12405 results for ""non-traditional+communal+storytelling+approach"+novel+segment+noted+in+critical+commentary"

in 24.92 milliseconds.

• WTCCC3_Anorexia_Nervosa

  As part of the Genetic Consortium for Anorexia Nervosa (GCAN) and Wellcome Trust CaseControl Consortium 3 (WTCCC3), we have amassed the largest anorexia nervosa (AN)sample in the world (~4,000). Following the WTCCC3 GWAS, we secured funding from theKlarman Family Foundation to extend the genetic analyses to variants on the exome chip(CoreExome array). This pre-lim relates to carrying out genotyping on the CoreExome arrayon up to a maximum of 580 new samples.

  Study EGAS00001000913

• APCDR AGV Project: Whole genome sequencing of 3 African populations (curated data)

  The African Genome Variation Project (AGVP) provides a resource to help design, implement and interpret genomic studies in sub-Saharan Africa (SSA) and worldwide. The AGVP represents dense genotypes from 1,481 and whole genome sequences (WGS) from 320 individuals across SSA. As part of the AGVP we sequenced 3 African populations; Baganda from Uganda (4x), Zulu from South Africa (4x), Gumuz, Wolayta, Oromo, Somali and Amhara from Ethiopia (8x).

  Study EGAS00001000960

• SOFT_study___sequencing_premenopausal_breast_cancer

  Our project will examine the role of PIK3CA mutations and their sensitivity to endocrine therapies and its role, with the addition of complete ovarian suppression. We plan to test our hypotheses using tumour samples collected from patients enrolled in the SOFT/IBCSG24-02 clinical study (Suppression of Ovarian Function Trial – (NCT00066690). SOFT is a phase III trial that randomised 3066 premenopausal women to evaluate if adding ovarian suppression to adjuvant endocrine therapy will improve clinical outcomes.

  Study EGAS00001000983

• Korean Young Age Diffuse Gastric Cancers

  The incidence of diffuse gastric cancers (DGC) remains steadily high, but relatively small numbers of DGCs have been evaluated with whole exome sequencing (WES). Clinicopathological features of DGC vary according to age, but the molecular basis for these variations is unclear. To identify genomic alteration in this unique subset of gastric cancers, whole exome and SNP6 analyses were performed using frozen cancer tissue. The same analyses were also performed using blood of the same patients.

  Study EGAS00001001711

• Exome sequencing of DNA from pituitary neuroendocrine tumor (PitNET) and germline DNA from the same patient

  The goal of the project is to study tumor - normal DNA pairs from the PitNET patients. Total of 15 PitNET patients were recruited for the study to investigate sometic changes in the tumor compared to normal tissue. Illumina technology were used for sequencing and two data analysis pipelines employed for data analysis. Recurrent somatic variations were investigated and genomic disruption analysis from exome sequencing data attempted.

  Study EGAS00001004654

• Whole genome sequencing of patients affected by acute intermittent porphyria

  Acute intermittent porphyria (AIP) is an hereditary rare metabolic disorder of incomplete penetrance, affecting the biosynthesis of heme. IAP is an autosomal dominant disorder, resulting in a substantial reduction of the activity of the hydroxymethylbilane synthase coding gene (HMBS). Most HMBS mutation carriers are asymptomatic and only between 10% and 20% of patients present acute attacks of the associated symptoms. Here, we sequenced whole genomes of 16 AIP patients.

  Study EGAS00001004999

• scRNA_seq_of_circulatory_immune_cells_from_Crohn_s_disease_patient_blood

  Whole blood from Crohn's disease patients with active inflammation in the terminal ileum was depleted of red blood cells and partially depleted of granulocytes before single cell sequencing using 10X genomics 3'v3 kit followed by Illumina sequencing (HS4000 and NovaSeq) This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001004150

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Genes___Health_imputed_genotype_dataset

  Genes & Health is a cohort of British Bangladeshi and British Pakistani individuals. In the Feb2020 data freeze, 28,022 individuals were genotyped on the Illumina Infinium Global Screening Array v3 chip (with the additional Multi-Disease variants). Imputation was performed using the Michigan Imputation Server with the GenomeAsia pilot reference panel, which contains 1,739 genomes and 642 from them are from South Asian groups. This dataset contains imputed SNPs with imputation accuracy >0.3 and MAF >0.1%.

  Study EGAS00001005373

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• BCR_repertoire_sequencing

  Isotype-specific B-cell receptor repertoire sequencing in six immune-mediated diseases at diagnosis and during therapy reveals an unexpectedly complex B-cell architecture, which may provide a platform for a better understanding of pathological mechanisms and treatment responses. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001003185

• Single-cell RNA sequencing of 6 follicular lymphoma tumors

  Follicular lymphoma (FL) is an indolent cancer of mature B-cells but carries increased risk of transformation to a more aggressive histology over time. We present here comprehensive profiling both tumor and immune compartments in 6 diagnostic FL biopsies by single-cell RNA sequencing. This confirmed results from 155 FL tumors characterized by mass cytometry (CyTOF) which revealed two distinct evolutionary trajectories with disparate risk of transformation and alternate biologies.

  Study EGAS00001005257

• UROMOL 2020 - SNP data

  The molecular landscape in non-muscle-invasive bladder cancer (NMIBC) is characterized by large biological heterogeneity with variable clinical outcomes. Here, we performed a large integrative multi-omics analysis of patients diagnosed with NMIBC (n=834). Transcriptomic analysis identifies four classes (1, 2a, 2b and 3) reflecting tumor biology and disease aggressiveness. Both transcriptome-based subtyping and the level of chromosomal instability provide independent prognostic value beyond established prognostic clinicopathological parameters.

  Study EGAS00001004862

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• Hereditary_Cerebellar_Ataxias___Whole_Genome_Sequencing___2021

  Looking to identify mutations in order to validate that lines we have classified as from Ataxia patients contain the disease relevant mutations. This will allow us to publish on the existance of these lines which are now commercially avalable. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001006234

• Whole blood transcriptomic analysis of ANCA-associated vasculitis

  Whole blood mRNA sequencing from 30 patients with AAV (granulomatosis with polyangiitis/GPA, n=22) and microscopic polyangiitis (MPA, n=8) combined with functional enrichment and network analysis for aberrant pathways. Key genes and pathways were validated in an independent cohort of 18 AAV patients. Co-expression network and hierarchical clustering analysis, identified molecular endotypes. Multi-level transcriptional overlap analysis to SLE was based on our published data from 142 patients.

  Study EGAS00001006704

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• Single cell transcriptomic data of human gut macrophages

  Cellular suspensions (∼15000 cells, with expected recovery of ∼7500 cells) of sorted CD45+ HLA-DR+ CD14+ macrophages from colonic mucosa and muscularis propria were loaded on the 10X Chromium Controller instrument (10X Genomics) according to the manufacturer’s protocol using the 10X GEMCode proprietary technology. All samples from individual patients were loaded in one batch. The Chromium Single Cell 3´ v2 Reagent kit (10X Genomics) was used to generate the cDNA and prepare the libraries, according to the manufacturer’s protocol. The libraries were then equimolarly pooled and sequenced on an Illumina NextSeq500 using HighOutput flow cells v2.5. A coverage of 400M reads per sample was targeted, in order to obtain 50 000 reads per cell. The raw data were then demultiplexed and processed with the Cell Ranger software (10X Genomics) v2.1.1.

  Dataset EGAD00001007765

• Identification of immune mechanisms associated with the high rate of relapse in patient with visceral leishmaniasis and HIV co-infection

  RNA-seq transcriptomics of whole blood samples from longitudinal follow-up of a cohort of visceral leishmaniasis (VL) patients with and without HIV coinfection, from active disease through apparent cure and potential relapse. Analysis will identify potential correlates of relapse to identify immune mechanisms underlying the high rate of relapse in HIV/VL coinfection. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ .

  Dataset EGAD00001008361

• WGS and Avenio Surveillance Panel data to previously submitted data under study number EGAS00001004276 of ALK-rearranged lung cancer

  Some data was previously submitted data under study number EGAS00001004276. In this new dataset we provide additional WGS and Avenio Surveillance Panel data. We utilized 43 ALK+ NSCLC patients receiving targeted ALK therapy to evaluate ctDNA levels based on matched panel-based targeted next generation sequencing (tNGS) and untargeted shallow whole genome sequencing (sWGS). For the Avenio panel the sequencing was done on Illumina NextSeq 550 paired end 150 bp, for WGS the sequencing was done on Illumina HiSeq 4000, partly with KAPA_Hyper_Prep_Kit. In this dataset there are 132 WGS tumor samples and 134 panel sequencing data of plasma.

  Dataset EGAD00001007818

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  We investigated 10 female and 14 male SARS-CoV-2 positive children (age range: 0.8 to 18 years). Based on the WHO guidelines, 15 patients were classified as having mild COVID-19, while 7 children were classified as moderate COVID-19 cases. Two children were asymptomatic. 8 female and 10 male SARS-CoV-2 negative children were included as controls (age range: 4 to 16). 12 SARS-CoV-2 positive female and 9 male adults were included ( age range: 27 - 76) together with 13 female and 10 male SARS-CoV-2 negative adult controls (age: 24 - 77). 10 adult COVID-19 patients had mild disease, while 12 had moderate COVID-19. We performed single-cell RNA sequencing experiments.

  Dataset EGAD00001007969

• Single nuclei sequencing of early, late-term, and early-onset pre-eclamptic decidua and villi.

  Hypertensive disorders in pregnancy, of which the multisystem syndrome pre-eclampsia is the most severe, leading to preterm delivery, maternal mortality, and life-long complications. To elucidate early disease dynamics, we present the first spatio-temporal study comparing single-nuclei transcriptomes of human preterm pre-eclamptic placentae and healthy controls, contextualizing this in a comprehensive study including early and late gestational placentae. This study includes early placentae samples from the fetal part (villi; n=10), maternal part (Decidua; n=3), late placentae samples from healthy pregnancies, villi (n=6), decidua (n=4), and late placentae samples from early-onset preeclamptic pregnancies, villi (n=5) and decidua (n=5).

  Dataset EGAD00001008273

• Genomic Evolution of Breast Cancer Metastasis and Relapse

  Recurrent breast cancer is almost universally fatal. We characterize 170 patients locally relapsed or distant metastatic cancers using massively parallel sequencing. We identify that the relapse-seeding clone disseminates late from the primary tumor. TP53 and AKT1 appear to be enriched in ER-positive cancers predisposed to relapse. Mutation acquisition continues at relapse as the same mutation signatures continue to operate and new signatures, such as that caused by radiotherapy appear de novo. In 49% of cases we identify drivers mutations private to the relapse and these are sampled from a wider range of cancer genes, including SWI-SNF complex and JAK-STAT signaling.

  Dataset EGAD00001002696

• Myeloma Genome Project Targeted Sequencing Panel - Oxford Data

  This dataset comprises the BAM files from targeted genome sequencing of CD138+ selected myeloma tumour samples from 21 individuals. In 5 cases there is only one tumour sample, but in the other 16 cases there are sequential samples, spanning treatment relapses. There are denoted Tumor A, B C etc. Therefore there are a total of 48 myeloma tumour samples. For each individual there is also a germline control samples, obtained either from peripheral blood or from CD138-selected bone marrow cells.

  Dataset EGAD00001008735

• Disease specific alterations in the olfactory mucosa of patients with Alzheimer’s disease

  The sample AD_Library_1, AD_Library_2 and Control_Library were run on a Chromium Chip B with the Chromium Single Cell 3′ Library & Gel Bead Kit v3 kit (10x Genomics, CA, USA) . The 3’ gene expression libraries were sequenced at an approximate depth of 50,000 reads per cell using the NovaSeq 6000 S1 (Illumina, San Diego, CA, USA) flow cells. Cell Ranger v.3.0.2 was used to analyze the raw base call files. FASTQ files and raw gene-barcode matrices were generated and aligned human genome GRCh37 (hg19). The samples were integrated in R v.4.0.3 and generated Seurat objects, two related to AD samples and one to control samples, were analyzed using the Seurat package v.4.0.3 to perform downstream analysis, clustering of the cells and differential expression.

  Dataset EGAD00001008560

• Variant calls for "Quality of Whole Genome Sequencing from Blood versus Saliva Derived DNA in Cardiac Patients"

  Paired blood and saliva samples from five unrelated individuals were directly compared for quality of whole genome sequencing. Two (Sample Pairs 1 and 2) were female probands diagnosed with tetralogy of Fallot, a type of congenital heart disease, and three (Sample Pairs 3, 4 and 5) were male probands diagnosed with hypertrophic cardiomyopathy. WGS was performed using Illumina HiSeq X to a target average coverage depth of 30x and a read length of 150 bp. The resulting reads were not filtered for minimum quality in order to avoid losing possible contaminant reads. Sequencing read alignment was done using Isaac Aligner to human genome build hg19. Short variant i.e. single-nucleotide variant (SNV) and small insertion-deletion (indel) calling was performed using Isaac Variant Caller with default parameters.

  Dataset EGAD00001005772

• WGS/WES analysis refines molecular subtypes of hepatocellular carcinoma

  This work aims to identify homogeneous and robust molecular subtypes in HCC based on a large, homogenous and well-annotated cohort. We performed whole genome/exome sequencing (WGS/WES) on 529 HCC from 461 patients collected mainly in France. Based on the genomic data, we identified 9 robust HCC subtypes primarily driven by key mutations. We further characterized these subtypes using genomic and clinicopathological features. Among the 9 subtypes, 5 belonged to chromosome instable tumors, while 3 belonged to chromosome stable tumors. Our subtypes were associated with prognosis and showed distinct distributions across features like etiology and gender. This study offers a comprehensive molecular classification of HCC, enhancing our understanding of hepatocarcinogenesis and supporting the development of genome-based precision medicine for liver cancer.

  Dataset EGAD00001015428

• RNA-seq of non-LPS treated (N), non-tolerized (NT), and tolerized (T) IFNg-primed macrophages pretreated with or without HDAC3i

  In this experiment we investigated the effect of HDAC3 inhibition on the transcriptome of IFNg-primed macrophages under different tolerization conditions. Peripheral blood mononuclear cells (PBMCs) were isolated from 3 healthy donors. PBMCs were isolated from whole blood of healthy donors using Ficoll gradient (Invitrogen). Monocytes (CD14+ cells) were positively selected from PBMCs using CD14 Microbeads according to the manufacturer’s instructions (Miltenyi Biotec). Monocytes were subsequently treated with or without 500 nM HDAC3i (ITF3100) for 30 minutes prior to overnight IFNg priming (50 ng/mL). Cells were then kept without LPS (non-LPS; N), treated with 10 ng/mL LPS once (non-tolerized; NT), or treated with LPS twice (tolerized; T; second LPS concentration: 100 ng/mL). In total, there were 18 samples included.

  Dataset EGAD00001005959

• MultiOMICS study of a pair of infant monozygotic twins with concordant B-cell ALL (WGS)

  B-cell acute lymphoblastic leukemia (B-cell ALL) is the most common cancer in childhood. Studying identical twins with B-cell ALL provides a unique and tractable model for deciphering the developmental timing of pre- and post-natal mutations contributing to clonal evolution. To date, this has mainly focused on major cytogenetic subgroups of childhood B-cell ALL, including MLL fusions, ETV6-RUNX1, hyperdiploidy, and BCR-ABL1. However, formal demonstration of the prenatal origin and “backtracking” the natural history of the leukemia remains understudied in “B-other”/Normal Karyotype (NK) B-cell ALL. To characterize the genetic landscape of this particular leukemia subtype, we performed whole genome DNA- and B-cell receptor (BCR)- on a pair of 8-month-old monozygotic twins diagnosed with concordant “B-other”/NK B-cell ALL.

  Dataset EGAD00001005017

• Genomic characterisation of SDH deficient renal cell carcinoma - WGS

  SDH deficient renal cell carcinomas are a rare and recently defined subtype of kidney cancer, often associated with an inherited mutation in one of the SDH gene subunits. This dataset sought to understand the genomic events that underpin tumour formation, from putative cell of origin, characterisation of the tumour microenvironment, to the genomic evolution of these rare tumours. We performed whole genome and RNA sequencing of 4 patients with SDH deficient renal cell carcinomas, including one patient who had an additional paraganglioma. An addition patient in this cohort had the initial diagnosis revised to a clear cell renal cell carcinoma.

  Dataset EGAD00001008469

• RNAseq data of polyA+ RNA from Leukocytes from 624 individuals of the ProgeNIA cohort.

  We sequenced the polyA+ fraction of the RNA of the leukocytes from 624 sardinian individuals with RNAseq. Prior to library preparation we added either ERCC ExFold RNA Spike-In. An average of 60M reads per samples with 51 bp paired-end reads were generated on a HiSeq 2000 (Illumina). Sequencing reads were then aligned using STAR-2.2.0c2 to the h37d5 reference genome supplemented with the ERCC spike-ins sequences. We further provided an exon-exon junction database that we generated from the GENCODE v14 annotation. In order to remove a contamination from a parallel experiment, we discarded any reads that mapped to the genomic regions of CBLB (chr3:105370773-105592330) and BCL11A (chr2:60672555-60784156). Filtered aligned reads (bam format) are shared.

  Dataset EGAD00001003102

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• Direct transcriptional consequences of somatic mutation in breast cancer

  The disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription; co-ordinated secondary alterations in transcriptional pathways; and increased transcriptional noise. To catalogue the rules governing how somatic mutation Overall, 59% of 6980 exonic substitutions were expressed. Compared to other classes, nonsense mutations showed lower expression levels than expected with patterns characteristic of nonsense-mediated decay. 14% of 4234 genomic rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusion transcripts and premature poly-adenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes may drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data therefore reveals the rules by which transcriptional machinery interprets somatic mutation.

  Dataset EGAD00001002236

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• single-cell RNA-seq Case-Control study of children progressing to Type1 diabetes

  It was a single-cell RNA sequencing study on the PBMC samples from four Finnish children at risk of developing Type 1 diabetes and their gender age and HLA matched control children. All four Case children were positive for multiple islet specific autoantibodies and two of them also progressed to clinical disease during the follow up whereas the control children remain negative for all autoantibodies. Single-cell analysis confirmed some of the signatures obtained from the bulk data. It identified that high IL32 in case samples in the bulk RNA-seq was contributed mainly by activated T cells and NK cells. Trajectory analysis of the scRNA-seq data suggested that IL32 expression increased as the T cells moved towards activated state.

  Dataset EGAD00001005768

• A non-canonical lymphoblast in refractory childhood T cell leukaemia

  Refractory cancers may arise either through the acquisition of resistance mechanisms by cancer cells or represent distinct diseases. The origin of childhood T-cell acute lymphoblastic leukaemia (T-ALL) that does not respond to initial treatment, i.e. refractory disease, is unknown. Refractory T-ALL carries a poor prognosis and cannot be predicted at diagnosis. Here, we performed single cell mRNA sequencing of T-ALL from children who did or did not respond to initial treatment. We identified a transcriptionally distinctive blast population, exhibiting features of innate-like lymphocytes, as the major source of refractory disease. Evidence of such blasts at diagnosis heralded refractory disease across independent datasets and was associated with survival in a large, contemporary trial cohort. Our findings portray refractory T-ALL as a distinct disease. They may have immediate clinical utility.

  Dataset EGAD00001015381

• Massive parallel RNA sequencing of highly purified mesenchymal cells derived from bone marrow specimens of 10 healthy donors

  Highly purified mesenchymal cells (CD45-/7AAD-/CD235a-/CD31-/CD271+/CD105+) were prospectively FACS-isolated from bone marrow specimens of 10 healthy donors (HDs). This data set is used as a baseline control to observe the differences between gene expression profiles (GEPs) of pre-leukemia cases (45 low-risk myelodysplastic syndrome, 4 Shwachman-Diamond and 3 Diamond-Blackfan anemia patients) and gene expression patterns observed in a normal, healthy context. Through differential expression and gene set enrichment analysis we determined that inflammatory signaling pathways are significantly more active in mesenchymal cells of pre-leukemia cases compared to their healthy counterparts. Finally, we determined through statistical modelling of healthy donor's GEPs which pre-leukemia cases have significantly more active inflammatory signaling and demonstrated a strong relation to survival statistics.

  Dataset EGAD00001002659

• MultiOMICS study of a pair of infant monozygotic twins with concordant B-cell ALL (WGBS)

  B-cell acute lymphoblastic leukemia (B-cell ALL) is the most common cancer in childhood. Studying identical twins with B-cell ALL provides a unique and tractable model for deciphering the developmental timing of pre- and post-natal mutations contributing to clonal evolution. To date, this has mainly focused on major cytogenetic subgroups of childhood B-cell ALL, including MLL fusions, ETV6-RUNX1, hyperdiploidy, and BCR-ABL1. However, formal demonstration of the prenatal origin and “backtracking” the natural history of the leukemia remains understudied in “B-other”/Normal Karyotype (NK) B-cell ALL. To characterize the epigenetic landscape of this particular leukemia subtype, we performed DNA bisulfite-sequencing on a pair of 8-month-old monozygotic twins diagnosed with concordant “B-other”/NK B-cell ALL.

  Dataset EGAD00001005018

• Pathogenesis and Immunity in Endemic Burkitt Lymphoma

  This genomic landscape of Burkitt lymphoma represents a multimodal sequencing of tumors and control tissues and individuals to better understand the etiology, and molecular pathogenesis of Burkitt lymphoma including the roles of the associated Plasmodium falciparum malaria and EBV infections. Comprehensive sequencing set includes genomic, transcriptomic, and epigenomic datasets in concert with variable clinical phenotypes and outcome information such as anatomical presentation site, in-hospital survival rates, and EBV genome type. This deposit includes additional small RNA-seq data from endemic BL (eBL) tumors and RNA-sequencing data from sorted NK cell subsets from the peripheral blood of eBL patients. The additional small RNA-seq data are from tumor specimens from 17 eBL cases, of the previously deposited polyA RNA-seq data from 28 eBL cases (phs1282.V1). The additional RNAseq data from Fluorescence-activated cell sorting (FACS) of NK cell subsets, isolated from the peripheral blood of 7 eBL cases. The additional RNAseq data are from eBL tumor samples of 5 eBL cases, BL cell lines established from these tumor samples and also NSG mouse tumors created by implanting the established BL cell lines into NSG mice. The dataset also includes RNAseq data of the NSG mouse tumors after treatment with Rituximab (RIT) and Phosphate buffered saline (PBS). The fifth batch of data includes mRNA-seq from different passages of a single eBL cell line that have variable EBV phenotypes (low passage with lytic EBV and high passage with latent EBV). This batch also includes lytic and latent lymphoblastoid cell line (LCL) clones from a single blood donor generated through infection with the strain of EBV isolated from the aforementioned eBL cell line. For initial transcriptome analysis see: Kaymaz et al. "Comprehensive Transcriptome and Mutational Profiling of Endemic Burkitt Lymphoma Reveals EBV Type-specific Difference." Molecular Cancer Research, 2017, PMID: 28465297. For initial microRNA analysis see: Oduor et al. "Human and Epstein-Barr Virus miRNA Profiling as Predictive Biomarkers for Endemic Burkitt Lymphoma." Frontiers in Microbiology 8, 2017, PMID: 28400759. For initial NK subsets RNA expression analysis see: Forconi et al. "A new hope for CD56negCD16pos NK cells as unconventional cytotoxic mediators: an adaptation to chronic diseases." Frontiers in Cellular and Infection Microbiology, 2020, PMID: 32373555.For initial eBL cell line and mouse avatar RNA expression analysis see: Saikumar et al. "Endemic Burkitt lymphoma avatar mouse models for exploring inter-patient tumor variation and testing targeted therapies." Life Science Alliance, 2023, PMID: 36878637. For general overview of cohort study see: Buckle et al. "Factors influencing survival among Kenyan children diagnosed with endemic Burkitt lymphoma between 2003 and 2011: A historical cohort study." Int J Cancer. 15:1231, 2016, PMID: 27136063.

  Study phs001282

• EGAD00010000628

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000628

• EGAD00010000630

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000630

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495