4736 results for "*oma"

in 40.45 milliseconds.

• Spatiotemporal Charting of Human Esophageal Development for Epidermolysis Bullosa Cell Therapy

  Human fetal esophageal development is not well understood. We present a spatio-temporal single-cell multi-omics atlas to close such a long-standing knowledge gap. With such an atlas, we describe the cellular heterogeneity and lineage transitions of esophageal epithelium and stroma. We delineate the cellular dynamics of both epithelial and stromal populations during the establishment of esophageal tissue architecture. We identify niche paracrine signals that drive the development of the epithelium. We develop an in silico perturbation deep learning algorithm to further enlighten the in vitro derivation of esophageal basal cells (eBCs) and we use the algorithm to screen for effective and efficient signaling pathway perturbations that could guide in vitro eBC differentiation. We observe that chemically perturbing prioritized pathways yields functional eBCs. Such success sheds light on cell replacement therapy of eBC dysfunction, such as Epidermolysis Bullosa.

  Study phs003281

• Genotyping Data From Subjects With Brain Lesions

  These data are from subjects with adult diffuse glioma (IDH wildtype, IDH mutant/1p19q intact, and IDH mutant/1p19q co-deleted), brain lesions, tumefactive multiple sclerosis, brain metastases, central nervous system lymphoma and controls genotyped on the Affymetrix Axiom Precision Medicine array. Data from this study were used for case/control association studies and developing polygenic risk scores.

  Study phs003806

• Evolutionary Pressures Shape Undifferentiated Pleomorphic Sarcoma Development and Radiotherapy Response

  To study tumor evolution during tumorigenesis and in response to radiotherapy, we performed whole exome sequencing of 120 spatially distinct tumor regions and matched germline DNA from 20 patients with undifferentiated pleomorphic sarcoma. This data was utilized to generate personalized capture probes for targeted resequencing of the tumor and normal samples along with 17 matched plasma samples for circulating tumor DNA analysis. We found evidence of subclonal selection prior to treatment that was increased after radiotherapy. In addition, circulating tumor DNA analysis was able to measure the abundance of subclones before, during, and after treatment. This dbGaP submission includes whole exome sequencing and targeted resequencing from the study.

  Study phs003830

• A Platform Study of Combination Immunotherapy for the Neoadjuvant and Adjuvant Treatment of Patients with Surgically Resectable Adenocarcinoma of the Pancreas

  This is a single-institutional, randomized, open label platform clinical trial testing various immunotherapy combinations. Patients with newly diagnosed and surgically resectable pancreatic ductal adenocarcinoma (PDA) and scheduled to undergo the Whipple procedure at Johns Hopkins Hospital were eligible to participate in this study. Criteria for determining resectability strictly followed National Comprehensive Cancer Network (NCCN) guidelines. The study consisted of 6 parts: parts 1-5 constituted the Prime Phase (see below), and part 6 was the Extended Treatment Phase. Part 1: Participants received one cycle of immunotherapy two weeks prior to undergoing the Whipple procedure. Part 2: Subjects underwent the Whipple procedure. Part 3: Subjects received a second cycle of immunotherapy 4-10 weeks following the Whipple procedure (2-4 weeks prior to adjuvant chemoradiation). Part 4: Subjects underwent chemoradiation. Part 5: Subjects received 4 additional 28-day cycles of immunotherapy beginning 1-2 months after completing chemoradiation for a total of six cycles (two before chemoradiation and 4 following chemoradiation). Eligible subjects were randomized to Arms A and B in a 1:1 ratio, stratified up-front by age (≤65, >65). Arm A participants received Cy/GVAX. Arm B participants received the combination of Cy/GVAX and nivolumab. GVAX Vaccine consists of equal numbers (2.5 x 108 each) of Panc 6.03 pcDNA1GM-CSF and Panc 10.05 pcDNA1GM-CSF combined into a single vaccination. Each vaccination consisted of six total intradermal injections. A single intravenous (IV) dose of 200 mg/m2 Cy (CytoxanR) was given one day prior to GVAX. Anti-PD-1 Therapeutic Antibody Nivolumab 480 mg every 4 weeks was administered as an intravenous infusion. The primary objective for Arms A and B was to compare IL17 expression (Th17) in vaccine-induced lymphoid aggregates between resected PDAs from patients treated with the combination of Cy/GVAX and anti-PD-1 blockade antibody vs. the treatment of Cy/GVAX alone. Secondary objectives were to assess the safety, overall survival (OS), and disease free survival (DFS) of patients treated with each of the study drug combinations, and to assess the effects of each of the immunotherapy study drug combinations on PD-L1/PD-1 associated pathways, vaccine-induced immune regulatory signatures, and peripheral and intratumoral antigen specific T cell responses. The exploratory objective was to explore the effects of therapy on tumor and peripheral blood and tumor infiltrating immune cells, and to explore potential molecular determinants of response, progression and disease stability. To these ends, tumor infiltrating immune cells (TIICs) were obtained from surgically resected tumors following the neoadjuvant treatment of the study immunotherapy. TIICs were sorted into CD3+CD4+ T cells, CD3+CD8+ T cells, CD3-CD19+ B cells, and CD3-CD19-CD11b+ myeloid cells by flow cytometry. The sorted immune cell subtype pellets were sent to the commercial vendor (Eurofins) for RNA extraction and sequencing. SMART-seq v4 Ultra Low Input mRNA Sample Prep Kit was used for library preparation with 100bp paired end reads. FASTQ files, that were returned from the vendor, are deposited here.

  Study phs003002

• Yale SPORE in Skin Cancer Project 2

  Understanding the relationship between tumor and peripheral immune environments could allow longitudinal immune monitoring in cancer. Here, we examined whether T cells that share the same TCRab and are found in both tumor and blood can be interrogated to gain insight into the ongoing tumor T cell response. Paired transcriptome and TCRab repertoire of circulating and tumor-infiltrating T cells were analyzed at the single cell level from matched tumor and blood from patients with metastatic melanoma. The data shared here consist of gene expression matrix and fastq files obtained from sequencing single-cell libraries generated with the Chromium (TM) 5' technique. For each of 18 immunotherapy naive and 11 previously treated melanoma patients, T cells (Live/CD45+/TcRab+) were FACS-sorted from PBMCs and freshly resected tumors. Metadata associated with each individual cell consist of Patient I.D., biological sex, immunotherapy status, amino acid and nucleotide CDR3 sequence of the TCR alpha and beta chain (obtained from matched VDJ region enriched libraries), and sequencing batch. Further details about previous treatment history and other clinical parameters can be found in the associated manuscripts (Lucca et al., 2021: PMID: 33651881; Lu et al., PMID: 39609626).

  Study phs002289

• MDACC GBM Data Access Committee

  Retrospective global-omics analyses of an anti-PD-L1 treated cohort of newly diagnosed glioblastoma.

  Dac EGAC50000000477

• Assessment of candidate high-grade serous ovarian carcinoma predisposition genes through integrated germline and tumour sequencing

  High-grade serous ovarian carcinoma (HGSOC) has a significant hereditary component, only half of which is explained. Previously, we performed germline exome sequencing on BRCA1 and BRCA2-negative HGSOC patients, revealing three proposed and 43 novel candidate genes enriched with rare loss-of-function variants. For validation, we undertook case-control analyses using genomic data from disease-free controls. This confirms enrichment for nearly all previously identified genes. Additionally, one-hundred-and-eleven HGSOC tumours from variant carriers were sequenced alongside other complementary studies, seeking evidence of biallelic inactivation as supportive evidence. PALB2 and ATM validate as HGSOC predisposition genes, with 6/8 germline carrier tumours exhibiting biallelic inactivation accompanied by characteristic mutational signatures. Among candidate genes, only LLGL2 consistently shows biallelic inactivation and protein expression loss, supporting it as a novel HGSOC susceptibility gene. The remaining candidate genes fail to validate. Integrating case-control analyses with tumour sequencing is thus crucial for accurate gene discovery in familial cancer studies.

  Study EGAS50000000770

• Genetic landscape of pediatric Retinoblastoma

  Study EGAS00001000346

• Whole Genome Sequencing of Neuroblastoma

  Study EGAS00001000222

• Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma

  Study EGAS00001000226

• Whole-genome-Sequencing of adult medulloblastoma

  Study EGAS00001000393

• Whole genome sequencing of chondrosarcoma

  Study EGAS00001000505

• Paired-end Whole Exome-seq analysis of the 3D evolution of glioma cell populations. Part 1.

  Dataset contains Exome sequencing data (aligned and base quality score recalibrated BAM files) for 236 tumor samples + matched normal from blood, collected from 21 patients with adult diffuse glioma. The majority of these samples were spatially-mapped during sample collection, enabling the genomic information derived from them to be mapped in 3D space.

  Dataset EGAD00001005221

• Paired-end RNA-seq analysis of the 3D evolution of glioma cell populations. Part 1.

  Dataset includes 160 double-stranded RNAseq libraries collected from 16 patients with adult diffuse glioma. The majority of these samples were spatially-mapped during sample collection, enabling the genomic information derived from them to be mapped in 3D space.

  Dataset EGAD00001005222

• Oesophageal adenocarcinoma scRNAseq from LUD2015-005 study (NCT02735239, EudraCT 2015-005298-19)

  This dataset contains single-cell RNA-seq generated from the LUD2015-005 study (NCT02735239, EudraCT 2015-005298-19) and additional donors with Barrett's oesophagus using the 5' Single Cell Gene Expression assay from 10x Genomics. Samples were generated from oesophageal tumours, Barrett's oesophagus, and normal oesophagus and gastric tissues, with the aim of generating a reference atlas for cell types found in normal and disease-associated tissue states in the upper GI tract. This reference atlas was used as the basis for a deconvolution workflow to estimate the cell composition of bulk transcriptomes from these tissues, and to assess cell type-specific expression patterns of potential predictive biomarkers for immunochemotherapy regimens in this setting.

  Dataset EGAD00001009401

• Multiple myeloma treated with T-cell redirecting immunotherapies

  Whole Genome Sequencing from patients with multiple myeloma treated with T-Cell redirecting therapies including chimeric antigen receptor T-cells (CAR-T) and Bispecific T-cell Engagers (TCE).

  Study EGAS50000000546

• Molecular biomarkers for stratification periheral T cell lymphoma

  Peripheral T cell lymphoma (PTCL) is a diverse group of rare lymphoid malignancies with overall poor prognosis. Diverse biological mchanisms behind these diverse disease groups make targeted treatment challenging. Based on molecular biomarkers, more , the aim is to characterise more specific features for the different clinically defined PTCL for new future prognostic therapies.

  Study EGAS00001006691

• nEODURVARIB clinical trial. Exome sequencing in advanced urothelial carcinoma

  Exome sequencing (BAM and VCF files) in advanced urothelial carcinoma in diagnostic and pos-ttreatment samples

  Dataset EGAD50000001162

• Melanoma Genome Sequencing Project

  Melanoma is the most prevalent cause of skin cancer morbidity and mortality. In order to characterize the full range of somatic mutations that may drive the growth of melanoma, we are sequencing tumor and normal DNA from a set of roughly 150 melanomas. For the majority of samples (approximately 90% of the cases), mutations in protein coding genes will be assessed in the exonic DNA of tumor-normal pairs using hybrid capture and paired-end DNA sequencing. For a few of DNA samples (approximately 10% of the cases), the entire genomes will be analyzed to assess the possible contribution of complex structural rearrangements contributing to oncogenesis. The sequencing data are supplemented by copy number profiling on the same tumors using high-density SNP arrays. Integration of these approaches will enable the unbiased and comprehensive characterization of both known and novel recurrent DNA alterations that arise in melanoma.Versions 1-4 contain whole exome and bulk RNA sequencing data for patients with melanoma.Version 5 - We compared somatic genomic profiles from matched pre-treatment and post-resistance tumor biopsies in patients with metastatic melanoma who exhibited heterogeneous responses to immune checkpoint inhibitors (ICIs). This version includes whole exome sequencing (WES) data from 14 patients.

  Study phs000452

• Genomic and transcriptome analysis for intrahepatic cholangiocarcinoma

  Study EGAS00001006007

• Malignant mesothelioma EWAS on European prospective study

  Study EGAS00001006432

• Hepatocellular carcinoma xenografts established from needle biopsies preserve the characteristics of the originating tumors

  Study EGAS00001003396

• Sclerosing Epithelioid Fibrosarcoma sequencing data

  Study EGAS00001007370

• Multi Omics of glioma in the the Chinese Glioma Genome Atlas (CGGA) project

  Study EGAS00001004729

• TULIPs decorate the three-dimensional genome of PFA ependymoma

  Study EGAS00001005476

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Oncolytic virotherapy mediated anti-tumor response in primary cutaneous B-cell lymphoma: a single-cell perspective

  Study EGAS00001004904

• A genome-wide association study for nasopharyngeal carcinoma in Hong Kong population

  Study EGAS00001006102

• ID1 in glioblastoma

  Study EGAS00001003711

• Polyomavirus-positive Merkel cell carcinoma derived from a trichoblastoma suggests an epithelial origin of Merkel cell carcinoma

  Study EGAS00001003784

• Targetable ERBB2 Mutations in Neurofibroma/Schwannoma Hybrid Nerve Sheath Tumors

  Study EGAS00001003776

• Molecular profiling reclassifies adult astroblastoma into known and clinically distinct tumor entities with frequent MAPK pathway alterations

  Study EGAS00001003798

• Small molecule screen reveals synergy of cell cycle checkpoint kinase inhibitors with DNA-damaging chemotherapies in medulloblastoma (RNAseq dataset)

  Study EGAS00001004748

• WGS of Roma (Romani/Rroma) and European/Romanian individuals from Romania

  Study EGAS00001003624

• The whole genome landscape of Burkitt lymphoma subtypes

  Study EGAS00001003778

• Metabolic requirements of the metastasis-initiating tumour cell population using oral squamous cell carcinoma (OSCC) as a model system

  Study EGAS00001004765

• Multiregion Whole-Exome Sequencing Uncovers the Genetic Evolution and Mutational Heterogeneity of Early-Stage Metastatic Melanoma.

  Study EGAS00001004320

• Accelerated single cell seeding in relapsed multiple myeloma

  Study EGAS00001004404

• Impact of genetic variants in clinical outcome of a cohort of patients with oropharyngeal squamous cell carcinoma

  Study EGAS00001004430

• Circulating tumor cells for comprehensive and multiregional non-invasive genetic characterization of multiple myeloma

  Study EGAS00001004288

• Genomic characterization of retinoblastoma

  Study EGAS00001005248

• Multiscale heterogeneity in gastric adenocarcinoma evolution is an obstacle to precision medicine

  Study EGAS00001004525

• Deep MRD profiling defines outcome and unveils different modes of treatment resistance in standard and high risk myeloma

  Study EGAS00001004558

• Selective Elimination of Immunosuppressive T cells in Patients with Multiple Myeloma

  Study EGAS00001004915

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• AUBTRG - Whole Exome Sequencing of Diffuse Glioma Samples

  Study EGAS00001003035

• Integrated Genomic and Transcriptomic Analysis Reveals Unique Characteristics of Hepatic Metastases and Pro-metastatic Role of Complement C1q in Pancreatic Ductal Adenocarcinoma

  Study EGAS00001004821

• Genomic Analysis of Focal Nodular Hyperplasia with Associated Hepatocellular Carcinoma Unveils its Malignant Potential

  Study EGAS00001005313

• Immune infiltrate and tumor microenvironment transcriptional programs stratify pediatric osteosarcoma into prognostic groups at diagnosis

  Study EGAS00001005326

• WGS Leiomyosarcoma subtypes

  Study EGAS00001005341

• RNA-seq on neuroblastoma PDX model COG-N-519 treated with control miR-1283 and test miR-99b-5p mimics

  Study EGAS00001005368

• Epigenetic encoding, heritability and plasticity of glioma transcriptional cell states

  Study EGAS00001005472

• A renal cell carcinoma tumorgraft platform to advance precision medicine

  Study EGAS00001005516

• Single-cell characterization of anti-LAG3+anti-PD1 treatment in melanoma patients

  Study EGAS00001005580

• Berlin Neuroblastoma Dataset Update 2021

  Study EGAS00001005604

• PIK3CA mutation in a case of CTNNB1 mutant sinonasal glomangiopericytoma

  Study EGAS00001005653

• Myeloma methylation

  Study EGAS00001005788

• Mutations in ALK signaling pathways conferring resistance to ALK inhibitor treatment lead to collateral vulnerabilities in neuroblastoma cells

  Study EGAS00001005791

• RNA-seq data from 27 glioblastoma samples

  Study EGAS00001005807

• Orthotopic murine Group 3 medulloblastoma in C57Bl/6 mice treated with saline, cyclophosphamide or gemcitabine

  Study EGAS00001005846

• Orthotopic murine Group 3 medulloblastoma in C57Bl/6 mice treated with sham or craniospinal irradiation

  Study EGAS00001005847

• Overexpression of the miR-17-92 cluster in colorectal adenoma organoids induces a carcinoma-like genotype

  Study EGAS00001005949

• Oesophageal adenocarcinoma whole exome and RNA-seq raw sequencing data

  Study EGAS00001005957

• Targeted analysis of cell-free circulating tumor DNA is suitable for early relapse and actionable target detection in patients with neuroblastoma

  Study EGAS00001006027

• A multi-center genome-wide association study for nasopharyngeal carcinoma

  Study EGAS00001006062

• Molecular characterization of a renal cell carcinoma PDX cohort

  Study EGAS00001006249

• Genomic profiling of metastatic basal cell carcinoma reveals candidate drivers of disease and therapeutic targets

  Study EGAS00001006148

• Validation of a targeted sequencing panel for multiple myeloma

  Study EGAS00001006164

• Study of the microenvironment of angioimmunoblastic T-cell lymphoma

  Study EGAS00001006401

• A Risk Score Incorporating Low Pass Whole Genome Sequencing of Cell Free DNA from Patients Receiving CD19 CAR T-Cell Therapy for Large B-Cell Lymphoma

  Study EGAS00001006308

• Molecular determinants of outcomes in relapsed mantle cell lymphoma treated with ibrutinib or temsirolimus in the MCL3001 (RAY) trial

  Study EGAS00001006342

• Soft tissue sarcoma sequencing data

  Study EGAS00001006356

• Single-cell study of 14 childhood medulloblastoma patients

  Study EGAS00001006392

• Quantitative Exploratory Proteomics Analysis of Glioblastoma in Initial and Recurrent Tumors

  Study EGAS00001006395

• Case Report: early contribution of germline and nevi genetic alterations to a rapidly-progressing Cutaneous Melanoma Patient

  Study EGAS00001006459

• microRNA and isomiR profiling of Stage 1 epithelial ovarian carcinoma

  Study EGAS00001006617

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - WGS

  Study EGAS00001006843

• Genomic Analysis of a Metastatic Fusion-negative Embryonal Rhabdomyosarcoma

  Study EGAS00001006946

• Germline variants in childhood cutaneous melanoma

  Study EGAS00001006995

• Whole genome, RNA-seq and single-cell Multiome profile of multiple myeloma

  Study EGAS00001007014

• VRK3 depletion in Pontine Diffuse Midline Glioma (DMG)-K27 altered cells

  Study EGAS00001007047

• Genomic Landscape of Follicular Lymphoma Across a Wide Spectrum of Clinical Behaviors

  Study EGAS00001007105

• TIGIT is the central player in T-cell suppression associated with CAR T-cell relapse in mantle cell lymphoma

  Study EGAS00001007113

• Exploration of neuroblastoma xenograft models for tumor extracellular RNA profiling in murine blood plasma

  Study EGAS00001007295

• Detection of somatic mutations of angioimmunoblastic T-cell lymphoma

  Study EGAS00001007333

• Integrative genomic analyses of European intrahepatic cholangiocarcinoma: new ROS1 fusion gene and PBX1 as prognostic marker

  Study EGAS00001007525

• Identification of Novel Immunotherapy Targets in Myeloma

  RNA sequencing (RNA-Seq) was performed on 94 multiple myeloma (MM) patient samples. We used genomic subgroup and high-risk markers to identify therapeutic targets, including TNFRSF17, GPRC5D, ITGA4, and LAX1, with low predicted toxicity and high specificity to MM and genomic subgroups such as those with TP53 alterations.

  Study phs003772

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Novel Myeloma Pathobiology Mediators and Potential Targets

  Newly diagnosed symptomatic and relapsed/refractory myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors which have been studied utilizing bulk or single-cell (sc) techniques. By combining scRNA-sequencing with scB-cell receptor (BCR)-sequencing, we found more dysregulated genes in monoclonal PCs compared with analyses of the entire CD138+ population, which includes non-neoplastic/polyclonal PCs. Paired tumor and non-tumor WGS was performed to evaluate the presence of IgH-associated translocations and hyperdiploidy events, initially detected by FISH, in a subset of samples included in this study.

  Study EGAS50000000801

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Myeloma Pathobiology Mediators and Potential Targets

  Multiple myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors and has been studied utilizing approaches focused on CD138+ cells. By combining single-cell (sc)RNA- with scB-cell receptor (BCR)-sequencing, we differentiate monoclonal/neoplastic from polyclonal/normal PCs, and find more dysregulated genes, especially in precursor patients, than by analyzing bulk PCs. To determine if this approach can identify oncogenes that contribute to disease pathobiology, MAD2L1 and MAT2A are validated as targets with drug-like molecules that suppress myeloma growth in pre-clinical models. Moreover, functional studies show a role of LAMP5, which is uniquely expressed in neoplastic PCs, in tumor progression and aggressiveness via interactions with c-MYC. Finally, a monoclonal antibody recognizing cell-surface LAMP5 shows efficacy as an antibody-drug conjugate and in a chimeric antigen receptor-guided T-cell format. These studies provide additional insights into myeloma biology and identify potential targeted therapeutic approaches that can be applied to reverse myeloma progression.

  Study EGAS50000000802

• Single-cell Analysis of Neoplastic Plasma Cells Identifies Novel Myeloma Pathobiology Mediators and Potential Targets

  Newly diagnosed symptomatic and relapsed/refractory myeloma is a clonal plasma cell (PC) dyscrasia that arises from precursors which have been studied utilizing bulk or single-cell (sc) techniques. By combining scRNA-sequencing with scB-cell receptor (BCR)-sequencing, we found more dysregulated genes in monoclonal PCs compared with analyses of the entire CD138+ population, which includes non-neoplastic/polyclonal PCs. We identified a panel of genes that were over- or under-expressed in symptomatic states that could be putative oncogenic drivers or tumor suppressors, respectively.

  Study EGAS50000000803

• WGS of Newly Diagnosed and Refractory/Relapsed Multiple Myeloma

  This dataset includes paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dataset EGAD50000001177

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Single-cell Transcriptome Analysis of Plasma Cells Across the Disease Spectrum of Multiple Myeloma

  This dataset includes FastQ files of single-cell RNA sequencing data of 5' GEX and VDJ libraries from CD138+ plasma cells enriched from 72 bone marrow aspirates from patients diagnosed with a monoclonal gammopathy from the multiple myeloma spectrum, including MGUS (n=13), SMM (n = 22), NDMM (n = 17), RRMM (n = 15) and PCL (n = 2); and 3 controls.

  Dataset EGAD50000001179

• MDACC Lymphoma & Myeloma WGS of Tumor and Non-tumor Cells in Multiple Myeloma

  FastQ files from paired tumor and non-tumor WGS data from patients diagnosed with newly diagnosed (n = 6), refractory/relapsed multiple myeloma (n = 3) or plasma cell leukemia (n = 1). These samples presented >95% tumor PCs in bone marrow aspirates. Plasma cells and T cells (non-tumor cells) were isolated from bone marrow aspirates using a magnetic approach.

  Dac EGAC50000000282

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• MDACC Lymphoma & Myeloma scRNAseq of Plasma Cells in Multiple Myeloma

  FastQ files from Chromium single cell 5' gene expression and B-cell receptor sequencing of plasma cells from patients diagnosed with a monoclonal gammopathy of the multiple myeloma spectrum, including the precursor stages MGUS (n =13) and SMM (n = 22); newly diagnosed (n = 17); relapsed (n = 15); and plasma cell leukemia (n = 2); and 3 controls.

  Dac EGAC50000000271

• TRACERx NSCLC - whole genome sequencing for ctDNA study

  An ultra-sensitive and specific ctDNA assay provides novel pre-operative disease stratification in early stage lung adenocarcinoma

  Study EGAS50000000313

• Peripheral T cell lymphoma (PTCL) Shallow Whole Genome Sequencing

  Shallow Whole Genome Sequencing (sWGS) of 148 FFPE DNA samples from peripheral T cell lymphoma (PTCL) samples. Assoicated with the "Molecular biomarkers for stratification peripheral T cell lymphoma" study.

  Dataset EGAD50000001146

• metastatic uveal melanoma tumour biopsies

  Tumour biopsies were obtained from uveal melanoma patients pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Study EGAS50000000864

• mUM patient biopsies pre and post treatment with tebentafusp

  The dataset includes 141 RNA-seq samples form mUM patietns. Tumour biopsies were obtained from uveal melanoma patients pre and post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dataset EGAD50000001258