available for this study on 2014-09-24

  Dataset EGAD00001001018

• IBDCA_Edinburgh

  In this experiment we have sequenced tumour normal pairs from patients presenting with CRC who have a prior history of inflammatory bowel disease. The idea is to identify driver mutations, new genes and novel pathways associated with the development of these malignancies.

  Dataset EGAD00001001330

• WGS on patients 5-7, study of metastatic prostate cancer

  Data from the study of subclonal metastatic expansion in prostate cancer. Whole genome shotgun sequencing of six samples, tumour and whole blood, from the three additional patients whose somatic variants were examined in depth.

  Dataset EGAD00001001344

• Metastatic Breast Cancer Whole Genome

  We propose to definitively characterise the somatic genetics of Metastatic breast cancer through generation of comprehensive catalogues of somatic mutations in Metastatic breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000899

• Gut microbiome of BA patients and normal controls

  Metagenomic sequencing data of human gut microbiome

  Dataset EGAD00001007735

• Metastatic breast cancer targeted gene screen (2017-05-11)

  The samples will be sequenced for a targeted panel of cancer relevant genes (n ~ 370) and analysed for somatic mutations. This dataset contains all the data available for this study on 2017-05-11.

  Dataset EGAD00001003330

• Genomic Landscape of Chordoid Glioma

  This data set consist genomic information of 10 Chordoid Glioma samples: - Exome sequencing: 10 tumors and matched normal DNA for four of them (BAM files) - RNAseq : 10 tumors (fastq files) - CNV array: 9 tumors (IDAT files)

  Dataset EGAD00001004112

• Transposome Bisulfite Sequencing

  DNA belonging to 16 tumour/normal samples were treated with bisulfite, then up to 5 different bisulfite PCRs were performed in each one of the samples. Amplicons form the same sample were pooled and submitted to sequencing on a MiSeq platform.

  Dataset EGAD00001001028

• Genomic alteration in Korean Young Age Diffuse Gastric Cancers

  To identify recurrent somatic alterations in this unique subset of gastric cancers, whole exome and SNP6 analyses were performed using frozen cancer tissue. The somatic mutation analyses were also performed using blood of the same patients.

  Dataset EGAD00001001984

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• BLUEPRINT DNA methylation profiles of human hematopoietic progenitors

  DNA methylation was analyzed for stem/progenitor cell types and terminally differentiated cell types of the human blood lineage (HSC, MPP, CMP, MEP, GMP, CLP, MLP0, MLP1, MLP2, MLP3, MK, CD4+ Tcell, CD8+ Tcell, Bcell, NK, Neut, Mono).

  Dataset EGAD00001002732

• Exome sequencing of 7-member healthy family (father, mother, their three biological daughters and monozygotic twin sons)

  The dataset contains exome sequencing data of seven healthy family members, all in FASTQ format. The samples were taken from peripheral blood mononuclear cells. Furthermore, corresponding proteomics data are available as well.

  Dataset EGAD00001004949

• EGAS00001003405 combined RNA, WES, WGS data of 16 gastrointestinal tumor patients

  50 samples of 16 individuals with Gastrointestinal Tumor. Patients were sequenced in various combinations of WGS, Exome and RNA sequencing.

  Dataset EGAD00001005113

• Targeted deep sequencing

  T200 caner panel sequencing on primary and metastatic sites from highly clinically annotated HGSC samples. Samples were obtained pre-treatment based on a laparoscopic triage algorithm from patients who underwent R0 tumor debulking, or received neoadjuvant chemotherapy (NACT) with excellent (ER) or poor response (PR).

  Dataset EGAD00001005239

• GRAIL Metadata

  Metadata summarizes participants (n=198), samples (n=396), basic clinical information, and analysis. analysis1: raw sequencing reference alignment files (bam/bai) analysis2: error-corrected sequencing reference alignment files (bam/bai) analysis3: variant calling using error-corrected sequencing reference alignment (vcf)

  Dataset EGAD00001005302

• Prognostic markers of DNA methylation and NGS sequencing in progressive glioblastoma from the EORTC-26101 trial

  These dataset contains NGS data from 380 samples from the EORTC-26101 clinical trial for patients with progressive glioblastoma.

  Study EGAS00001007421

• WES FASTqs

  Whole exome sequencing FASTq files from 469 pre-treatment tumors from IMvigor210, POPLAR and IMmotion150, with matched PBMC samples.

  Dataset EGAD00001006632

• Hyperpolarized carbon-13 MRI for very early response assessment of neoadjuvant chemotherapy in breast cancer patients

  Transcriptomic data for five patients with breast cancer undergoing neoadjuvant chemotherapy and hyperpolarised 13C-MRI for early response assessment

  Dataset EGAD00001008141

• TCRab sequencing of T-LGLL patients

  TCRab sequencing was performed on viably frozen cells from 11 T-LGLL samples from 9 T-LGLL patients and 6 age-matched healthy samples. The raw data is available as fastq files.

  Dataset EGAD00001008691

• RNA Dataset

  The RNA dataset includes 5 samples analyzed with the Oncomine Comprehensive Assay (OCA) panel. After library preparation, sequencing was performed on the Ion Torrent S5 System, generating FASTQ files. The analysis captures gene fusions and splice variants relevant to oncogenic processes. (idem)

  Dataset EGAD50000002502

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• mFAST-SeqS

  mFAST‑SeqS, or modified Fast Aneuploidy Screening Test‑Sequencing System, is a streamlined and cost-effective approach to estimate the fraction of ctDNA in blood samples by detecting genome-wide aneuploidy in cfDNA

  Dataset EGAD50000001670

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• This dataset contains the cram files from the whole Exome sequencing

  Exome Sequencing of Healthy and M. Heamophilum Infected Participants

  Dataset EGAD50000001565

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934