17871 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 24.53 milliseconds.

• SIGi001-A-7 / SAMEA4448730 WGS data

  The iPSC line SIGi001-A-7 / SAMEA4448730 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-7 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001060

• Paired-end Whole Exome-seq analysis of multi-centric lower grade glioma

  This dataset includes Nimblegen SeqCap EZ Exome v3 data for each lesion of three patients with multicentric glioma. For two patients, each lesion was sequenced along with whole blood. For a third patient, 3 pieces from the right lesion and 4 pieces from the left were sequenced along with whole blood. In each case BAM files that have been aligned with BWA mem alignment are available.

  Dataset EGAD00001003795

• Paired-WGS-two-families-with-GBA-variants-and-Parkinsons-disease

  We performed whole- genome sequencing, rare variant filtering, segregation analysis and functional validation of PD cosegregating rare genetic variation in two families (6 samples) segregating PD associated GBA variants c.115+1G>A (ClinVar ID: 93445, ) and p.L444P (ClinVar ID: 4288) respectively. The paired WGS sequencing was run on HiSeq X Ten and the library preparation kit was Illumina TruSeq DNA nano.

  Dataset EGAD00001006561

• 10X 3' V2 data of single immune cells in hepatocellular carcinoma

  The immune microenvironment of hepatocellular carcinoma (HCC) is poorly characterized. Combining two single-cell RNA sequencing technologies, we produced transcriptomes of CD45+ immune cells for HCC patients from five immune-relevant sites: tumor, adjacent liver, hepatic lymph node (LN), blood, and ascites. This is the droplet data of this study

  Dataset EGAD00001005961

• Exome sequencing of lung tissue conducted in SMC

  The data includes exome sequencing FASTQ files of 335 patients receiving immune checkpoint blockade therapy. The data only provides for WXS of tumor tissue.

  Dataset EGAD00001009101

• Epigenomic analysis of human dopaminergic neuron differentiation reveals LBX1, NHLH1 and NR2F1/2 as necessary for lineage specification

  Sample information: The 56 samples produced in this project come from the human iPSC line GM17602 (Coriell) where a tyrosine hydroxylase-T2A-mCherry reporter was inserted. A combination of epigenetic analysis (ATAC/ChIP) along transcriptomics.

  Dataset EGAD00001009288

• Intra-prostatic tumour evolution, steps in metastatic spread and histogenomic associations revealed by integration of multi-region whole genome sequencing with histopathological features

  We performed whole genome sequencing on 42 prostate cancer samples from the prostate, seminal vesicles and regional lymph nodes of five treatment-naive patients with locally advanced disease who underwent radical prostatectomy. Whole genome sequencing was performed as 150bp paired end reads on the Illumina NovaSeq 6000 platform.

  Dataset EGAD00001011174

• WXS Normal Samples Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011321

• Swarm Learning to identify COVID-19, tuberculosis and leukemia patients based on blood transcriptomes

  Identification of patients with life-threatening diseases including leukemias or infections such as tuberculosis or COVID-19 is an important goal of modern precision medicine. However, there is an increasing divide between what is technically possible and what is allowed because of privacy legislation. We have recently illustrated that classical machine learning can identify leukemia patients based on their blood transcriptomes. To facilitate integration of any omics data from any data owner world-wide without violating privacy laws, we here introduce Swarm Learning (SL), a decentralized machine learning approach uniting edge computing, artificial intelligence (AI), blockchain and privacy protection without the need for a central coordinator thereby going beyond federated learning. To illustrate its feasibility, using more than 12,000 transcriptomes from peripheral blood mononuclear cells and more than 2,000 peripheral blood transcriptomes we demonstrate that SL of omics data distributed across different individual sites leads to disease classifiers that outperform those developed at individual sites. Yet, SL completely protects local privacy regulations by design. We propose this approach to noticeably accelerate the introduction of precision medicine.

  Dataset EGAD00001006231

• WGBS Discovery Samples

  The dataset contains valuable genomic data from a discovery cohort consisting of 29 individuals. This cohort is comprised of 8 healthy individuals (control), 8 patients with ST-segment elevation myocardial infarction (STEMI), 7 patients with non-ST-segment elevation myocardial infarction (NSTEMI), and 6 patients with unstable angina (UA). The genomic data was obtained by isolating cell-free circulating DNA (ccfDNA) and subjecting it to bisulfite conversion using a low-input BS-seq (PBAT) protocol. Sequencing was done on the Novaseq 6000 platform.

  Dataset EGAD00001010935

• Liverpool Preterm Birth Biomarker Study

  Preterm birth is a multifactorial condition defined as birth less than 37 weeks of gestation. This study aimed to identify early pregnancy biomarkers from maternal genome-wide and transcriptome-wide data of women experiencing two types of spontaneous PTB (sPTB): spontaneous preterm birth (SPTB) and preterm premature rupture of membranes (PPROM). Whole blood samples were obtained from women with singleton pregnancies (N=567) recruited at the Liverpool Women’s Hospital at 16 and 20 weeks of gestation. Women with a previous history of sPTB pregnancies <34 weeks were categorised on their index pregnancy outcome as spontaneous preterm birth (SPTB) and preterm premature rupture of membranes (PPROM) or high-risk term control (HTERM, ≥37 weeks). Women with no history of SPTB/PPROM and delivered at term were LTERM (≥39 weeks of gestation). DNA was genotyped on the UK Biobank Axiom™ array (Applied Biosystems™, Thermo Fisher Scientific) and RNA who processed using the Clariom™ D Human assay (Thermo Fisher Scientific). Genome-wide association analysis, differential expression analysis and expression quantitative trait loci (eQTL) were completed.

  Study EGAS00001005076

• Dataset for GIST-RNA

  Rare cancer sequencing data of 50 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008852

• Dataset for neuroendocrine_adrenal_tumor-EXON

  Rare cancer sequencing data of 164 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008891

• Dataset for other_cancer-EXON

  Rare cancer sequencing data of 137 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008896

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Epilepsy related sudden death (2019-08-21)

  These samples include exome sequences of samples from patients who suffered Sudden Unexplained Death in Epilepsy. They all are of European descent. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005276

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• Exploring the extracellular transcriptome in seminal plasma for non-invasive prostate cancer diagnosis

  mRNA capture sequencing data of 57 seminal plasma samples.

  Dataset EGAD00001007688

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026