10841 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 43.75 milliseconds.

• The Iberian Roma genetic variant server

  The Roma are the most numerous ethnic minority in Europe. The Iberian Roma arrived in the Iberian Peninsula five centuries ago and still today, they keep a strong group identity. Demographic and cultural reasons lie behind a high rate of Mendelian disease often related to founder variants. We have analysed exome data from 119 Iberian Roma individuals collected from 2018 to 2020. A database of variant frequency has been implemented (IRPVS) and made available online. We have analysed the carrier rate of founder private alleles as well as pathogenic variants present in the general population. Significant enrichment in structural variants involving gene clusters related to keratinization and epidermal growth suggest that evolutive mechanisms have developed towards climate and environmental adaptation. IRPVS can be accessed at http://irpvs.clinbioinfosspa.es/

  Study EGAS00001006758

• GCparagon: Evaluation and correction of GC biases in cell-free DNA at the fragment level

  We present GCparagon, a two-stage algorithm for computing and correcting GC biases in cell-free DNA (cfDNA) samples. The length of the highly fragmented cfDNAs and the number of GC bases are essential parameters in the calculations. Regions of low mappability, known reference genome assembly errors and regions surrounding assembly gaps are excluded from the bias computation. GCparagon outputs a bias matrix and an optional tagged BAM file with GC bias balance weights as alignment tags. Parallelization allows calculation of a GC bias estimate in less than 2 minutes per sample with between 99.0% and 99.9% of fragments already corrected. We propose that GCparagon can help standardize cfDNA applications and evaluate the impact of GC bias on algorithms used in the analysis of liquid biopsy data.

  Study EGAS00001006963

• Evolutionary landscape of clonal hematopoiesis in 3359 individuals from the general population

  This project contains longitudinal data for processed somatic variant calls and data on core phenotypic variables for 3359 community-based individuals ≥60 years, a sub-cohort of the population-based Lifelines cohort (167,729 participants). Cases with peripheral blood count abnormalities and population-based controls were included. Next-generation sequencing data were generated with a median time period of 43 months between baseline and follow-up visit. For 327 individuals a third visit sample was included. Error-corrected sequencing was performed using single-molecule tagged molecular inversion probes targeting 27 myeloid and lymphoid driver genes. The threshold for variant calling was set at ≥1% VAF and ≥10 consensus variant reads. Details on sample selection, sequencing technique, variant calling procedures and data curation are described (van Zeventer et al. 2023).

  Study EGAS00001007087

• Transcriptome human nasal epithelium

  1. Odors are detected, firstly, by olfactory sensory neurons (OSNs) in the olfactory epithelium of the nose. This neurons then project directly to the olfactory bulb in the brain. Olfaction depends on cellular regeneration of the OE, olfactory bulb and hippocampus, and on their continual re-wiring. The olfactory neural pathway includes regions of the frontal, temporal and limbic brain, which in turn overlap with brain areas involved in brain disorders. OSNs are the only aspect of the human brain exposed to the external environment. This not only makes them vulnerable to environmental changes, but also accessible for biomedical studies. We have already sequenced and developed a protocol for analyzing the transcriptome of mouse main olfactory epithelium and single OSNs. We propose here to perform a similar study for samples from the human olfactory epithelium. We have developed a minimally invasive method for obtaining human OSNs, among other cells from the nasal epithelium. In this experiment, we have obtained cell samples from the olfactory epithelium, including OSN, from healthy volunteers. We would like to further characterize them by RNA sequencing. This will give us valuable insight into human olfaction. It will also provide a first step into a new avenue to study, and find biomarkers for, brain diseases though the analysis of these easily available neurons. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Dataset EGAD00001002226

• Direct Comparative Analysis of 10X Genomics Chromium and Smart-seq2

  Single cell RNA sequencing (scRNA-seq) is widely used for profiling transcriptomes of individual cells. The droplet-based 10X Genomics Chromium (10X) approach and the plate-based Smart-seq2 full-length method are two frequently-used scRNA-seq platforms, yet there are only a few thorough and systematic comparisons of their advantages and limitations. Here, by directly comparing the scRNA-seq data by the two platforms from the same samples of CD45- cells, we systematically evaluated their features using a wide spectrum of analysis. Smart-seq2 detected more genes in a cell, especially low abundance transcripts as well as alternatively spliced transcripts, but captured higher proportion of mitochondrial genes. The composite of Smart-seq2 data also resembled bulk RNA-seq data better. For 10X-based data, we observed higher noise for mRNA in the low expression level. Despite the poly(A) enrichment, approximately 10-30% of all detected transcripts by both platforms were from non-coding genes, with lncRNA accounting for a higher proportion in 10X. 10X-based data displayed more severe dropout problem, especially for genes with lower expression levels. However, 10X-data can better detect rare cell types given its ability to cover a large number of cells. In addition, each platform detected different sets of differentially expressed genes between cell clusters, indicating the complementary nature of these technologies. Our comprehensive benchmark analysis offers the basis for selecting the optimal scRNA-seq strategy based on the objectives of each study.

  Dataset EGAD00001005448

• Smoking-dependent expression alterations in nasal epithelium reveal immune impairment linked to germline variation and lung cancer risk.

  Lung cancer is the leading cause of cancer-related death in the world. In contrast to many other cancers, a direct connection to lifestyle risk in the form of cigarette smoke has long been established. More than 50% of all smoking-related lung cancers occur in former smokers, often many years after smoking cessation. Despite extensive research, the molecular processes for persistent lung cancer risk are unclear. CT screening of current and former smokers has been shown to reduce lung cancer mortality by up to 26%. To examine whether clinical risk stratification can be improved upon by the addition of genetic data, and to explore the mechanisms of the persisting risk in former smokers, we have analyzed transcriptomic data from accessible airway tissues of 487 subjects. We developed a model to assess smoking associated gene expression changes and their reversibility after smoking is stopped, in both healthy subjects and clinic patients. We find persistent smoking associated immune alterations to be a hallmark of the clinic patients. Integrating previous GWAS data using a transcriptional network approach, we demonstrate that the same immune and interferon related pathways are strongly enriched for genes linked to known genetic risk factors, demonstrating a causal relationship between immune alteration and lung cancer risk. Finally, we used accessible airway transcriptomic data to derive a non-invasive lung cancer risk classifier. Our results provide initial evidence for germline-mediated personalised smoke injury response and risk in the general population, with potential implications for managing long-term lung cancer incidence and mortality.

  Dac EGAC50000000169

• Programmatic submission based on XML

  Programmatic submissions (XML based) For further information please check our Submission FAQs, submission quickguide as well as submission terms! Introduction Besides the Submitter Portal tool, EGA supports programmatic sequence and clinical data metadata submissions. If you are not sure what this means, you may want to explore our brief metadata introduction. Programmatic submissions are recommended for array-based submission. Moreove, it may be of help if your submission is recurrent or it is difficult to manage manually due to its sheer size. Otherwise, we highly recommend using the Submitter Portal to perform submissions. In this page we will guide you through the required steps to programmatically submit data to the EGA. Programmatic submissions require your metadata to be structured for an easy and straightforward validation and archival. It basically consists in formatting your metadata as Extensible markup language (XML) files and submitting them to the EGA using the WEBIN Before submitting metadata to the EGA, it is important to ensure that the information in your XML files is compliant with our standards. You can see further details on how these standards are maintained at EGA at our EGA Schemas documentation page. Using WEBIN, you can validate your XML files against EGA's schemas to ensure that your metadata is compliant before submission. WEBIN services WEBIN production service WEBIN test service We advise you to submit your metadata to the test service when submitting to the production service for the first time. The test service is identical to the production service except that all submissions will be discarded in the following 24 hours. This allows you to learn about the submission process without having to worry about data being submitted. Authentication Authentication is required each time a submission is made. The submission service uses HTTPS protocol for metadata encryption and identification to provide a secure submission environment. Data file upload Both Runs and Analyses reference files (e.g. FASTQ need to be uploaded to the EGA before these metadata objects are submitted. In other words, if you submit a Run that references a file that we cannot find associated with your account, the metadata submission will fail. See further details on how to upload your files in our File Upload documentation. Metadata model of the EGA Our metadata model is formed by multiple metadata objects. Check further details in our documentation at our EGA Schema documentation page. Working with EGA XMLs files Now that the basic concepts of the EGA metadata have been described, you can start preparing your programmatic submission through XML. Here you will find the guidance on how to prepare the XML files. Programmatic Submission Tutorial Video Take a look at the Programmatic Submission Tutorial Video, which explains the workflow of a programmatic submission and goes over an example metadata submission. Programmatic Submission Tutorial Video. When building your XML files, we recommend using text editors (e.g.Sublime Text or VisualStudio) that allow you to visualise the structure of the XML with ease. Furthermore, these editors constantly check the consistency of the XML structure. Alternatively, and if the submission consists of a big number of objects (specially analyses), you may find the tool star2xml handy. This tool allows for a direct conversion between metadata in a tabular format (e.g. a spreadsheet) into XMLs. Identifying objects: Aliases and center names Every EGA object must be uniquely identified within the submission account using their alias attribute. The aliases can be used in submissions to make references between EGA objects. Let us dig into EGA's use of aliases and center names: alias: every object should have a name that is unique within your submission account. Once submitted successfully, every alias will be assigned a unique and permanent accession (EGA ID). refname: when an object references another by its alias, the alias of the referenced object goes into the "refname" attribute of the referencing object. For example, if a sample has the alias "sample1", and an experiment uses this sample, then the experiment's "EXPERIMENT/SAMPLE/refname" attribute should be "sample1". center_name: The "center_name" attribute is required within the submission XML and, if not provided when the object is submitted, it will be automatically filled using your default EGA account center_name. This element is the "controlled vocabulary acronym or abbreviation that is provided to the account holder when the account is first generated". If the submitter is brokering a submission for another institute, the submitter should use their special broker account name in broker_name while the data centre acronym remains in center_name. Log-in details should have been provided when you requested a submission account. Please contact our Helpdesk team if you have any questions. run_center: Many submitting centers contract out the actual sample sequencing to another center. In these cases, the sequencing center should be acknowledged in the run_center attribute. Again, this is controlled vocabulary and the acronym should be sought from EGA helpdesk before submitting. Please contact our Helpdesk team if you have any questions. Prepare your XMLs The goal of this section is to provide sufficient information to be able to create the metadata XML documents required for programmatic submissions. Please note, the EGA utilises the XML schemas maintained at the European Nucleotide Archive (ENA). It is important due to the fact that by using a similar system, some pieces of documentation from the ENA's programmatic submission can also help you with your programmatic submission to the EGA. For example, you can submit programmatically without using a Submission XML by following the steps at Submission actions without submission XML. A submission does not have to contain all different types of XMLs. For example, it is possible to submit only a few samples; or a study that is later to be referenced. You can submit each object one by one, or submit all in a batch: you choose what method of submission works best for you. We do recommend, nevertheless, that you submit the objects to be referenced (e.g. samples or studies) first, and the objects that reference these (e.g. experiments or datasets) afterwards. You can see a graphical view of these objects and their relationships at our EGA Schemas page. Independently of the submission scenario, you will always require a Dataset XML. The entity of a dataset is what is used to control access to the given data, in the form of runs or analyses. In other words, when a requester is granted access, it is through the dataset and the objects (e.g. runs or analyses) that the dataset contains, granting access to them in one go. Given the nature of the EGA, a dataset XML will always be required for the data access. First, we will differentiate between submissions of "raw" and "processed" data: Runs and Analyses, respectively. Run data submissions Raw data derives from instruments "as is". For example, a plain sequence file (e.g. FASTQ or unaligned BAM files) would be considered raw data. A typical raw (unaligned) sequence read submission consists of 8 XMLs: Submission Study Sample Experiment Run DAC Policy Dataset When technical reads (e.g. barcodes, adaptors or linkers) are included in the submitted raw sequences, a spot descriptor must be submitted to describe the position of the technical reads so that they can be removed. The following data files can be submitted without providing spot descriptor information in the experiment/run XML: BAM files (single reads) SFF files (single reads without barcodes) FastQ files (single reads without any technical reads) Complete Genomics files Analysis data submissions Processed data is, in some way, refined raw data. This includes raw data that has been processed by some form of analysis method (e.g. alignment, noise reduction, etc.). For example, an aligned sequence (e.g. BAM file), that was created using raw FASTQ files, would be a processed file. This category includes most types of data: sequence alignment files (e.g. BAM or CRAM), clinical data (e.g. phenopackets), sequence variation files (e.g. VCF), sequence annotation, etc. A typical EGA analysis data submission consists of 7 EGA XML: Submission Study Sample Analysis DAC Policy Dataset We accept three different types of analysis data submissions: BAM files (for multiple read alignments) VCF files (for sequence variations) Phenotype files (in any format) In anycase, keep in mind that samples must be created in order to be referenced in the analyses. In other words, the provenance of the information within the BAM, VCF and phenotype files Example XMLs Below you can find a non-extensive list of example XMLs with descriptive fields (i.e. explaining what to provide in each field). Furthermore, you can also find real examples (i.e. the true value of the provided fields) in our GitHub repository. Submission XML The submission XML is used to validate, submit or update any number of other objects. The submission XML refers to other XMLs. New submissions use the ADD action to submit new objects. Object updates are done using the MODIFY action and objects can be validated using the VERIFY action. Descriptive submission XML example True values submission XML example Study XML The study XML is used to describe the study containing a title, a study type and abstract as it would appear in a publication. Descriptive study XML example True values study XML example Please use the following notation within the property "STUDY_LINKS" when including PubMed citations in the Study XML: <STUDY_LINKS> <STUDY_LINK> <XREF_LINK> <DB>PUBMED</DB> <ID>18987735</ID> </XREF_LINK> </STUDY_LINK> </STUDY_LINKS> Sample XML The sample XML is used to describe the samples used to obtain the data, whether they were sequenced, measured in any other way, or have an associated phenotype. The mandatory fields include information about the taxonomy of the sample, sex, subject ID and phenotype. For example, the mandatory attribute fields for each sample would look like these, within the array of "SAMPLE_ATTRIBUTES": <SAMPLE_ATTRIBUTES> <SAMPLE_ATTRIBUTE> <TAG>subject_id</TAG> <VALUE>free text!</VALUE> </SAMPLE_ATTRIBUTE> <SAMPLE_ATTRIBUTE> <TAG>sex</TAG> <VALUE>female/male/unknown</VALUE> </SAMPLE_ATTRIBUTE> <SAMPLE_ATTRIBUTE> <TAG>phenotype</TAG> <VALUE>Free text, EFO terms (e.g. EFO:0000574) are recommended</VALUE> </SAMPLE_ATTRIBUTE> </SAMPLE_ATTRIBUTES> Sample is one of the most important objects to be described biologically, it is highly recommended that “TAG-VALUE” pairs are generated as SAMPLE_ATTRIBUTES to describe the sample in as much detail as possible. For example, were we to give the population ancestry of the sample, we could add a new attribute to the array, in which, for example, we would indicate that the sample derives from an individual of "Mende in Sierra Leone" (MSL), with an african ancestry: <SAMPLE_ATTRIBUTE> <TAG>Population</TAG> <VALUE>MSL</VALUE> </SAMPLE_ATTRIBUTE> Given that VALUE and TAG are free text, the combinations are limitless in order to give you full flexibility on the information you want to provide. We recommend you use the Experimental Factor Ontology (EFO) to describe the phenotypes of your samples. You can provide more than one phenotype by adding more items to the array of SAMPLE_ATTRIBUTES. Phenotypes considered essential for understanding the data submission should be provided. Each phenotype described should be listed as a separate sample attribute <SAMPLE_ATTRIBUTE> </SAMPLE_ATTRIBUTE>. There is no limit to the number of phenotypes that can be submitted. If a suitable EFO accession cannot be found for your phenotype attribute, please consider using another controlled ontology database (e.g. HPO, MONDO, etc.) before using free text. Descriptive sample XML example True values sample XML example Experiment XML The experiment XML is used to describe the experimental setup, including instrument platform and model details, library preparation details, and any additional information required to correctly interpret the submitted data. Where any of these values differ between runs, a new experiment object must exist, since runs are grouped by experiments. Each experiment references a study and a sample by alias, or if previously-submitted, by accession. Pooled data must be demultiplexed by barcode for submission. Descriptive experiment ( Illumina paired read ) XML example True values experiment ( Illumina paired read ) XML example Run XML The run XML is used to associate data files with experiments and typically comprises a single data file (e.g. a FASTQ file). Please note that pooled samples should be de-multiplexed prior submission and submitted as different runs. Descriptive run XML example True values run XML example Analysis XML Given that an analysis can be used to submit any type of processed data to the EGA, we will list below an example of each of the three most common types of analysis XMLs submitted to the EGA: sequence alignments (e.g. BAM files); sequence variation (e.g. VCF files); and clinical metadata or phenotypes (e.g. phenopackets). Regardless of the type of processed data submitted in the analysis, the analysis must be associated with a Study and can reference multiple types of other objects, from samples to experiments, if they are available at the EGA. Just like with Runs, whenever a file is submitted to the EGA through an analysis object, the file MD5 checksums must be present, in order for the EGA to validate file integrity upon transfer. This also includes index files when applicable (e.g. .bai.md5 files). Ideally, any analysis that uses a reference sequence for some kind of alignment (e.g. BAM, CRAM or VCF files), would contain metadata about the alignment, such as INSDC reference assemblies and sequences, by either using accessions (e.g. CM000663.1) or common labels (e.g. GRCh37). Read alignment (BAM) Analysis XML The Analysis can be used to submit BAM alignments to EGA. Only one BAM file can be submitted in each analysis and the samples used within the BAM read groups must be associated with Samples. Descriptive bam alignments XML example True values bam alignments XML example Sequence variation (VCF) Analysis XML The Analysis can be used to submit VCF files to EGA. Only one VCF file can be submitted in each analysis and the samples used within the VCF files must be associated with Samples. Download analysis XML (VCF) Phenotype files The Analysis XML can be used to submit phenotype files to the EGA. Only one phenotype file can be submitted in each analysis and the samples used within the phenotype files must be associated with EGA Samples. Download analysis XML (Phenotype) DAC XML The DAC XML describes the Data Access Committee (DAC) affiliated to the data submission. The DAC may consist of a group or a single individual and is responsible for the data access decisions based on the application procedure described in the POLICY.XML. As with any other object, if it was already submitted to the EGA, there is no need to submit it again: you can reference an existing object within the EGA. Hence, A DAC XML does not need to be provided if your submission is affiliated to an existing EGA DAC.. Further information on DACs can be found here, and you can always contact our Helpdesk team if you have further inquiries. Descriptive dac XML example True values dac XML example Policy XML The Policy XML describes the Data Access Agreement (DAA) to be affiliated to the named Data Access Committee. Descriptive policy XML example True values study XML example Dataset XML The dataset XML describes the data files, defined by the Run.XML and Analysis.XML, that make up the dataset and links the collection of data files to a specified Policy. The dataset xml is commonly the last metadata object to be submitted, since it references multiple other entities. Please consider the number of datasets that your submission consists of. For example, a case-control study is likely to consist of at least two datasets. In addition, we suggest that multiple datasets should be described for studies using the same samples but different sequence technologies. Descriptive dataset XML example True values dataset XML example Validating and submitting your EGA Validating EGA's XMLs through Webin After you have ensured that the XMLs are properly formatted and contain all the required information. You can proceed to validate and submit your data. Use the curl command to validate your XML file: Once you have prepared your XML file and asserted you have access to Webin, you can validate your XML file programmatically against EGA's schemas using the curl command. There are multiple ways in which you can validate your XMLs. This variety has to do with the fact that: (1) there are 2 instances of Webin (test and production); and (2) that validation is a default step during submission. In other words, any time that you submit your data through Webin, it will be validated automatically before being accepted. This allows for 4 possible routes of validation, all having the same validation result: validating or submitting to either the production service or the test service of Webin. For example, directly validating a "study" object XML in the testing service (wwwdev…) would look like the following: curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" In this command, you would need to replace <USERNAME> and <PASSWORD> with your EGA account username and password, respectively. You would also replace <INPUT_FILE> with the path to your XML file. A mock example would look like the following: curl -u ega-test-data@ebi.ac.uk:egarocks -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" The validation attempt can have different results depending on the given arguments: If your XML file is valid according to EGA's schemas, you will see a message indicating that your XML file is compliant. For example, see below for our mock example, where the "success" was "true" (i.e. no validation errors found). Nevertheless, notice how the "<STUDY accession=" is empty: it is because we were simply validating, so the study did not get an accession or ID. <?xml version="1.0" encoding="UTF-8"?> <?xml-stylesheet type="text/xsl" href="receipt.xsl"?> <RECEIPT receiptDate="2023-04-11T15:19:28.850+01:00" submissionFile="submission-EBI-TEST_1681222768850.xml" success="true"> <STUDY accession="" alias="Mock example" status="PRIVATE"/> <SUBMISSION accession="" alias="SUBMISSION-11-04-2023-15:19:28:840"/> <MESSAGES> <INFO>VALIDATE action has been specified.</INFO> <INFO>Submission has been rolled back.</INFO> <INFO>This submission is a TEST submission and will be discarded within 24 hours</INFO> </MESSAGES> <ACTIONS>VALIDATE</ACTIONS> <ACTIONS>PROTECT</ACTIONS> If there are any errors or warnings, the tool will display them, allowing you to correct them before submitting your data to EGA. For example, in the following response, it is said that the object we were trying to submit was already existing, and therefore the "success" was "false". <?xml version="1.0" encoding="UTF-8"?> <?xml-stylesheet type="text/xsl" href="receipt.xsl"?> <RECEIPT receiptDate="2023-04-11T15:12:35.609+01:00" submissionFile="submission-EBI-TEST_1681222355609.xml" success="false"> <STUDY alias="Example!_Human Microbiome Project SP56J" status="PRIVATE" holdUntilDate="2023-03-11Z"/> <SUBMISSION alias="SUBMISSION-11-04-2023-15:12:35:576"/> <MESSAGES> <ERROR>In study, alias: "Example!_Human Microbiome Project SP56J". The object being added already exists in the submission account with accession: "ERP127584".</ERROR> <INFO>VALIDATE action has been specified.</INFO> <INFO>Submission has been rolled back.</INFO> <INFO>This submission is a TEST submission and will be discarded within 24 hours</INFO> </MESSAGES> <ACTIONS>VALIDATE</ACTIONS> <ACTIONS>PROTECT</ACTIONS> If the curl command retrieves no response at all, please double check if your username and password are correctly provided. Also notice the "ACTION=..." argument passed to the Curl command. This specifies the action to take during the call to Webin, so we do not need a "Submission" XML just for a validation attempt. See more at submission actions without submission XML. Furthermore, validation of multiple files or objects (e.g. sample, experiment, study…) can be done in a single command by adding more arguments (i.e. '-F'). For example: curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" -F "SAMPLE=@sample.xml" -F "DATASET=@dataset.xml" As mentioned above, beside "validate" action in the test environment, you can also validate your metadata by three other methods: "Validate" in the production server. From our example above, you simply need to take the "dev" away from the URL. curl -u <USERNAME>:<PASSWORD> -F "ACTION=VALIDATE" "https://www.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" "Add" in the development server. From our example above, you would simply need to replace the action: from "validate" to "add". Whatever is submitted to this service will be discarded in 24h, so whether something gets submitted or not would not matter in the long run. curl -u <USERNAME>:<PASSWORD> -F "ACTION=ADD" "https://wwwdev.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" "Add" in the productionserver. A combination of the previous two methods, which would render this attempt into a submission. This path is just to be taken when you are sure your metadata is compliant and what you want to submit. curl -u <USERNAME>:<PASSWORD> -F "ACTION=ADD" "https://www.ebi.ac.uk/ena/submit/drop-box/submit/" -F "STUDY=@study.xml" What happens after the submission of a dataset XML? Once you have completed the registration of your dataset/s please contact our Helpdesk Team to provide a release date for your study. Please note that all datasets affiliated to unreleased studies are automatically placed on hold until the authorised submitter or DAC contact contact the EGA Helpdesk for the study to be released. We strongly advise you not to delete your data until EGA Helpdesk confirms that your data has been successfully archived.

  Documentation submission/metadata/submission/programmatic-submission-xml

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• GEDI: A Developmental Model of Gene-Environment Interplay in SUDs: Combined Genotype Dataset from the "Great Smoky Mountains Study" and the "Caring for Children in the Community Study".

  1. Great Smoky Mountains Study (GSMS; Costello et al. 1996, 1997) Three cohorts of boys and girls, aged 9, 11, and 13 years at intake in 1993, were selected from a rural population of some 20,000 children using a household equal probability design. A two-phase procedure was used for White and African-American youth to increase power by oversampling children at risk for psychiatric and SUDs. Parents (usually mothers) of the first stage random population sample completed a questionnaire about their child&#39;s behavioral problems. Of 4,195 subjects selected, 95% (N=3,896) of parents completed the screen. All children scoring above a predetermined threshold (the top 25% of the total scores), plus a 10% random sample of the remaining 75%, were recruited for detailed interviews. Results can be back-weighted to population levels for analyses. Half of the sample consists of females, and 6% are African Americans, reflecting the population of the study area. The interviewed sample of white and African-American subjects was 1,070 (80% of those recruited). American Indian youth were oversampled (100%) because they are an understudied group known to be at high risk for stressful events, substance disorders, and mood disorders. Of 431 age-eligible children, 350 (81% boys, 49% girls) participated. Thus, the size of total GSMS sample is 1,070 + 350 = 1,420. Data collection is complete for ages 9-26, and age 30 interviews are in progress. By age 26 a total of 9,858 interviews had been completed; the average number of interviews per subject was seven, and by age 26, 97.3% completed two or more interviews. 2. The Caring for Children in the Community Study (CCC; Angold et al., 2002) This representative study of psychiatric illness and service use in African-American and White youth took place in four rural counties in the southeastern USA. The two-stage sampling design and methods are similar to those used in the GSMS. Of 4,500 youth randomly selected from the 17,117 9- to 17-year-olds in the public school&#39;s database, 3,613 (80.0%) were successfully contacted and agreed to complete the behavioral screen. Of the 1,302 selected to participate in the study, 920 (70.7%) interviews were completed. Because CCC was also the only study in GEDI to contain more than a very few African-American participants, these were omitted from the multi-site analyses. Reprinted with permission from Cambridge University Press from Costello et al., 2013: PMID: 23461817 References: Costello et al., 1996: PMID: 8956679 Costello et al., 1997: PMID: 9184514 Angold et al., 2002: PMID: 12365876

  Study phs000852

• Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response

  The study 'Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response' reports the genomic characterization at the single allele level upon Whole Exome Sequencing of Bladder Cancer (BLCa) Patient Tumor (PT) samples obtained from 18 patients and corresponding Patient Derived Organoids (PDOs), implementing the SPICE pipeline (Ciani Y et al). Our cohort included 21 PTs and 22 PDOs. In this study, we generated a unique biobank resource of BLCa organoids that encompasses a broad spectrum of disease stages. We demonstrated that PDOs retain cancer heterogeneity and mutational burden. Furthermore, we observed that BLCa PDO can have different morphologies which may reflect tumor-specific features. Indeed, a solid morphology may be associated with more advanced tumors, as supported by the high PDO genomic burden and high primary tumor stage. Moreover, with our drug screening pipeline, we demonstrated the clinical relevance and feasibility of using a BLCa PDO-based drug assay for comparing the standard of care (SOC) drugs with compounds not currently in use for BLCa. Response to SOC was highly heterogeneous with approximately 50% of non-muscle invasive bladder cancer and 33% of muscle invasive bladder cancer PDOs showing no or minimal response. The most effective targeted therapy was lapatinib. We used an integrative analysis of drug response profiles with matched PDO genomic analysis to determine enrichment thresholds for candidate markers of therapy resistance and sensitivity. Importantly, by assessing the clinical history of longitudinally sampled cases, the clonal evolution of the disease could be determined and matched with PDO drug response profiles.

  Study phs003149

• Genomic Studies of Bipolar Disorder in a Large Cohort from The Netherlands

  The transcriptomes of whole blood samples of a large cohort of individuals from the Netherlands were assayed using RNA-seq. These whole blood samples included patients diagnosed with schizophrenia or bipolar disorder, family members of patients, and healthy controls. Within the whole blood dataset, about 600 of the samples were sequenced to an average of 13.9 million mapped reads per sample, while about 2,000 were sequenced to an average of 5.9 million mapped reads per sample, in order to assess changes in power to detect eQTLs based on sample size. We find that expression, defined as the log transcripts per million reads (TPMs), is highly correlated when comparing the moderate (13.9M) and lower (5.9M) coverage datasets.&nbsp;Additionally, a subset of about 150 individuals provided fibroblast cell lines which were assessed for the levels of gene expression using RNA-seq at an average of 50 million mapped reads per sample. We use downsampling techniques to generate synthetic datasets derived from this real fibroblast RNA-Seq data to explore the relationship between coverage and number individuals in an eQTL analysis.&nbsp;Corresponding individual-level genotypes for the samples included in the expression matrix are also made available. The genotypes were derived from multiple other project cohorts, each using different genotyping platforms including OmniExpress Exome, Global Screening Array, Illumina550, and PsychChip. A Plink file set of these cohorts is provided here after merging the separate project file sets and extracting only the individuals who have expression data also provided here; quality control for SNP-missingness is recommended.&nbsp;We demonstrate in this study that given a fixed budget, eQTL discovery power can be increased by lowering the sequencing depth per sample to allow for an a greater number of individuals sequenced.&nbsp;

  Study phs002856

• The Human Phenotype Project (HPP) is a large-scale deep-phenotype prospective longitudinal and ethnically diverse cohort

  The Human Phenotype Project (HPP) is a large-scale deep-phenotype prospective longitudinal and ethnically diverse cohort and biobank that we established. To date, approximately 28,000 participants have enrolled in the study, with over 13,000 having completed their initial visit. The project is aimed at identifying novel molecular signatures with diagnostic, prognostic and therapeutic value, and at developing AI-based predictive models for disease onset and progression. A unique feature of the HPP is its deep and longitudinal profiling that includes medical history, lifestyle and nutritional habits, vital signs, anthropometrics, blood tests, continuous glucose and sleep monitoring, imaging modalities and molecular profiling of the transcriptome, genetics, gut, vaginal and oral microbiome, metabolome and immune system. For several of these modalities, the HPP is the first or largest cohort of its kind. Our analyses of this data provide novel insights into the variation of phenotypes with age and ethnicity, highlighting the importance of having ethnically diverse cohorts and the need for establishing age-dependent norms. We demonstrate how the HPP can be used to unravel personalized molecular signatures of disease by comparison to patient-specific and disease-specific matched healthy controls. Leveraging the extensive dietary and lifestyle HPP data, we systematically identify associations between lifestyle factors and health outcomes. Finally, we present a multi-modal foundation AI model that is trained using self-supervised learning on diet and CGM data and outperforms existing methods in predicting future onset of disease. We extend this AI framework to integrate all data modalities of each subject as a continuous sequence of diverse medical events, creating a digital twin that can simulate interventions and predict health trajectories and outcomes.

  Study EGAS00001008040

• Whole genome sequencing of a breast cancer cohort with known functional homologous recombination status

  Optimal patient selection for PARP inhibitors and double strand break (DSB) inducing chemotherapy is of great clinical importance. In principle, the use of these therapies can be extended beyond germline BRCA1/2 mutated cancers. Although several methods for detection of BRCA-like tumors have been developed, a golden standard is lacking. We have developed the RECAP test, a functional HR assay exploiting the formation of RAD51 foci in proliferating cells after ex vivo irradiation of fresh primary breast cancer (BrC) tissue. The RECAP test seems robust and has an advantage over genetic tests, due to its functional character for exploring the HR phenotype. Another type of HRD test is the BRCAness classifier, which is based on specific genomic patterns derived from copy number data of BRCA1/2 mutated BrCs that also occur in sporadic cancers. The BRCAness classifier is a robust test that is easily applicable in the clinic and has also been validated to predict in vivo response to high dose chemotherapy in clinical trials. More recently, a new HRD test based on genomic signatures which can be extracted from whole genome sequencing has been published, HRDetect. Studies comparing these different HRD tests within the same cohort of patients do not yet exist. Here, we have the unique opportunity to compare three HRD tests within the same cohort. We aim to compare three different HRD tests (RECAP, BRCAness classifier and HRDetect) within the same cohort of primary BrCs (n=41). As a secondary aim, we will analyze additional genetic alterations in HRD tumors (both BRCA-deficient and BRCA-proficient HRD tumors).

  Study EGAS00001005572

• A transcriptomic approach to understand patient susceptibility to pneumonia after abdominal surgery

  Rationale Nosocomial infections are a major healthcare challenge, developing in over 20% of patients aged 45 or over undergoing major-abdominal surgery, with postoperative pneumonia associated with an almost five-fold increase in 30-day mortality. Objectives To describe immune-pathways and gene-networks altered following major-abdominal surgery and identify transcriptomic patterns associated with postoperative pneumonia. Methods and Measurements From a prospective consecutive cohort (n=150) undergoing major-abdominal surgery whole-blood RNA was collected preoperatively and at three time-points postoperatively (2-6, 24 and 48hrs). Twelve patients diagnosed with postoperative pneumonia and 27 matched patients remaining infection-free were identified for analysis with RNA-sequencing. Main Results Compared to preoperative sampling, 3,639 genes were upregulated and 5,043 downregulated at 2-6hrs. Pathway-analysis demonstrated innate-immune activation with neutrophil-degranulation and Toll-like-receptor signalling upregulation alongside adaptive-immune suppression. Cell-type deconvolution of preoperative RNA-sequencing revealed elevated S100A8/9-high neutrophils alongside reduced naïve CD4 T-cells in those later developing pneumonia. Preoperatively, a gene-signature characteristic of neutrophil-degranulation was associated with postoperative pneumonia acquisition (P=0.00092). A previously reported Sepsis Response Signature (SRSq) score, reflecting neutrophil-dysfunction and a more dysregulated host response, at 48hrs postoperatively, differed between patients subsequently developing pneumonia and those remaining infection-free (P=0.045). Analysis of the novel neutrophil gene-signature and SRSq scores in independent major-abdominal surgery and polytrauma cohorts indicated good predictive performance in identifying patients suffering later infection. Conclusions Major-abdominal surgery acutely upregulates innate-immune pathways while simultaneously suppressing adaptive-immune pathways. This is more prominent in patients developing postoperative pneumonia. Preoperative transcriptomic signatures characteristic of neutrophil-degranulation and postoperative SRSq scores may be useful predictors of subsequent pneumonia risk.

  Study EGAS00001007229

• A catalog of the genetic causes of Hereditary Angioedema in the Canary Islands (Spain)

  Hereditary angioedema (HAE) is a rare disease where known causes involve C1 inhibitor dysfunction or dysregulation of the kinin cascade. The updated HAE management guidelines recommend performing genetic tests to reach a precise diagnosis. Unfortunately, genetic tests are still uncommon in the diagnosis routine. Here, we characterized for the first time the genetic causes of HAE in affected families from the Canary Islands (Spain). Whole-exome sequencing data was obtained from 41 affected patients and unaffected relatives from 29 unrelated families identified in the archipelago. The Hereditary Angioedema Database Annotation (HADA) tool was used for pathogenicity classification and causal variant prioritization among the genes known to cause HAE. Manual reclassification of prioritized variants was used in those families lacking known causal variants. We detected a total of eight different variants causing HAE in this patient series, affecting essentially SERPING1 and F12 genes, one of them being a novel SERPING1 variant (c.686-12A&amp;gt;G) with a predicted splicing effect which was reclassified as likely pathogenic in one family. Altogether, the diagnostic yield by assessing previously reported causal genes and considering variant reclassifications according to the American College of Medical Genetics guidelines reached 66.7% (95% Confidence Interval [CI]: 30.1-91.0) in families with more than one affected member and 10.0% (95% CI: 1.8-33.1) among cases without family information for the disease. Despite the genetic causes of many patients remain to be identified, our results reinforce the need of genetic tests as first-tier diagnostic tool in this disease, as recommended by the international WAO/EAACI guidelines for the management of HAE.

  Study EGAS00001006547

• Long-Term Oxygen Treatment Trial (LOTT-BioLINCC)

  Data Access NOTE: Please refer to the &#8220;Authorized Access&#8221; section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives: To evaluate the efficacy of long-term treatment with supplemental oxygen in people with stable chronic obstructive pulmonary disease (COPD) and resting or exercise-induced moderate desaturation. Background: COPD is the fourth leading cause of death in the United States, with more than twelve million people currently diagnosed with the disease. In 2011, Medicare reimbursements for oxygen-related costs for people with COPD exceeded two billion dollars. The quality of life of a person with COPD decreases as the disease progresses, making treating and managing COPD in the moderate stages important. The benefits of oxygen supplementation were studied in the 1970s, but these benefits were specific to people with COPD who have severe resting hypoxemia. The LOTT trial was designed to address the effectiveness of supplemental oxygen therapy in treating people with COPD who have moderately low blood oxygen levels at rest or who have normal blood oxygen levels at rest, but have low or very low blood oxygen levels during exercise. Participants: There were a total of 1759 people screened for eligibility for the LOTT trial. Of the 1759 screened, 738 people with COPD were selected for randomization with 368 randomly assigned to the supplemental-oxygen group and 370 to the no-supplemental-oxygen group. Of the 738 people with COPD who underwent randomization, 133 (18%) had resting desaturation only, 319 (43%) had exercise-induced desaturation only, and 286 (39%) had both types of desaturation. Furthermore, in the supplemental-oxygen group, 220 people were prescribed 24-hour oxygen and 148 were prescribed oxygen during exercise and sleep only. Design: The LOTT trial was originally designed to test whether the use of supplemental oxygen would result in a longer time to death for people with COPD and moderate resting desaturation. After seven months, the trial design was judged to be infeasible; therefore, the trial was redesigned to include people with exercise-induced desaturation with a primary composite outcome of death or first hospitalization for any cause, whichever occurs first. Other outcomes measured included: death, health care utilization, COPD exacerbation, quality of life measurements, anxiety, depression, and measures of functional status. Potential participants were screened using questionnaires, a breathing test, a brief physical exam, a blood draw, and measurements of resting and walking blood oxygen levels. Based on those results, eligible participants returned for a second screening visit for further evaluations. At the end of the second visit, eligible participants were assigned randomly to supplemental oxygen therapy or no oxygen therapy. Participants assigned to supplemental oxygen therapy received stationary and/or portable oxygen systems. Participants were required to return for a one hour visit to determine how much oxygen to use while walking and to learn how to use the equipment. Participants who had low blood oxygen levels during rest were instructed to use supplemental oxygen 24 hours per day. Participants with normal resting blood oxygen levels, but low or very low blood oxygen levels during exercise were instructed to use it during physical activity and sleep. Throughout the treatment period, participants were asked to keep records of the number of oxygen tanks emptied or pounds of oxygen delivered, meter readings, and changes in equipment. Study officials contacted participants weekly for the first month, monthly for the next five months, and then every two months until the Year 1 study visit. Participants assigned to receive no oxygen treatment were contacted one week after assignment for a check-up. All participants returned for study visits once a year for up to seven years. At each of these visits, participants completed some of the same tests and questionnaires from the screening visit. Participants underwent a blood draw during the one year study visit. Participants in both treatment groups received two phone calls each year to check on status and use of oxygen. In addition, participants in both groups were asked to complete a quality of life questionnaire by mail at four months and sixteen months. Medicare claims were collected for the duration of each participant's enrollment in the study. Conclusions: In participants with stable COPD and resting or exercise-induced moderate desaturation, the prescription of long-term supplemental oxygen did not result in a longer time to death or first hospitalization than no long-term supplemental oxygen, nor did it provide sustained benefit with regard to any of the other measured outcomes. Long-Term Oxygen Treatment Trial Research Group, Albert RK, Au DH, Blackford AL, Casaburi R, Cooper JA Jr, Criner GJ, Diaz P, Fuhlbrigge AL, Gay SE, Kanner RE, MacIntyre N, Martinez FJ, Panos RJ, Piantadosi S, Sciurba F, Shade D, Stibolt T, Stoller JK, Wise R, Yusen RD, Tonascia J, Sternberg AL, Bailey W. A Randomized Trial of Long-Term Oxygen for COPD with Moderate Desaturation. N Engl J Med. 2016 Oct 27;375(17):1617-1627.

  Study phs003933

• Transcriptome of Chronic Pain and Disease

  The Functional Genomics Section (FGS) is a part of the National Institute of Dental and Craniofacial Research (NIDCR) within the National Institutes of Health (NIH). Research at the FGS focuses on understanding the mechanics involved in nociception through both clinical samples from patients with chronic pain and mouse models of pain. Pain is relayed from the periphery to the central nervous system through specialized sensory neurons known as nociceptors. The cell body of nociceptors resides in neuronal structures that branch off of the spinal cord known as dorsal root ganglia (DRG). The DRG is a heterogenous tissue containing not only sensory neurons like nociceptors, but also glial cells, capillaries, fibroblasts, and resident macrophages. The interaction between the nociceptors and these DRG cell types can have a significant role in affecting neuronal hyperexcitability and downstream pain sensitivity. To better understand the cellular factors involved in producing conditions of chronic pain, DRGs from consenting organ donors were collected from individuals experiencing pain disorders such as painful diabetic neuropathy and rheumatoid arthritis. A multi-omics approach is being used to identify molecular mechanisms that lead to pain hypersensitivity in patients with chronic pain.&nbsp;&nbsp;

  Study phs002548

• Whole Exome Sequencing in Alopecia Areata Identifies Rare Mutations in KRT82

  Alopecia areata (AA) is an autoimmune disorder, in which the body's own immune cells attack hair follicels resulting in hair loss. It is a complex genetic disease with 14 associated loci previously identified in our genome-wide association study (GWAS). In the study, we performed the whole-exome sequencing (WES) on 849 AA patients with the aim to identify the novel rare variants in genes contributing to AA susceptibility. We performed gene-collapsing analyses and identified keratin 82 (KRT82 Gene ID: 3888) as the highest associated AA gene in the three rare damaging collapsing models with p&lt;6.7E-07 in one of the models. The KRT82 gene is a hair-specific type II keratin expressed in the hair shaft cuticle during the anagen phase of the hair cycle. We reported the lower expression of KRT82 in AA hair follicles, compared to controls, and the KRT82 expression is absent from the bulb region, the site of AA immune attack. This study emphasizes the significance of using WES and gene collapsing analyses to identify rare variation in a functionally relevant risk gene using a moderate sample size.&nbsp;&nbsp;

  Study phs002632

• Whole Genome Sequencing in the Inner City Asthma Consortium (ICAC) Cohorts

  We performed whole-genome sequencing on individuals from the Asthma Phenotypes in the Inner City (APIC) and Urban Environment and Childhood Asthma (URECA) study cohorts, which consist of children with asthma who live in low-income neighborhoods across 10 U.S. cities. APIC was a one-year, prospective, observational study of children ages 6-17 with asthma. URECA was a prospective, observational study featuring a birth cohort of children with a high risk of developing asthma based on family history. We performed whole-genome sequencing on 1,035 individuals (ages 5-17 yrs; 67% Black, 25% Hispanic; 66% with MD-diagnosed asthma; APIC=508, URECA=527). Sequence read processing, quality control, and variant calling were performed using the Genome Analysis Toolkit suite (GATK v4). Variant call sites were annotated according to the filters applied in our common variant (minor allele frequency &#8805; 1%) association studies, based on predicted false positive rates, genotype quality and depth, and population-adjusted Hardy-Weinberg equilibrium. Principal components of ancestry were calculated using high quality, linkage-disequilibrium-pruned single-nucleotide variants, accounting for subject relatedness, using PC-Air and PC-Relate.

  Study phs002921

• Whole Genome Association Study of Systemic Lupus Erythematosus

  The goal of this collaborative study was to identify new genetic risk factors for Systemic Lupus Erythematosus (SLE). To do this we conducted a genome-wide scan by combining the resources and expertise from a number of SLE researchers to establish a large sample set comprising 1311 SLE cases and 3340 controls. The SLE case samples were genotyped from the following collections: 338 subjects from the Autoimmune Biomarkers Collaborative Network (ABCoN), an NIH/NIAMS funded repository, 141 subjects from the Multiple Autoimmune Disease Genetics Consortium (MADGC), 613 subjects from the University of California San Francisco (UCSF) Lupus Genetics, and 335 subjects from the University of Pittsburgh Medical Center (UPMC), plus 8 samples collected at The Feinstein Institute for Medical Research. A total of 3583 control samples were examined in the association analyses. As part of this project, 1861 control samples were selected and then genotyped from the New York Cancer Project (NYCP), based on self-described ethnicity, gender and age. In addition, genotype data from 1722 control samples (all self-described North Americans of European descent) were obtained from the publicly available iControlDB database (http://www.illumina.com/pages.ilmn?ID=231).

  Study phs000122

• Genetic Epidemiology of Ovarian Cancer Histotypes

  Epithelial ovarian cancer is a highly fatal malignancy with known genetic etiology; however, it is estimated that a substantial portion of narrow sense heritability remains to be discovered. The goal of this research was to use genetic information from distantly related ovarian cancer cases to identify regions of the genome that may harbor rare risk variants for epithelial ovarian cancer. The study was conducted in the setting of the Utah Population Database, a statewide data resource in which extensive ancestry data are linked to Utah Cancer Registry records. Focusing on families with a statistically significant excess risk of epithelial ovarian cancer, we used the Infinium Global Screening Array v.3.0 to generate germline genotyping data for distantly related cases. We then applied Shared Genomic Segment Analysis to each set of related cases to identify genomic regions that may harbor ovarian cancer risk variants. Eleven regions were identified. Genotype data are available through dbGaP for one case from each pedigree. Genotype data from other ovarian cancer cases within the high-risk pedigrees as well as the pedigrees' corresponding structures can be requested and made available with approval from the Utah Resource for Genetic and Epidemiologic Research (RGE).

  Study phs003140

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Molecular Determinants of Esophageal Cancer in Tanzania

  We describe the genomic profiles of 61 esophageal squamous cell carcinoma (ESCC) cases from Tanzania and compare them to profiles from an existing cohort of ESCC cases from Malawi. We also provide a comparison to ESCC tumors in The Cancer Genome Atlas Program (TCGA). Despite a high burden of ESCC in Eastern Africa, investigations into the genomics in this region are nascent. This represents the largest comprehensive genomic analysis of ESCC from sub-Saharan Africa to date. We observed substantial transcriptional overlap with other squamous histologies via comparison with TCGA PanCan dataset. DNA analysis revealed known mutational patterns, both genome-wide as well as in genes known to be commonly mutated in ESCC. TP53 mutations were the most common somatic mutation in tumors from both Tanzania and Malawi but were detected at lower frequencies than previously reported in ESCC cases from other settings. In a combined analysis, two unique transcriptional clusters were identified: a proliferative/epithelial cluster and an invasive/migrative/mesenchymal cluster. Mutational signature analysis of the Tanzanian cohort revealed common signatures associated with aging and cytidine deaminase activity and an absence of signature 29, which was previously reported in the Malawi cohort.

  Study phs003217

• Whole-Exome Sequencing Study of Diabetic Nephropathy

  To identify rare variants of diabetic kidney disease (DKD), we conducted a whole-exome sequencing (WES) study. This study employed an extreme case&#8211;control design, which included a selection of the 593 most rapidly progressing DKD cases from the Chronic Renal Insufficiency Cohort (CRIC) Study (phs000524). In this two-stage WES study of DKD, participants with DKD from the CRIC were compared with control groups of participants without DKD from another cohort in the first stage. Suggestive signals identified in the first stage were confirmed in the second stage analysis among a diverse population with existing whole-genome sequencing (WGS) data. Generalized linear mixed models, which accounted for genetic relatedness and adjusted for age, sex and ancestry, were used to test associations between single variants and DKD. Gene-based aggregate rare variant analyses were conducted using an optimized sequence kernel association test implemented within our mixed model framework. As a result, we identified four novel gene loci, DIS3L2, KRT6B, ERAP2 and NPEPPS, that achieved exome-wide significance and may play an important role in the DKD disease course. This large WES study provides novel insights into DKD's molecular mechanisms.

  Study phs003429

• Immunogenetics of BCG Vaccination and Pediatric Tuberculosis

  We examined genetic variation associated with BCG-induced innate immune responses and susceptibility to pediatric tuberculosis (TB) disease. South African study participants were enrolled at the South African Tuberculosis Vaccine Initiative (SATVI) as part of a larger BCG vaccination study. This area has one of the highest rates of TB incidence in the world. Infants were vaccinated with BCG at birth, and a nested case-control study was performed over a 2-year prospective observation period, which resulted in 135 infant TB cases and 521 controls. Whole blood was collected from BCG vaccinated infants at 10 weeks of age. Genotyping was performed with the llumina MegaEx Beadchip, and GWAS was performed against TB disease to assess for associations between genetic variants and susceptibility to TB. In addition, a subset of infants were assessed for BCG-induced innate immune responses (N=198). For these, whole blood was stimulated with BCG or media and flow cytometry was used to measure BCG-induced PDL1, CD40, and cytokine expression in myeloid (mDC) and plasmacytoid (pDC) dendritic cells, monocytes, and neutrophils. Cellular GWAS was then performed to associate genetic variants with BCG-induced immune responses.

  Study phs003406

• Development of cell lines and mouse models of bone and soft tissue sarcoma to establish novel treatment

  Malignant giant-cell tumors are extremely rare bone sarcomas that transform from conventional giant-cell tumors during long periods of treatment. We have applied the culture methods and succeeded in establishing patient-derived organoids (PDO) of rare sarcomas. This study aimed to investigate the genomic characteristics of our established novel organoids from human malignant giant-cell tumors. The developed tumors with xenograft were genomically analyzed to compare their characteristics with those of the original tumors. Genetic changes over time throughout treatment were analyzed, and the genomic status of the established organoid was confirmed. Next generation sequencing revealed that the established organoids lacked the H3-3A G34W mutation. The xenografted organoids of the malignant giant-cell tumor had phenotypes genetically similar to those of the original tumor. The established organoids were confirmed to be derived from human malignant giant-cell tumors. In summary, the present study demonstrated a novel organoid model of a malignant giant-cell tumor that was genetically confirmed to be a malignant transformed tumor. Our organoid model could be used to elucidate the molecular pathogenesis of a malignant giant-cell tumor and develop novel treatment modalities.

  Study JGAS000618

• High-coverage whole-genome sequencing reveals structural variations in triple-negative breast cancer

  Triple-negative breast cancer (TNBC) cells do not express estrogen receptors, progesterone receptors or human epidermal growth factor receptor 2 (HER2). Currently, apart from poly ADP-ribose polymerase (PARP) inhibitors, there are few effective therapeutic options for this cancer type. Here, we present a comprehensive characterization of genetic alterations in TNBC via high-coverage whole-genome sequencing along with transcriptomic and whole-exome sequencing. Silencing of BRCA1 gene impaired the homologous recombination (HR) pathway in a subset of TNBC, which exhibited similar phenotypes with tumors with BRCA1 mutations; they harbored many structural variations (SVs) with relative enrichment for tandem duplication. Clonal analysis suggested that TP53 mutations and methylation of CpG dinucleotides in the BRCA1 promoter were the early events of carcinogenesis. SVs were associated with driver oncogenic events such as amplification of MYC, NOTCH2 or NOTCH3 and impacted tumor suppressor genes including RB1, PTEN and KMT2C. We also identified a variety of oncogenes that could transform 3T3 mouse fibroblast cells, suggesting that individual TNBC tumors may undergo a unique driver event that can be targetable. Thus, we revealed several features of TNBC that had important clinical implications.

  Study JGAS000095

• Single cell atlas of large B-cell lymphoma

  Large B-cell lymphomas (LBCL) are clinically and biologically heterogeneous lymphoid malignancies, shaped by complex tumor and microenvironments that play a critical role in disease progression. There has been no direct and comprehensive single-cell characterization of tumor microenvironment in LBCL that simultaneously captures lymphoid, myeloid, and stromal populations across a sufficiently large cohort to reveal reproducible and biologically meaningful patterns. Here, we performed single-nucleus multiome profiling, coupled with bulk DNA and RNA sequencing, on 232 tumor and control biopsies to comprehensively map cell subpopulations of LBCL. Through this integrative approach, we identified Lymphoma Microenvironment Archetype Profiles (LymphoMAPs)—distinct, reproducible patterns defined by the co-occurrence of functionally specialized cell subsets. We further characterized the cell-cell communication pathways that shape these transcriptional phenotypes within archetypes. Importantly, we discovered associations between specific LymphoMAPs and clinical and molecular features of LBCL, including response to CD19 CAR T-cell therapy. Our study provides a valuable resource of lymphoid, myeloid, and non-hematopoietic cell states in LBCL and offers a framework for understanding how the abundance and functional state of cells within the tumor microenvironment may drive inter-patient variability in therapeutic outcome.

  Study EGAS50000001022

• Novel regional age-associated DNA methylation changes within human common disease-associated loci

  Background: Advancing age progressively impacts on risk and severity of chronic disease. It also modifies the epigenome, with changes in DNA methylation, due to both random drift and variation within specific functional loci. Results: In a discovery set of 2,238 peripheral-blood genome-wide DNA methylomes (MeDIP-seq) aged 19-82 years, we identified 71 age-associated Differentially Methylated Regions (a-DMRs, p &lt; 1.85 x 10-8) within the Linkage Disequilibrium (LD) blocks of the NIH Catalogue of published GWAS SNPs. This included 52 novel regions, 29 within loci not covered by 450k or 27k Illumina array, and with marked enrichment for Poised Promoters and Enhancers across multiple cell types. In a replication set of 2,084 DNA methylomes, 95.7% of the a-DMRs showed the same direction of ageing effect, with 80.3% and 53.3% replicated to p &lt; 0.05 and p &lt; 1.85 x 10-8, respectively. Conclusion: By analysing the functionally enriched disease and trait-associated regions of the human genome, we identified novel epigenetic ageing changes, which could be useful biomarkers or provide mechanistic insights into age-related common diseases.

  Study EGAS00001001910

• Whole-genome methylation profiling of menstrual stem cells identifies novel biomarkers for endometriosis

  Endometriosis is a highly prevalent condition that remains underdiagnosed and poorly managed due to the lack of clinically validated biomarkers and limited understanding of its underlying pathophysiology. Although menstrual blood–derived stem cells (MenSCs) have been implicated in disease pathogenesis, their potential as a diagnostic source has not been systematically explored. We conducted a clinical study including 42 women (19 with endometriosis and 23 controls) to evaluate whether DNA methylation profiles from freshly isolated MenSCs could identify disease-specific biomarkers. Whole-genome DNA methylation sequencing identified differentially methylated regions (DMRs) enriched in genes associated with key features of endometriosis, including inflammation, tissue remodelling, and developmental processes. These DMRs robustly discriminated cases from controls, independently of technical and clinical confounders. Machine learning models trained and validated on these regions demonstrated strong diagnostic performance (specificity 83%, sensitivity 79%). Integration with an independent single-cell RNA sequencing dataset suggested that the identified DMRs may influence gene expression, supporting their biological relevance. Collectively, these findings highlight MenSC DNA methylation profiling as a promising, non-invasive strategy for early diagnosis and personalised management of endometriosis. (PubMed IDs will be provided once the manuscript is published.)

  Study EGAS50000001640

• Pediatric Whole Genome Sequencing Diagnostic Utility

  The standard of care for first-tier clinical investigation of the etiology of congenital malformations and neurodevelopmental disorders is chromosome microarray analysis (CMA) for copy number variations (CNVs), often followed by gene(s)-specific sequencing searching for smaller insertion-deletions (indels) and single nucleotide variant (SNV) mutations. We compared diagnostic rate of WGS to CMA and targeted gene testing of 100 patients referred to The Hospital for Sick Children Genetics clinic in 2014. WGS identified genetic variants meeting clinical diagnostic criteria in 34% of cases, representing a 4-fold increase in diagnostic rate over CMA (8%) (p-value = 1.42e-05) alone and &gt;2-fold increase in CMA plus targeted gene sequencing (13%) (p-value = 0.0009). WGS identified all rare clinically significant CNVs that were detected by CMA. In an additional 26 patients, WGS revealed indel and missense mutations presenting in a dominant (63%) or a recessive (37%) manner. We found four subjects with mutations in at least two genes associated with distinct genetic disorders, including two cases harboring a pathogenic CNV and SNV. When considering medically actionable secondary findings in addition to primary WGS findings, 38% of patients would benefit from genetic counselling.

  Study EGAS00001001623

• Distinct portrayal of lesions in synchronous multifocal lung adenocarcinoma revealed by genome sequencing

  Distinguishing multiple primary lung cancers in the synchronous multifocal intrapulmonary lesions has important significance on clinical staging and therapeutic decision. To investigate genomic aberration profiles, we applied whole genome and whole exome sequencing, and microarray-based comparative genomic hybridization on 15 intrapulmonary tumors derived from six patients with synchronous multifocal lung cancers having similar histological diagnosis. Any pair of intrapulmonary tumors in a single patient, which shared the identical genetic background and environment, showed an extinctive heterogeneity between each other. Phylogenetic relationship analysis indicated an independently branched evolution among all the tumors, suggesting they were multiple primary lung cancers. EGFR or KRAS mutations were found in 7 or 3 out of the 15 tumors, from 3 or 2 patients, respectively. Somatic mutational heterogeneity of these two genes in a single patient was also observed. Our analysis indicates genomic aberration profiling is valuable for identification of multiple primary lung cancer, especially when high histopathological concordance was observed between lesions. We also suggest a thoroughly molecular diagnosis against therapeutic target genes should be taken for each accessible nodule before making a plan for adjuvant therapy.

  Study EGAS00001001572

• Genome-wide cell-free DNA fragmentation in patients with cancer

  Cell-free DNA (cfDNA) in the blood provides a noninvasive diagnostic avenue for patients with cancer. However, characteristics of the origins and molecular features of cfDNA are poorly understood. We developed an approach to evaluate fragmentation patterns of cfDNA across the genome and found that cfDNA profiles of healthy individuals reflected nucleosomal patterns of white blood cells, while patients with cancer had altered fragmentation profiles. We applied this method to analyze fragmentation profiles of 236 patients with breast, colorectal, lung, ovarian, pancreatic, gastric, or bile duct cancers and 245 healthy individuals. A machine learning model incorporating genome-wide fragmentation features had sensitivities of detection ranging from 57% to &amp;gt;99% among the seven cancer types at 98% specificity, with an overall AUC of 0.94. Fragmentation profiles could be used to identify the tissue of origin of the cancers to a limited number of sites in 75% of cases. Combining our approach with mutation based cfDNA analyses detected 91% of cancer patients. The results of these analyses highlight important properties of cfDNA and provide a proof of principle approach for screening, early detection, and monitoring of human cancer.

  Study EGAS00001003611

• Germline mutations in the transcription factor IKZF5 cause thrombocytopenia.

  To identify novel causes of hereditary thrombocytopenia, we performed a genetic association analysis of whole-genome sequencing data from 13,037 individuals enrolled in the NIHR BioResource, including 233 cases with isolated thrombocytopenia. We found an association between rare variants in the transcription factor encoding gene IKZF5 and thrombocytopenia. We report five causal missense variants in or near IKZF5 zinc fingers (Znfs), of which two occurred de novo and three co-segregated in three pedigrees. A canonical DNA-Znf binding model predicts that three of the variants alter DNA recognition. Expression studies showed that chromatin binding was disrupted in mutant compared to wild-type (WT) IKZF5 and electron microscopy revealed a reduced quantity of alpha granules in normally sized platelets. Proplatelet formation (PPF) was reduced in megakaryocytes (MKs) from seven cases relative to six controls. Comparison of RNA-seq data from platelets, monocytes, neutrophils and CD4 T-cells from three cases and 14 healthy controls showed 1,194 differentially expressed genes in platelets but only four DEGs in each of the other blood cell types. In conclusion, IKZF5 is a novel transcriptional regulator of megakaryopoiesis and the eighth transcription factor associated with dominant thrombocytopenia in humans.

  Study EGAS00001003736

• RNA sequencing and Illumina 2.5M SNP array data collected from 675 commonly used human cancer cell lines.

  Tumor-derived cell lines have served as vital models to advance our understanding of oncogene function and therapeutic response1. Although substantial effort has been directed to defining the genomic constitution of cancer cell line panels2–4, the transcriptome – which represents the active program of a cell – remains understudied. Here, we describe RNA sequencing and SNP array analysis of 675 commonly used human cancer cell lines. We explore numerous transcriptome features including coding and non-coding gene expression, transcribed mutations, gene fusion and expression of non-human sequences. Aside from many known aberrations we find new surprising characteristics, including more than 2200 unique fusion gene pairs representing a vast, testable repertoire of oncogenic fusions, many of which have analogs found in primary human tumors. We show that a combination of multiple genome and transcriptome features in a novel pathway-based approach enhances prediction of response to various targeted therapeutics. Our results provide valuable new insights into these critical pre-clinical models and provide added context for interpreting the numerous studies that employ these widely used cell lines.

  Study EGAS00001000610

• Single-cell multidimensional profiling of tumor cell heterogeneity in supratentorial ependymomas

  Supratentorial ependymomas (ST-EPNs) are aggressive and treatment-resistant pediatric brain tumors that form along the human cortex, with suspected origin from radial glia cells. Although histologically similar, ST-EPNs are molecularly classified into six distinct subgroups, many of them remaining understudied. Here, we integrated molecular cell states and spatial architecture to resolve the cellular origins and aberrant differentiation trajectories of ST-EPNs at single-cell resolution. We show that, while all ST-EPNs display a unified origin from neuroepithelial cells, different subgroups harbor highly diverse cell states and differentiation potential associated with neural or ependymal differentiation. Spatial mapping uncovered a higher-order structural tumor organization driven by presence of the mesenchymal state, and refines classical histological features based on detailed molecular resolution. By benchmarking a morpho-molecular cell-state classification system in different disease models and human tumors, we identified four cellular subtypes defined by the architecture of neurite-like extensions that mediate either self-renewal or fast, saltatory invasive phenotypes reminiscent of neurons during neurodevelopment. Collectively, our study provides a comprehensive framework for the study of ST-EPN cellular states, and reveals biologically relevant tumor compartmentalization with potential clinical implication.

  Study EGAS50000001513

• Whole genome and transcriptome analysis of medullary thyroid cancer

  Medullary thyroid cancer is the neoplasm of the calcitonin-producing parafollicular cells of the thyroid gland. The hormone calcitonin acts to lower the blood calcium level, counteracting the effects of the parathyroid hormone; it can also serve as a biomarker for the presence or recurrence of medullary thyroid cancer. Surgery is the only curative treatment for this cancer. Targeted therapeutics vandetanib and cabozantinib are approved for the treatment of aggressive and metastatic tumors that are not amenable to surgery. The use of these multikinase inhibitors are supported by the observed overactivation of the RET oncoprotein in a large sub-population of medullary thyroid cancers; however, not all patients carry oncogenic alterations of this kinase. Hence, there is a need for molecular characterization of medullary tumors on the genomic scale with the aim of identifying targetable mutations. Here, we describe the genomic profiles of two medullary thyroid cancers and report the presence of a putative oncogenic BRAF fusion in one. Such alterations previously observed in other malignancies and known targets of available drugs, can benefit patients who currently have no therapy options.

  Study EGAS00001001473

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  Systematic discovery of transcription factor (TF) landscapes in low-input samples and at single cell level is a major challenge in the fields of molecular biology, genetics, and epigenetics. To address this, we present here cleavage under Dynamic targets and Tagmentation (DynaTag), which allows robust mapping of specific TF-DNA interactions via the use of a physiological salt solution during sample preparation. Using this method, we revealed occupancy alterations for 15 different TFs in stem cell and cancer tissue models. Of note, we showcased for NANOG, MYC, and OCT4 differentially occupied genomic loci during stem cell differentiation, both in bulk and at single-cell resolution. DynaTag demonstrated superior signal-to-background ratio and occupancy resolution in comparison to CUT&RUN and ChIP-seq. In addition, a model for small cell lung cancer chemotherapy treatment in vivo showed increased chromatin occupancies of the gain-of-function mutant P53 p.R248Q, FOXA1, and MYC at altered gene pathways, such as epithelial-mesenchymal-transition. Altogether, these results highlight the technical advancement of DynaTag to uncover TF landscapes in cell models and in tissues of a complex disease model.

  Study EGAS50000001074

• Whole exome sequencing of bladder tumors

  Bladder carcinomas are immunogenic, and patients with bladder cancer benefit from immune checkpoint therapy. This is correlated to a high tumor mutation burden, which provides a higher number of neoepitopes that can be recognized by tumor-specific CD8+ T cells. Intravesical Bacillus Calmette-Guérin (BCG) is used to treat non-muscle invasive bladder cancer (NMIBC), but its mechanism of action remains elusive. Most lymphocytes appearing in the urine of BCG-treated patients are CD4+ T cells though preclinical studies showed that CD8+ T cells are also necessary for BCG treatment efficacy. It is currently unknown which proportion of patients with non-metastatic bladder cancer develop a spontaneous antitumor CD8+ response, and if BCG treatment influences this response. were prepared using the xGen Dual Index UMI Adapters (IDT), and genomic DNA (gDNA) extracted (DNeasy kit, Qiagen) from formalin-fixed paraffin- embedded (FFPE) or snap-frozen tumor tissue, as well as autologous lymphocytes. Libraries were subjected to paired-end sequencing using Illumina HiSeq4000 with a coverage depth of 250X. Library preparation was carried out with the AllType FASTplex NGS 11 Loci Flex Kit (One Lambda), and sequencing was conducted on the Illumina MiSeq platform.

  Study EGAS50000001248

• Low and variable tumor reactivity of the intratumoral TCR repertoire in human cancers

  Infiltration of human cancers by T cells is generally interpreted as a sign of immune recognition, and there is a growing effort to reactivate dysfunctional T cells at such tumor sites. However, these efforts only have value if the intratumoral T cell receptor (TCR) repertoire of such cells is intrinsically tumor-reactive, and this has not been established in an unbiased manner for most human cancers. To address this issue, we analyzed the intrinsic tumor-reactivity of the intratumoral TCR repertoire of CD8+ T cells in ovarian and colorectal cancer – two tumor types for which T cell infiltrates form a positive prognostic marker. Data obtained demonstrate that a capacity to recognize autologous tumor is limited to approximately 10% of intratumoral CD8+ T cells. Furthermore, in two out of four patient samples tested, no tumor-reactive TCRs were identified, despite infiltration of their tumors by T cells. These data indicate that the intrinsic capacity of intratumoral T cells to recognize adjacent tumor tissue can be rare and variable, and suggest that clinical efforts to reactivate intratumoral T cells will benefit from approaches that simultaneously increase the quality of the intratumoral TCR repertoire.

  Study EGAS00001003119

• TDP43 proteinopathy leads to divergent cryptic splicing in the cortex and spinal cord

  Mislocalization of the nuclear TAR DNA-binding protein 43 (TDP43) is a hallmark of ALS and FTD which leads to de-repression and inclusion of cryptic exons, promising biomarkers of TDP43 pathology in a spectrum of neurodegenerative diseases. However, most cryptic exons to date have been identified from in vitro models or a single cortical FTD dataset, and little is known about cryptic splicing in the spinal cord, or within different neuronal subtypes. We meta-analyzed published bulk RNAseq datasets representing 1,778 RNAseq profiles of ALS and FTD post-mortem tissue, and in vitro models with experimentally depleted TDP43. We identified 142 cryptic splices, including 76 novel events. We found a novel pattern of spinal cord cryptic splicing, validated in an independent cohort by qPCR, which differed significantly from cortical and in vitro splicing. Finally, leveraging multiple public single-nucleus RNAseq datasets of ALS and FTD motor and frontal cortex, we confirmed the elevation of cortical-enriched splices in disease and localized them to layer-specific neuronal populations. This catalog of cryptic splices could inform efforts to develop biomarkers for tissue-specific and cell type-specific TDP43 pathology.

  Study EGAS50000000575

• UAMS Smoldering Myeloma Myeloma Sequencing

  Identifying high risk smoldering myeloma patients and progression mechanism is a prerequisite to implement effective inception strategies and curve myeloma related morbidity and mortality. We hypothesize that genomics may help identify determinants of progression that may help predict outcome and offer effective chemo preventive targets. Eighty-two patients underwent a custom targeted panel sequencing with an additional capture for the translocation loci. These results were compared to 223 newly diagnosed patients (EGAS00001003223 and EGAD00001004117) and 17 MGUS and 10 early myeloma patients. DNA was obtained from either CD138+ cells from the bone marrow of multiple myeloma patients (tumor) or from stem cell harvests or peripheral blood cells from the same patient (control). 100 ng of DNA was fragmented, end-repaired, and adapters ligated using the HyperPlus kit (KAPA Biosystems). After PCR amplification the libraries were hybridized with probes against either a targeted panel consisting of 140 genes and chromosomal regions (Nimblegen) using SeqCap reagents (Nimblegen). Hybridized libraries underwent further amplification before being sequenced on a NextSeq500 (Illumina) using 75 bp paired end reads. Overall, these data highlight the importance of dysregulation of the MAPK pathway in the progression to MM.

  Study EGAS00001003629

• The proliferative history shapes the DNA methylome of B-cell tumor and predicts clinical outcome

  Here, we provide access to CLL and DLBCL DNA methylation and gene expression data in the context of a systematic analysis of the DNA methylation variability in 1,595 samples of normal cell subpopulations and 14 tumor subtypes spanning the entire human B-cell lineage. This approach showed that differential methylation among tumor entities relates to differences in cellular origin and to de novo epigenetic alterations, which allowed us to build an accurate machine learning-based diagnostic algorithm. We identify extensive patient-specific methylation variability in silenced chromatin associated with the proliferative history of normal and neoplastic B cells. Mitotic activity generally leaves both hyper- and hypomethylation imprints, but some B-cell neoplasms preferentially gain or lose DNA methylation. Subsequently, we construct a DNA methylation-based mitotic clock called epiCMIT, whose lapse magnitude represents a strong independent prognostic variable in B-cell tumors and is associated with particular driver genetic alterations. Our findings reveal DNA methylation as a holistic tracer of B-cell tumor developmental history, with implications in the differential diagnosis and prediction of clinical outcome.

  Study EGAS00001004640

• Monitoring of leukemia clones in B-cell acute lymphoblastic leukemia at diagnosis and during treatment by single-cell DNA amplicon sequencing

  Acute lymphoblastic leukemia (ALL) is characterized by the presence of chromosomal changes, including numerical changes, translocations and deletions, which are often associated with additional single nucleotide mutations. In this study we used single-cell targeted DNA sequencing to determine the clonal heterogeneity of B-cell ALL at diagnosis and during chemotherapy treatment. With a customly designed DNA amplicon library targeting the most common mutations (in 110 genes) present in ALL, we analyzed bone marrow samples and/or blood samples from 12 B-ALL cases at diagnosis. For 4 cases where we detected multiple mutational clones at diagnosis, we also studied blood samples during the first weeks of chemotherapy treatment. This study shows that B-ALL cases with either a ETV6-RUNX1 or a BCR-ABL1 fusion have a low mutational burden, while cases with PAX5 alterations or hyperdyploidy have multiple clones at diagnosis, often with mutations in the JAK-STAT signaling pathway and the RAS signaling pathway. As expected, it can be observed that these clones disappear during treatment of the leukemia with almost no mutated cells left after two weeks of treatment.

  Study EGAS00001005029

• Kidney_transplant_nephrectomy_scRNAseq

  Single cell transcriptomics study of tissue from human kidney transplant nephrectomies Tissue is acquired from kidney transplant nephrectomies, homogenised and disaggregated to a single cell suspension prior to droplet encapsulation single cell RNAseq (10X protocol) or plate based single cell RNAseq (SS2 protocol). Human tissues, including the kidney are seeded with a tissue resident immune cell network throughout life. These cells may self renew in situ or be replaced by circulating precursors which enter the tissue in response to tissue specific niche and inflammatory signals. We are using single cell RNA sequencing of kidney transplant nephrectomy tissue to 1) understand the immune cell populations which are resident within the human kidney 2) identify which of these populations is donor or recipient derived. 3) Uncover the temporal dynamics of donor/recipient chimerism in the the human kidney following transplantation. 4) Understand transcriptional differences between organs removed for a variety of reasons (infection, chronic rejection, vascular emergencies) This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001003935

• Molecular_risk_stratification_in_patients_with_T1_colorectal_cancer_WES

  The introduction of bowel cancer screening has led to a significant increase in the proportion of patients being diagnosed with asymptomatic, early-stage colorectal cancer (CRC). Although the majority of these patients are successfully treated with surgery alone, a small proportion of patients have ‘born-to-be-bad’ aggressive lesions with early dissemination leading to distant metastases. Current standard of care histological assessment is unable to distinguish between these aggressive versus non-aggressive early lesions which is essential to provide appropriate clinical management decisions. This study aims to carry out molecular and histological profiling of approximately 300 T1 CRCs in order to develop a molecular stratifier based on the risk of relapse in early-invasive CRC. This novel T1 cohort will represent the world’s largest molecularly characterised T1 cohort of samples, with digital pathology assessment alongside whole exome sequencing, copy number variation analysis and 3’ RNA-seq. This data will be used to generate a robust panel of molecular and/or histological markers applicable to formalin-fixed paraffin embedded (FFPE) archival tissue which discriminates between T1 lesions based on risk of relapse, which will ultimately be used to inform clinical management of CRC at the earliest stages of the disease.

  Study EGAS00001005734

• Clonal relationships of ductal carcinoma in situ and recurrent invasive breast cancers defined by genomic analysis

  Ductal Carcinoma In Situ (DCIS) is the most common form of pre-invasive breast cancer and despite treatment a small fraction (5-10%) of DCIS patients present with invasive disease many years later. A fundamental biologic question is whether the invasive disease recurring in the same breast is established by tumor cells in the initial DCIS or represents new unrelated disease. To address this question, we performed genomic analyses on the initial pure DCIS lesion and paired invasive recurrent tumors in 95 patients together with single cell DNA sequencing in a subset of cases. Our data shows that in 75% the invasive recurrence was clonally related to the initial DCIS, suggesting that the tumor cells were not eliminated during the initial treatment with surgery +/- radiotherapy. Surprisingly however, 18% were clonally unrelated to the DCIS, representing new independent lineages, and 7% of cases were ambiguous. Our findings show that although DCIS is often the precursor of invasive recurrence, a significant fraction of invasive recurrences are unrelated to the initial DCIS. This knowledge is essential for accurate risk evaluation of DCIS treatment de-escalation strategies and the identification of predictive biomarkers.

  Study EGAS00001005784

• B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

  B cells play a central role in the immune response to both SARS-CoV-2 infection and vaccination, but the development of the B cell receptor (BCR) repertoire in both contexts has not been defined nor compared. We analysed serial samples from 171 SARS-CoV-2-infected individuals with a range of disease severities together with 63 vaccine recipients, and found marked differences in the global BCR repertoire after natural infection compared to vaccination. Following infection, the proportion of BCRs bearing IgG1/3 and IgA1 isotypes increased, somatic hypermutation (SHM) was markedly decreased and, in patients with severe disease, expansion of IgM and IgA clones was observed. In contrast, after vaccination the proportion of BCRs bearing IgD/M isotypes increased, SHM was unchanged and expansion of IgG clones was prominent. Infection generated a broad distribution of SARS-CoV-2-specific clones predicted to target the spike protein whilst vaccination produced a more focused response mainly targeting the spike’s receptor-binding domain. These findings offer insights into how different immune exposure to SARS-CoV-2 impacts upon BCR repertoire development, potentially informing vaccine strategies.

  Study EGAS00001005816

• Clonal relationships of ductal carcinoma in situ and recurrent invasive breast cancers defined by genomic analysis

  Ductal Carcinoma In Situ (DCIS) is the most common form of pre-invasive breast cancer and despite treatment a small fraction (5-10%) of DCIS patients present with invasive disease many years later. A fundamental biologic question is whether the invasive disease recurring in the same breast is established by tumor cells in the initial DCIS or represents new unrelated disease. To address this question, we performed genomic analyses on the initial pure DCIS lesion and paired invasive recurrent tumors in 95 patients together with single cell DNA sequencing in a subset of cases. Our data shows that in 75% the invasive recurrence was clonally related to the initial DCIS, suggesting that the tumor cells were not eliminated during the initial treatment with surgery +/- radiotherapy. Surprisingly however, 18% were clonally unrelated to the DCIS, representing new independent lineages, and 7% of cases were ambiguous. Our findings show that although DCIS is often the precursor of invasive recurrence, a significant fraction of invasive recurrences are unrelated to the initial DCIS. This knowledge is essential for accurate risk evaluation of DCIS treatment de-escalation strategies and the identification of predictive biomarkers.

  Study EGAS00001006306

• PDAC organoid genomic heterogeneity

  The establishment of patient-derived pancreatic cancer organoid culture in recent years creates an exciting opportunity for researchers to perform a wide range of in vitro studies on a model that closely recapitulates the tumor. Among the outstanding questions in pancreatic cancer biology are the causes and consequences of genomic heterogeneity observed in the disease. However, to use pancreatic cancer organoids as a model to study genomic variations, we need to first understand the degree of genomic heterogeneity and its stability within organoids. Here, we used single-cell whole-genome sequencing to investigate the genomic heterogeneity of two independent pancreatic cancer organoids, as well as their genomic stability with extended culture. Clonal populations with similar copy number profiles were observed within the organoids, and the proportion of these clones was shifted with extended culture, suggesting the growth advantage of some clones. However, sub-clonal genomic heterogeneity was also observed within each clonal population, indicating the genomic instability of the pancreatic cancer cells themselves. Furthermore, our transcriptomic analysis also revealed a positive correlation between copy number alterations and gene expression regulation, suggesting the “gene dosage” effect of these copy number alterations that translates to gene expression regulation.

  Study EGAS00001006782

• DNA methylation landscape of prostate cancer

  Metastases from primary prostate cancers to rare locations, such as the brain, are becoming more common due to longer life expectancy thanks to improved treatments. Epigenetic dysregulation is a feature of primary prostate cancer, and distinct DNA methylation profiles are associated with the mutually exclusive SPOP mutant or TMPRSS2-ERG fusion genetic backgrounds. Using a cohort of 42 patients with prostate cancer brain metastases (PCBM), with matched primary samples available for 17 patients, we carried out DNA methylation analysis using Illumina EPIC array. We examined the epigenetic distinction between primary PCa and PCBM, the association between epigenetic alterations and mutational background, and particular epigenetic alterations that may be associated with PCBM in particular. Multiregion sampling of PCBM revealed epigenetic heterogeneity in metastases. We found aberrant methylation in PCBM is associated with mutational background, PRC2 complex activity and upregulation of EZH2, an effect that is particularly pronounced in SPOP mutant PCBM. While we detected a hypermethylator phenotype in PCBM, we also observed hypomethylation occurring at the promoters of genes involved in neuroactive ligand-receptor interactions or the calcium signalling pathway, such as GABRB3 and GRM5, a change not observed in non-brain prostate cancer metastases.

  Study EGAS00001006670

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  Children have reduced SARS-CoV-2 infection rates and a substantially lower risk for developing severe COVID-19 than adults. However, the molecular mechanisms underlying protection in younger age groups remain unknown. Here, we characterize the single-cell transcriptional landscape in the upper airways of SARS-CoV-2-negative (n=18) and age-matched SARS-CoV-2–positive children (n=24) and corresponding samples from adults (n=44), covering an age range of four weeks to 77 years. Children displayed higher basal expression of the relevant pattern recognition receptors (PRR) such as MDA5 (IFIH1) and RIG-I (DDX58) in upper airway epithelial cells, macrophages, and dendritic cells, resulting in stronger innate antiviral responses upon SARS-CoV-2 infection than adults. We further detected distinct immune cell subpopulations including KLRC1 (NKG2A)+ cytotoxic T cells and a CD8+ T cell population with a memory phenotype occurring predominantly in children. Our study provides evidence that the airway immune cells of children are primed for virus sensing, resulting in a stronger early innate antiviral responses to SARS-CoV-2 infection than adults.

  Study EGAS00001005461

• Transgenerational transmission of reproductive and metabolic dysfunction in the male progeny of polycystic ovary syndrome

  The transgenerational maternal effects of PCOS in female progeny have been revealed. As there are evidence that a male equivalent of PCOS may exist, we asked whether sons born to mother with PCOS (PCOS-sons) transmit reproductive and metabolic phenotypes to their male progeny. Here, in a Swedish nationwide register-based cohort and a clinical case-control study from Chile we found that PCOS-sons are more often obese and dyslipidemic. Their serum miRNAs are found to potentially regulate PCOS-risk genes. Our prenatal androgenized PCOS-like mouse model with or without diet-induced obesity confirmed that reproductive and metabolic dysfunctions in F1 male offspring are passed down to F3. Small non-coding RNAs (sncRNAs) sequencing of F1-F3 sperm revealed distinct differentially expressed (DE) sncRNAs across generations in the androgenized, obese, and obese and androgenized lineages, respectively. Notably, common targets between transgenerational DEsncRNAs in mouse sperm and in PCOS-sons serum indicate similar effects of maternal hyperandrogenism. These findings strengthen the translational relevance highlighting a previously underappreciated risk of reproductive and metabolic dysfunction via the male germline transmission and potential molecular markers to study in future generations.

  Study EGAS00001007079

• Discovery of immunotherapy targets for pediatric solid and brain tumors by exon-level expression

  Immunotherapy with chimeric antigen receptor T cells for pediatric solid and brain tumors is constrained by available targetable antigens. Cancer-specific exons present a promising reservoir of targets; however, these have not been explored and validated systematically in a pan-cancer fashion. To identify cancer specific exon targets, we analyze 1,532 RNA-seq datasets from 16 types of pediatric solid and brain tumors for comparison with normal tissues using a newly developed workflow. We find 2,933 exons in 157 genes encoding proteins of the surfaceome or matrisome with high cancer specificity either at the gene (n=148) or the alternatively spliced isoform (n=9) level. Expression of selected alternatively spliced targets, including the EDB domain of fibronectin 1, and gene targets, such as COL11A1, are validated in pediatric patient derived xenograft tumors. We generate T cells expressing chimeric antigen receptors specific for the EDB domain or COL11A1 and demonstrate that these have antitumor activity. The full target list, explorable via an interactive web portal (https://cseminer.stjude.org/), provides a rich resource for developing immunotherapy of pediatric solid and brain tumors using gene or AS targets with high expression specificity in cancer.

  Study EGAS00001007766

• Data Quality Control

  Data Quality Control High-throughput sequencing techniques have become the leading method to study, decode and discover the genomic origins of biological phenomenons. EGA provides a secure archival of such identifiable genomics data with the purpose of data-upcycling, i.e. to re-use these data for research. High-quality data standards are essential to ensure the quality and credibility of the research. Moreover, a quality check report can assure a researcher beforehand about the data that they will request access, therefore saving time and effort. The EGA has developed a File Quality Control Report (QC Report) to provide generic quality control reports for Fastq, SAM/BAM/CRAM, and VCF files deposited at EGA. This QC Report will allow users to get information regarding the files submitted within a specific dataset. The data requesters will obtain information such as the quality of reads, mapped reads, number of variants, and other features before starting the requesting process, which will save the efforts and time.Accessing file quality control reportsIn each dataset page, the user can explore the files that it contains by clicking the "files" tab. The Quality Control report of a file has two sections. The first one, contains general information about the file, such as the inferred assembly, total reads, the dataset or study where it comes from, etc. The second section contains plots that summarise interesting information about the file, for example, the base coverage distribution, base quality or mapped reads. The description of each plot is accessible by clicking the "i" button at the top-right corner of each plot box. Technical Description For analysing the fastq, SAM/BAM/CRAM and VCF files, the EGA applies a set of tools widely used in the bioinformatics community. FASTQ: FastQC, recognised as the gold standard tool by the community.Per base sequence quality, per sequence quality scores, per base sequence content, per sequence GC content, sequence duplication levels, etc.SAM/BAM/CRAM: samtools, also the gold standard, generates results plots useful to get an overall idea of the quality of the file.base coverage distribution, base quality, % of mapped reads, % of both mates mapped, singletons, duplicates, etc.VCF: vcftools and bcftools, combined with a custom script to infer the genome assembly.site frequency distribution, Ts/Tv, base changes, indel distribution, etc.

  Documentation access/request-data/quality-control-reports

• Whole genome sequencing of retinoblastoma reveals the diversity of rearrangements disrupting RB1 and uncovers a treatment related mutational signature

  Background: The development of retinoblastoma is thought to require pathological genetic changes in both alleles of the RB1 gene. However, cases exist where RB1 mutations are undetectable suggesting alternative pathways to malignancy. Methods: We applied comprehensive whole genome sequencing (WGS) and transcriptomics to sporadic retinoblastomas derived from twenty patients attending our clinic, contrasting these results to that obtained through customary clinical testing. We sought RB1 and other driver mutations, investigated mutation burden, mutational signatures and phylogenetic relatedness in one case of bilateral retinoblastoma. Results: At least one RB1 mutation was identified in all retinoblastomas. We confirmed RB1 mutations previously identified by clinical screening, identified three new RB1 mutations and provided clarity to the mechanism behind a further six mutations. Eight tumours carried structural rearrangements involving RB1 ranging from relatively simple to extremely complex rearrangement patterns, including a chromothripsis-like pattern in one tumour. Potential driver mutations included mutations in BCOR (5/20) and amplification of MYCN (2/20) and MDM4 (1/20). We show that RB1 mutations are not mutually exclusive of MYCN amplifications, and further reveal that all tumours demonstrate increased MYCN expression suggesting a universal role in retinoblastoma tumorigenesis.  Bilateral tumours obtained from one patient harboured conserved germline but divergent somatic RB1 mutations, indicating independent evolution. In-keeping with previous WGS of paediatric cancers, the mutation burden in retinoblastomas was extremely low. Mutational signature analysis showed a predominance of signatures associated with cell division and an absence of ultraviolet-related DNA damage. In a tumour exposed to chemotherapy prior to enucleation, a profound platinum-related mutational signature was observed. Conclusions: WGS provides a complete picture of the genomic landscape of retinoblastomas, allowing the discovery of mutations otherwise undetected by conventional clinical screening approaches. The presence of at least one RB1 mutation in all retinoblastomas and the relative paucity of driver mutations in other genes suggests mutations beyond RB1, MYCN and BCOR are rare. Whilst most RB1 mutations are identifiable by clinical screening, the increased resolution and ability to detect otherwise elusive rearrangements of RB1 by WGS, confirming whether they are somatic or germline, has important repercussions on clinical management and advice on recurrence risks.

  Dataset EGAD00001006431

• H3Africa - Identification and characterization of novel hereditary neurological disease genes in Mali.

  Despite the vast diversity of its populations, genetic studies in Africa have been limited. African populations, Malians in particular, have a high rate of intra-ethnic and consanguineous marriage, resulting in increased prevalence of autosomal recessive diseases. Family-based genetic studies can be limited in developed countries due to small sibships. The average fertility rate in Mali is over 6 births per woman, offering a unique opportunity to find new disease genes or mutations that can then be studied in other populations. Hereditary neurological diseases are very debilitating diseases, and developing countries, particularly in Africa, pay a high price in terms of disability-adjusted life years. Although most are currently untreatable, increasing awareness about hereditary neurological disorders can reduce this burden. This study will help to identify and characterize novel hereditary neurological disease genes in Mali. These genes are likely to be important in the normal function of the nervous system and to have important pathophysiological implications for African and other populations. This study will also train physicians and students in the characterization of neurodegenerative diseases as well as in genetic technology and molecular biology, and build a suitable research environment that will retain them.

  Study EGAS00001003016

• A Phase I/IB Study of Ipilimumab or Nivolumab in Patients With Relapsed Hematologic Malignancies After Allogeneic Hematopoietic Cell Transplantation

  Relapse after allogeneic hematopoietic stem cell transplantation (HSCT) is characterized by poor outcomes and novel therapeutic options are urgently needed. Immune checkpoint blockade using CTLA-4 and PD-1 blocking antibodies are a potential concept for reinstating a dormant graft-versus-leukemia (GvL) effect.This study investigated transcriptomic changes in biopsies obtained from patients who received immune checkpoint blockade for relapsed hematologic malignancy post-HSCT and elucidated transcriptional programs associated with successful reinvigoration of GvL. Differential gene expression analysis showed evidence of increased T cell infiltration in biopsies of responders to ipilimumab treatment and demonstrated shared gene programs between GvL and GvHD.

  Study phs002377

• Circulating cell-free DNA methylation profiles as noninvasive multiple sclerosis biomarkers: A proof-of-concept study

  In chronic neurodegenerative diseases such as multiple sclerosis (MS), there is a critical unmet need for cost-effective non-invasive blood biomarkers to concurrently classify disease subtypes, monitor disability severity, and predict long-term progression. In this proof-of-concept study, we performed low-coverage whole-genome bisulfite sequencing (WGBS) on 75 plasma cell-free DNA (cfDNA) samples collected from a well-characterized real-world prospective clinic cohort with longitudinal disability outcome measurements. We assessed the clinical utility of cfDNA methylation profile for differentiating MS patients from non-MS controls, classifying MS subtypes, estimating disability severity, and predicting disease trajectories.

  Study EGAS50000001277

• GCAT | Genomes for life

  The GCAT project is a prospective cohort study that was designed to recruit the general population of Catalonia, the north-east region of Spain. This study is a long-term genomic, environmental and lifestyle cohort project that aims to evaluate and track multiple pathologies as well as biologically related traits. By the end of 2017, the GCAT Study had recruited a total of 20 000 participants aged 40–65 years. Participants who agreed to take part in the study completed a self-administered computer-driven questionnaire, and underwent blood pressure, cardiac frequency and anthropometry measurements. For each participant, blood plasma, blood serum and white blood cells are collected at baseline. The GCAT Study has access to the electronic health records of the Catalan Public Healthcare System. Participants are followed biannually for/during, at least, 20 years after recruitment. Therefore, the GCAT Study offers a unique opportunity to integrate diverse data to allow the identification of novel relations among different biomarkers and conditions. Results may lead to the development of new genetic, genomic, epigenomic and proteomic diagnoses and screening tests, as well as new public health recommendations. The only currently available population-based prospective cohort study in Spain to the date, including more than 4899 genotyped participants and 800 whole genome sequences is now stored in the EGA archive under accession id EGAS00001003018.

  Blog gcat-genomes-for-life

• MorphoITH: A Framework for Deconvolving Intra-Tumor Heterogeneity Using Tissue Morphology

  This study introduces MorphoITH, a framework for deconvolving intra-tumor heterogeneity (ITH) in clear cell renal cell carcinoma (ccRCC) based on tissue morphology from histopathological slides. The study tested MorphoITH's ability to capture different aspects of morphology and to reflect genetic ITH. The data deposited here is derived from a morphology guided multi-regional sequencing dataset used to study the relationship between morphology and genetic evolution. This dataset consists of whole exome sequencing of tumor from multiple sites and adjacent normal samples which were collected from two patients treated in affiliated hospitals of the University of Texas Southwestern Medical Center (UTSW), including Parkland Hospital.

  Study EGAS50000001064

• RNA sequencing of a glioblastoma PDX cohort

  Patient-derived xenograft (PDX) models represent an essential tool for the preclinical evaluation of novel targeted therapies and their combinations. In this project, we molecularly characterized a comprehensive panel of glioma PDX models with well conserved molecular and pathological features over multiple passages. PDX samples were subjected to next generation sequencing (NGS). Characterization of cancer-relevant features including driver mutations or cellular processes was performed using mutational and gene expression data in order to identify potential biomarker or treatment targets in glioblastoma. In summary, we reported a newly established and molecularly characterized panel of glioma PDX models with high relevance for translational preclinical research.

  Study EGAS00001007119

• Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study

  The Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study (NCT: NCT04750109) was sponsored by The Christie NHS Foundation Trust and funded by Innovate UK. Data generated include: A) Whole genome sequencing* of paired germline blood and tumour tissue B) Whole genome sequencing *of germline blood only C) Next-generation sequencing of circulating tumour DNA (FoundationOne Liquid CDX) D) Next-generation sequencing of tumour tissue (FoudationOne CDX) *Whole genome sequencing - germline sample at 30x coverage and somatic sample at 75x coverage performed by Illumina NovaSeq 6000 instrument in the 150bp PE read mode.

  Study EGAS00001008239

• Structural rearrangements generate cell-specific, gene-independent CRISPR-Cas9 loss of fitness effects.

  CRISPR-Cas9 genome editing is widely used to study gene function, from basic biology to biomedical research. Structural rearrangements are a ubiquitous feature of cancer cells and their impact on the functional consequences of CRISPR-Cas9 gene-editing has not yet been assessed. Utilizing CRISPR-Cas9 knockout screens for 250 cancer cell lines, we demonstrate that targeting structurally rearranged regions, in particular tandem or interspersed amplifications, is highly detrimental to cellular fitness in a gene independent manner. In contrast, amplifications caused by whole chromosomal duplications have little to no impact on fitness. This effect is cell line specific and dependent on the ploidy status. We devise a copy-number ratio metric that substantially improves the detection of gene-independent cell fitness effects in CRISPR-Cas9 screens. Furthermore, we develop a computational tool, called Crispy, to account for these effects on a single sample basis and provide corrected gene fitness effects. Our analysis demonstrates the importance of structural rearrangements in mediating the effect of CRISPR-Cas9-induced DNA damage, with implications for the use of CRISPR-Cas9 gene-editing in cancer cells.

  Dataset EGAD00001004124

• RNA sequencing data of 257 samples from the CORALLEEN trial

  Early-stage Luminal B breast cancer is frequent and is a major cause of breast cancer death due to its poor prognosis. Our proposal aims to study the biology behind the sensitivity and resistance of Luminal B breast cancer to chemotherapy (CHT) or a non-CHT regimen composed of hormone therapy in combination with ribociclib, a CDK4/6 inhibitor. To accomplish this, we first completed the SOLTI-1402 CORALLEEN phase II trial, a study where 106 patients with early-stage Luminal B breast cancer were randomized to standard neoadjuvant CHT for 6 months, or neoadjuvant letrozole and ribociclib for 6 months. After treatment, patients underwent surgery. The primary results of the study, which showed that the response rate to letrozole+ribociclib was similar to CHT, was reported (Prat et al; Lancet Oncol). Tumor biopsies were available at baseline, week 3 and surgery. A total of 257 samples were analyzed using the Illumina TruSeq Stranded Total RNA w/Ribo Zero Gold with MiSeq in TGL (Sequencer NovaSeq S4/PE/100x)

  Dataset EGAD00001010121

• Sequential single-cell transcriptional and protein marker profiling reveals TIGIT as a marker of CD19 CAR-T cell dysfunction in patients with non-Hodgkin’s lymphoma

  Employed single cell RNA sequencing and protein surface marker profiling of serialCAR-T cell samples from patients with non-Hodgkin’s lymphoma (NHL) to reveal CAR-T cell evolution, identify biomarkers of response, and test for evidence of exhaustion inCAR-T cells of poor responders. At the transcriptional and protein levels, we note the evolution of CAR-T cells toward a non-proliferative, highly-differentiated, andexhausted state that is enriched in CAR-T cells of patients with poor response.Furthermore, we identified the checkpoint receptor TIGIT as a novel prognosticbiomarker and potential driver of CAR-T cell exhaustion.

  Study EGAS00001005356

• Genomewide Association Study of Alcohol Use and Alcohol Use Disorder in Australian Twin-Families (OZ-ALC GWAS)

  The Australian twin-family study of alcohol use disorder (OZALC study) derives from telephone diagnostic interview studies of two general population volunteer cohorts of Australian twins (cohort 1, mostly born 1940-1964; cohort 2, born 1964-71) and the spouses of the former cohort - a total of over 11,000 families. Three coordinated studies, using a shared assessment protocol and with a shared goal of gene-discovery, were conducted - one funded by the National Institute on Drug Abuse, the others by the National Institute on Alcoholism and Alcohol Abuse - by investigators associated with the Midwest Alcoholism Research Center at Washington University in St. Louis, and investigators at Queensland Institute of Medical Research, Brisbane, Australia (led by Professor Nicholas Martin), using informative families identified from these cohorts. The first of these (NIDA Nicotine Addiction Genetics [NAG] project, PI Pamela Madden) identified index cases from the 3 cohorts with a history of heavy smoking (smoked 20 or more cigarettes daily, or 40 or more cigarettes on 1 or more occasions) and with additional available full siblings who were smokers, and interviewed and obtained blood samples from twins, and cooperative full siblings and parents, in order to identify families that would be informative for linkage analysis of a quantitative heaviness of smoking trait. The second identified additional families with an index case who either reported a history of alcohol dependence (DSM-IV), or scored above the 85th percentile on a quantitative measure of heaviness of alcohol use (alcohol factor score), derived from measures of frequency of heavy drinking, frequency of drinking to intoxication, and typical weekly consumption in standard drinks (all referenced to the respondent&#39;s heaviest drinking period) and of lifetime maximum 1-day alcohol consumption and maximum tolerance to alcohol (drinks before getting drunk or before feeling effects of alcohol). Interview and DNA were obtained from index cases and siblings, and DNA only from available parents. The goal of this second study (NIAAA OZ-ALCOHOL EDAC study, PI Andrew Heath) was to identify sibships including pairs who were either extreme concordant for the quantitative consumption measure (both scoring above the 85th percentile) or extreme discordant (one scoring above the 85th percentile and one scoring below the 30th percentile) that would be informative for linkage analysis. The third identified additional sibships solely on the basis of large sibship size, regardless of alcohol or tobacco use phenotypes (NIAAA OZ-BIGSIB study, PIs the late Richard Todd, Andrew Heath). From these coordinated studies a case-control series of alcohol dependent individuals and unaffected controls were constructed for a family-based Genomewide Association Study (OZALC-GWAS) of heaviness of alcohol use and alcohol dependence, funded by the National Institute of Alcoholism and Alcohol Abuse. These data are made available here for all investigators studying outcomes related to alcohol or tobacco use (including major depressive disorder).

  Study phs000181

• INCLUDE Data Hub: NDA GUIDs for Down Syndrome Research

  The INCLUDE (INvestigation of Co-occurring conditions across the Lifespan to Understand Down syndromE) Project is an NIH-wide collaboration that seeks to improve health and quality of life for people with Down syndrome. The INCLUDE Project Data Coordinating Center (DCC) and partners created the INCLUDE Data Hub, a centralized data resource that allows access to large-scale clinical and multi-omics datasets specific to Down syndrome and supports collaborative, cloud-based analysis to accelerate scientific discoveries related to Down syndrome and its co-occurring conditions. The INCLUDE Data Hub includes an innovative researcher data repository, a portal, and a cloud-based platform for data analysis. The portal provides access to de-identified demographics and clinical metadata, as well as multi-omics datasets, including whole genome sequences, transcriptomes, proteomes, and metabolomes. The INCLUDE Data Hub uses a 'registered access' model, whereby users can access the portal and associated data after agreeing to terms of use. From the Data Hub, users can also reach 'controlled access' data (e.g., whole genome sequences) only for those studies for which they have obtained approval by an NIH Data Access Committee through the corresponding dbGaP study. A thoughtful linkage strategy to identify duplicate participants across studies enables researchers to merge multiple datasets and data types to create richer datasets and reduce costly redundancies in large-scale data generation (e.g., -omics) while mitigating potential risks introduced by linkage.Based on recommendations from the NICHD Office of Data Science and Sharing, which completed a comprehensive assessment of existing Privacy Protecting Record Linkage (PPRL) and associated data governance solutions, the INCLUDE DCC and the associated NIH Steering Committee have implemented NIMH Data Archive Global Unique Identifiers (NDA GUIDs) in the INCLUDE Data Hub. The NDA GUID Tool is a government-owned and operated PPRL technology that enables researchers to link data from multiple sources to the same individual without revealing personally identifiable information (PII). With the NDA GUID Tool, the same participant information will return the same GUID whenever or wherever it is entered. The GUID itself is not personally identifiable information or protected health information. Sharing data with NDA GUIDs allows approved researchers to link together data on a single participant, even if the data were collected at different locations or through different studies or are distributed from different data repositories. This dbGaP study enables researchers to access an INCLUDE GUID Mapping File that includes all available NDA GUIDs and their associations to study-specific Participant IDs across studies in the INCLUDE Data Hub. This dbGaP study only distributes NDA GUIDs associated with the INCLUDE Data Hub datasets. To access the associated controlled-access datasets, add the corresponding dbGaP studies to your Data Access Request. A list of these studies is available on the INCLUDE Data Hub Portal: https://portal.includedcc.org/studies.

  Study phs003678

• Heart Failure Network: Entresto(TM) in Advanced Heart Failure (HFN-LIFE-BioLINCC)

  Data Access NOTE: Please refer to the "Authorized Access" section below for information about how access to the data from this accession differs from many other dbGaP accessions.Objectives: To compare treatment with sacubitril/valsartan versus valsartan alone in patients with advanced heart failure with a reduced ejection fraction and recent New York Heart Association class IV symptoms.Background: Treatment with evidence-based medical therapies improves survival, reduces heart failure hospitalizations, and improves quality of life in patients with chronic heart failure with a reduced ejection fraction. However, evidence supporting the use of medical therapies among patients with advanced heart failure is limited. Patients with New York Heart Association (NYHA) class IV heart failure are not often enrolled in clinical trials.A previous trial reported that, compared with the angiotensin-converting enzyme inhibitor enalapril, sacubitril/valsartan, an angiotensin receptor-neprilysin inhibitor, reduced the relative risk of cardiovascular mortality and heart failure hospitalizations by 20% in ambulatory patients with heart failure with a reduced ejection fraction. Although patients with NYHA class IV heart failure were eligible to enroll, this population was underrepresented. The HFN-LIFE trial was initiated to provide additional information about the tolerability, safety, and potential efficacy of sacubitril/valsartan in patients with advanced heart failure.Participants: Of the eligible patients that enrolled, a total of 335 patients tolerated the run-in phase and were randomized to a treatment group. 167 patients were randomly assigned to receive sacubitril/valsartan and 168 patients were randomly assigned to receive valsartan alone.Design: The HFN-LIFE trial was a prospective, multicenter, randomized, double-blind phase 4 clinical trial. Trial enrollment was suspended early, due to the high risk for adverse outcomes associated with COVID-19 infection.Eligible patients were enrolled and began an unblinded run-in period of 3 to 7 days with sacubitril/valsartan, 24/26 mg (50-mg fixed dose), administered orally twice daily. Participants tolerating the run-in phase were randomized in a 1:1 fashion to receive sacubitril/valsartan (target dose, 200 mg twice daily) or valsartan (target dose, 160 mg twice daily). The initial doses were selected based on guidelines with dose adjustments being made every 2 weeks.The primary efficacy outcome was the area under the curve of NT-proBNP levels at 2, 4, 8, 12, and 24 weeks compared with the level of NT-proBNP at randomization. The secondary efficacy end point was the number of days the patient was alive, out of the hospital, and free from any of the following outcomes: listing for cardiac transplant, cardiac transplant, implantation of a left ventricular assist device, receipt of continuous inotropic therapy for 7 or more days, or hospitalization for heart failure on 2 or more occasions other than the index admission.Conclusions: In patients with chronic advanced heart failure with a reduced ejection fraction, there was no statistically significant difference between sacubitril/valsartan and valsartan alone with respect to reducing NT-proBNP levels.

  Study phs004171

• Action to Control Cardiovascular Risk in Diabetes (ACCORD - Imaging)

  Available DataAction to Control Cardiovascular Risk in Diabetes (ACCORD-Imaging), provides access to ECG signals data from the ACCORD clinical trial. The clinical phenotyping and outcomes data from the trial are associated with ACCORD-BioLINCC, phs003551.ObjectivesThe purpose of this study was to determine if intensive glycemic control, multiple lipid management and intensive blood pressure control could prevent major cardiovascular events (myocardial infarction, stroke or cardiovascular death) in adults with type 2 diabetes mellitus. Secondary hypotheses included treatment differences in other cardiovascular outcomes, total mortality, microvascular outcomes, health-related quality of life and cost-effectiveness.BackgroundGlycemia Trial:Patients with type 2 diabetes mellitus die of cardiovascular disease (CVD) at rates two to four times higher than non-diabetic populations of similar demographic characteristics. They also experience increased rates of nonfatal myocardial infarction and stroke. With the growing prevalence of obesity in the United States, CVD associated with type 2 diabetes is expected to become an even greater public health challenge in the coming decades than it is now. Expected increases in event rates will be associated with a concomitant rise in suffering and resource utilization.The ACCORD study investigated whether intensive therapy to target normal glycated hemoglobin (HbA1c) levels would reduce cardiovascular events in patients with type 2 diabetes who had either established cardiovascular disease or additional cardiovascular risk factors when compared to standard therapy (HbA1c between 7.0% and 7.9%). A separate analysis investigated whether reduction of blood glucose concentration decreases the rate of microvascular complications in these patients.Lipid Therapy Trial:Patients with type 2 diabetes mellitus have an increased incidence of atherosclerotic cardiovascular disease attributable, in part, to associated risk factors such as dyslipidemia. This is characterized by elevated plasma triglyceride levels, low levels of high-density lipoprotein (HDL) cholesterol and small, dense low-density lipoprotein (LDL) particles. The ACCORD Lipid Therapy trial was designed to test the effect of a therapeutic strategy that uses a fibrate to raise HDL-C and lower triglyceride levels and uses a statin for treatment of LDL-C reduce the rate of CVD events compared to a strategy that only uses a statin for treatment of LDL-C on cardiovascular outcomes in patients with type 2 diabetes that were at high risk for cardiovascular disease.Blood Pressure Trial:Diabetes mellitus increases the risk of cardiovascular disease at every level of systolic blood pressure. Because cardiovascular risk in patients with diabetes is graded and continuous across the entire range of levels of systolic blood pressure, even at prehypertensive levels, the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC 7) recommended beginning drug treatment in patients with diabetes who have systolic blood pressures of 130 mm Hg or higher, with a treatment goal of reducing systolic blood pressure to below 130 mm Hg. There is, however, a paucity of evidence from randomized clinical trials to support these recommendations. The ACCORD Blood Pressure trial tested the effect of a target systolic blood pressure below 120 mm Hg on major cardiovascular events among high-risk persons with type 2 diabetes compared to a strategy that targeted a SBP of EYE Substudy:Diabetic retinopathy, an important microvascular complication of diabetes, is a leading cause of blindness in the United States. Randomized, controlled clinical trials in cohorts of patients with type 1 diabetes and those with type 2 diabetes have shown the beneficial effects of intensive glycemic control and intensive treatment of elevated blood pressure on the progression of diabetic retinopathy. Elevated serum cholesterol and triglyceride levels have been implicated, in observational studies and small trials, as additional risk factors for the development of diabetic retinopathy and visual loss. The ACCORD EYE Substudy evaluated the effects of the ACCORD medical strategies on the progression of diabetic retinopathy in a subgroup of trial patients.MIND Substudy:Studies suggest that older persons with type 2 diabetes have at least twice the likelihood of developing late-life cognitive impairment or dementia compared to those without. The mechanisms underlying these cognitive disorders are increasingly thought to reflect a mixed pathology pattern with contributions from vascular, neurodegenerative and neurovascular processes. Pathophysiological mechanisms that have been described include inflammation, oxidative stress, energy imbalance, protein misfolding, glucocorticoid-mediated effects and differences in genetic susceptibilities. The ACCORD MIND substudy took as a premise that early intervention with the ACCORD therapeutic strategies to improve glycemic control could mitigate the adverse effects of type 2 diabetes on the brain.Subjects10,251 patients with type 2 diabetes and HbA1c concentrations of 7.5% or more participated in the trial. Of these patients, 5518 were assigned to the lipid therapy arm and 4733 to the blood pressure arm. EYE Substudy:A subgroup of 2856 patients was evaluated for the effects of the ACCORD interventions at 4 years on the progression of diabetic retinopathy. Patients who, at baseline, had a history of proliferative diabetic retinopathy that had been treated with laser photocoagulation or vitrectomy were excluded.MIND Substudy:A subgroup of 2977 patients was evaluated for cognitive function and brain volume. The ACCORD MIND substudy excluded patients aged DesignPatients were randomly assigned to undergo either intensive glycemic control (targeting a glycated hemoglobin level EYE Substudy:EYE Substudy patients were evaluated at two standardized and comprehensive eye examinations for the effects of the ACCORD interventions at 4 years on the progression of diabetic retinopathy by 3 or more steps on the Early Treatment Diabetic Retinopathy Study Severity Scale (as assessed from seven-field stereoscopic fundus photographs, with 17 possible steps and a higher number of steps indicating greater severity) or the development of diabetic retinopathy necessitating laser photocoagulation or vitrectomy.MIND Substudy:The cognitive primary outcome, the Digit Symbol Substitution Test (DSST) score, was assessed at baseline, 20 and 40 months. Total brain volume (TBV), the primary brain structure outcome, was assessed with MRI at baseline and 40 months in a sub-set of 632 patients. All patients with follow-up data were included in the primary analyses.ConclusionsGlycemia Trial:As compared with standard therapy, the use of intensive therapy to target normal glycated hemoglobin levels for 3.5 years increased mortality and did not significantly reduce major cardiovascular events. (NEJM. 2008; 358(24): 2545-59).Microvascular Outcomes of the Glycemia Trial:Intensive therapy did not reduce the risk of advanced measures of microvascular outcomes, but delayed the onset of albuminuria and some measures of eye complications and neuropathy. Microvascular benefits of intensive therapy should be weighed against the risk of increased total and cardiovascular disease-related mortality, increased weight gain, and higher risk for severe hypoglycemia. (Lancet. 2010; 376(9739): 419-30)Lipid Therapy Trial:The combination of fenofibrate and simvastatin did not reduce the rate of fatal cardiovascular events, nonfatal myocardial infarction or nonfatal stroke, as compared with simvastatin alone. These results do not support the routine use of combination therapy with fenofibrate and simvastatin to reduce cardiovascular risk in the majority of high-risk patients with type 2 diabetes (NEJM. 2010; 362(17): 1563&#8211;1574).Blood Pressure Trial:In patients with type 2 diabetes at high risk for cardiovascular events, targeting a systolic blood pressure of less than 120 mm Hg, as compared with less than 140 mm Hg, did not reduce the rate of a composite outcome of fatal and nonfatal major cardiovascular events (NEJM. 2010; 362: 1575-1585).EYE Substudy:Intensive glycemic control and intensive combination treatment of dyslipidemia, but not intensive blood-pressure control, reduced the rate of progression of diabetic retinopathy (NEJM. 2010; 363: 233-244).MIND Substudy:Although significant differences in TBV favored the intensive therapy, cognitive outcomes were not different. Combined with the unfavorable effects on other ACCORD outcomes, MIND findings do not support using intensive therapy to reduce the adverse effects of diabetes on the brain in patients similar to MIND patients (Lancet Neurol. 2011; 10(11): 969&#8211;977).

  Study phs003562

• Genetic analysis in an inherited cardiac arrhythmia

  To identify a causative gene for an inherited cardiac arrhythmia, exome sequence analysis was conducted in 6 patients and 5 controls.

  Study JGAS000041

• Cancer_Cell_Line_Exome_Sequencing_

  Genomic characterisation of a large series of cancer cell lines.

  Study EGAS00001000978

• Breast_cancer_topographs

  Breast cancer topography will be explored using a combination of multi-region whole geome sequencing and in-situ RNA sequencing of fixed tissue specimens.

  Study EGAS00001003698

• A Hematogenous Route for Medulloblastoma Leptomeningeal Metastases

  A Hematogenous Route for Medulloblastoma Leptomeningeal Metastases

  Dataset EGAD00001003907

• Next Generation Sequencing in an IBD Pedigree Exome Data

  We perform whole exome sequencing on samples from a large IBD pedigree. The selected samples are from more distantly related family members (healthy and with IBD) and a set of matched population (Ashkenazy Jewish ancestry) samples.

  Dataset EGAD00001000422

• Utility of ctDNA to support patient selection for early phase clinical trials: The TARGET Study

  The TARGET Study consists of 200 BAM files, for the 100 patients discussed in the publication. Each patient has a normal control BAM file and a ctDNA BAM file.

  Dataset EGAD00001004796

• Whole exome sequencing of a sinonasal glomangiopericytoma case

  The is dataset includes the whole exome sequencing of the tumor from a sinonasal glomangiopericytoma case together with the matching blood. The whole exome sequencing revealed somatic PIK3CA and CTNNB1 mutations.

  Dataset EGAD00001008291

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line WXS

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009758

• RNA-seq

  Stranded RNA-seq libraries were performed for 150 ng of mRNA using the TruSeq library kit (Illumina, San Diego, CA, USA). Libraries were sequenced on a NextSeq 2000 (Illumina) in a 2x50bp length.

  Dataset EGAD00001010841

• Evaluation of somatic mutations in cervicovaginal samples as a non-invasive method for the detection and molecular classification of endometrial cancer

  Evaluation of somatic mutations in cervicovaginal samples as a non-invasive method for the detection and molecular classification of endometrial cancer

  Dataset EGAD00001011123

• A Genome-Wide Association Comparative Analysis of Response of AF Patients to Rate Control Therapy; A Collaboration between the NIH Pharmacogenomics Research Network and the RIKEN Yokohama Institute Center for Genomic Medicine

  The goal of this study was to identify genetic predictors of response to rate control therapy in patients with AF. We conducted a genome-wide association study (GWAS) focusing on subjects with a history of atrial fibrillation. Rate control therapy for AF uses a range of drugs (beta-adrenergic receptor blockers, calcium channel blockers, and digitalis) to depress conduction through the AV node, thereby preventing rapid rates and minimizing symptoms. In large groups of patients, such as the Vanderbilt AF Registry (a clinical and genetic repository with over 1200 patients with ECG-confirmed AF) from which these study subjects were drawn, approximately 5% display failure of aggressive AV nodal-blocking therapy to control ventricular rate. In these patients, interruption of the AV node by ablation and pacemaker implantation are necessary for adequate rate control. Study cases were individuals who underwent AV node ablation and pacemaker implantation after combined therapy with 3 AV nodal-blocking agents was ineffective in rate control. Controls for this study were individuals who met standardized rate-control efficacy criteria (as described in AFFIRM study, Wyse et al, NEJM 2002; PMID: 12466506) for optimal rate control with 2 or fewer AV nodal-blocking agents. Two additional groups were genotyped by RIKEN: An additional group of patients with AF as well as subjects undergoing cardiac surgery in whom AF did not occur post-operatively. All study participants were recruited and treated/evaluated at Vanderbilt University Medical Center. This study was conducted by the Pharmacogenomics of Arrhythmia Therapy subgroup of the Pharmacogenetics Research Network, a nationwide collaboration of scientists studying the genetic contributions to drug response variability. Genotyping was performed by the RIKEN research institute in Japan using the Illumina 610 Quad Beadchip platform.

  Study phs000439

• Genetic Analysis of the Chiari I Malformation

  This study used whole exome sequencing (WES) on families affected with Chiari I Malformation (CM1). Individuals were recruited from the Republic of Tartarstan in the Russian Federation, where CM1 has a high prevalence (approximately 413 out of 100,000). At least one-third of these affected individuals have an affected relative. In collaboration with Dr. Enver Bogdanov of Kazan State Medical University, seven extended families affected with CM1 were identified. Eligible participants for this study were required to 1) have CM1 and a family member with syringomyelia or CM1, or 2) be a family member of a patient with CM1 and have at least two immediate family members diagnosed with CM1. Adults and minors were eligible for this study and recruitment was through self and physician referral. Patients were excluded if they had a contraindication to MRI scanning, were unable to understand the risks of testing, were under one year of age, or could not undergo MRI scanning without sedation. Study participants underwent SPGR (Spoiled Gradient Recalled) and T1-weighted MR-imaging of the brain and cervical spinal cord to assess the volume of the posterior fossa, as well as the presence of CM1. Individuals were defined as having CM1 if the inferior aspect of the cerebellar tonsils were lying &#8805;=2 mm caudal to the foramen magnum. Individuals were defined as having a small posterior fossa volume if the ratio of the posterior fossa volume to the supratentorial volume was &lt; 0.15. Sixty-two patients (both cases and controls) from the seven extended families had DNA extracted from blood lymphocytes contained in 10 milliliters of stored blood. Whole exome sequencing (WES) was performed by the National Intramural Sequencing Center (NISC). These genotype data, as well as the case-control phenotype data on CM1 diagnosis and small posterior fossa diagnosis, were made available to dbGaP.

  Study phs001795

• Shanghai Breast Cancer Genetics Study (SBCGS)

  The Shanghai Breast Cancer Genetics Study (SBCGS) includes data from four population-based studies conducted among Chinese women in urban Shanghai: the Shanghai Breast Cancer Study (SBCS), the Shanghai Breast Cancer Survival Study (SBCSS), the Shanghai Women&#39;s Health Study (SWHS), and the Shanghai Endometrial Cancer Study (SECS, contributing controls only). Shanghai Breast Cancer Study (SBCS): The SBCS is a population-based, case-control study conducted in urban Shanghai. Subject recruitment in the initial phase of the SBCS (SBCS-I) was conducted between August 1996 and March 1998. The second phase (SBCS-II) of recruitment occurred between April 2002 and February 2005. Breast cancer cases were identified through the population-based Shanghai Cancer Registry and supplemented by a rapid case-ascertainment system. Controls were randomly selected using the Shanghai Resident Registry. Approximately 3500 cases and 3500 controls were recruited in the study. Shanghai Breast Cancer Survival Study (SBCSS) and Shanghai Endometrial Cancer Study (SECS): The SBCSS also used the population-based Shanghai Cancer Registry to identify newly diagnosed breast cancer cases. A total of 5,046 breast cancer patients were recruited. In-person interviews were conducted to collect information on known breast cancer risk factors and anthropometrics by using protocols and questionnaires similar to those used in the SBCS. For genetic studies, controls for the SBCSS cases came from the SECS, which recruited healthy women between January 1997 and December 2003. With the exception of a few questions related specifically to breast or endometrial cancer risk, the questionnaires used in the SECS and the SBCS were very similar. Shanghai Women&#39;s Health Study (SWHS): The SWHS is a population-based prospective cohort study of approximately 75,000 adult women who were recruited between 1997 and 2000. The cohort has been followed by a combination of record linkage and active follow-ups. Breast cancer patients identified in the SWHS and non-cases were included in the current study.

  Study phs001088

• Multicenter International Lymphangioleiomyomatosis Efficacy of Sirolimus Trial (The MILES Trial)

  Lymphangioleiomyomatosis (LAM) is an uncommon, progressive, cystic lung disease that predominantly affects young women. It is believed to be caused by defects within cellular pathways that regulate nutrient uptake, cell size, cell migration, and cell proliferation. The disease is caused by mutations in tuberous sclerosis complex (TSC) genes. Individuals with Lymphangioleiomyomatosis (LAM) often experience pneumothorax and chylothorax, as well progressive loss of lung function. Lymphangioleiomyomatosis (LAM) is frequently fatal and existing therapies for the disease have not proven effective. Lung transplantation can be considered as a last option, but alternative treatments are needed. Sirolimus is an immunosuppressive drug that is often used in people who have had kidney transplants. It directly affects the genetic pathway that causes Lymphangioleiomyomatosis (LAM). This study will evaluate the safety and effectiveness of sirolimus in stabilizing or improving lung function in people with Lymphangioleiomyomatosis (LAM). Individuals interested in participating in this 2-year, double-blind study will first report to the study sites for pulmonary function testing to determine their eligibility for participation. Participants deemed eligible will be randomly assigned to receive either sirolimus or placebo for 1 year. Sirolimus or placebo will be administered in 2 tablet doses (2 mg for sirolimus) for the duration of the study. Study visits will occur at baseline, Week 3, every 3 months for 12 months, and Months 18 and 24. Study visits will include a physical exam, questionnaires, a pregnancy test, blood and urine collection, and functional lung tests. A 6-minute walk test will occur at most study visits; a chest x-ray will be taken at baseline and Month 24; and a volumetric computed tomography scan will occur at baseline Month 12, and Month 24. Adverse events, medication side effects, and lung function will be assessed at each visit.

  Study phs000605

• The Sea Islands Genetic Network (SIGNET): Identifying genetic contributors to diabetes and dyslipidemia in African Americans

  Recent genome-wide association studies (GWAS) have successfully identified genetic variants that influence diabetes risk in European populations, however most do not have a major impact on diabetes risk in populations of African descent. The African American (AA) population from the Sea Islands of coastal South Carolina and Georgia has high rates of type 2 diabetes, low levels of admixture, and in general, consume a diet rich in saturated fats. We postulate that this unique combination of ancestral and environmental factors results in a more consistent penetrance of diabetes risk alleles, as well as enrichment of risk alleles of African origin. The existing DNA samples and rich phenotypic data from the Sea Island Families Project comprise a unique resource for genetic studies of type 2 diabetes and related metabolic traits such as dyslipidemia. Our central hypothesis is that the increased risk for T2DM in AA compared with European American (EA) is due, in part, to susceptibility alleles of African origin, and that these alleles can be identified using a GWAS. The Specific Aims are to: 1) Identify genetic risk factors for type 2 diabetes utilizing DNA samples and data from the Sea Island Families Project, Reasons for Geographic and Racial Differences in Stroke (REGARDS) Study recruited from SC, GA, NC, and AL; and a GWAS approach; 2) Identify genetic contributors to lipoprotein subclasses in African Americans using the lipoprotein subclass profile (particle size and concentration for multiple subclasses of VLDL, LDL, and HDL) assessed by NMR at LipoScience, Inc., and the GWAS data from Aim 1. The rationale for this project is that identification and validation of novel pathophysiological pathways and informed selection of candidate genes for diabetes risk will inform development of new, targeted prevention and treatment strategies in this underserved, high risk population.

  Study phs000433

• National Institute on Aging - Late Onset Alzheimer's Disease Family Study: Genome-Wide Association Study for Susceptibility Loci

  Alzheimer disease is the most common neurodegenerative disorder of the elderly affecting an estimated five million Americans. Genetic factors contribute to the risk for disease with heritability estimates ranging from 57% to 79%. More than a decade ago, the &#949;4 variant of APOE was identified and remains the most consistently replicated genetic variant influencing the risk of late onset Alzheimer disease. A segregation analysis suggests there may be four additional genes influencing the age-at-onset of Alzheimer disease. In 2007 there were 968 association studies in 398 candidate genes reported, but none replicated consistently. There are many reasons for the lack of consistency, but one important reason for the lack of progress is the paucity of a sufficient number of well characterized families and patients available to the entire scientific community. The extensive effort and expense required to ascertain such a population has been addressed by the NIA-LOAD Family Study. Its goal is to identify and recruit families with two or more siblings with the late-onset form of Alzheimer&#39;s disease and a cohort of unrelated, non-demented controls similar in age and ethnic background, and to make the samples, the clinical and genotyping data and preliminary analyses available to qualified investigators world-wide. Genotyping by the Center for Inherited Disease Research (CIDR) was performed using the Illumina Infinium II assay protocol with hybridization to Illumina Human 610Quadv1_B Beadchips. This genotyping represents the largest collection of families ever assembled with Alzheimer&#39;s disease combining the NIA-LOAD Genetics Initiative Multiplex Family Study, the National Cell Repository for Alzheimer&#39;s Disease (NCRAD) with additional controls from the University of Kentucky. These genotyping results will serve as a focal point for future research that will identify all of the remaining genetic variants in Alzheimer&#39;s disease.

  Study phs000168

• Childhood Cancer Data Initiative (CCDI): Enhancement of Data Sharing in Pediatric, Adolescent and Young Adult Cancers

  NCI's Childhood Cancer Data Initiative (CCDI) is building a community centered around childhood cancer care and research data. Through enhanced data sharing, we can improve our understanding of cancer biology to improve preventive measures, treatment, quality of life, and survivorship, as well as ensure that researchers learn from every child with cancer. While childhood cancers represent the leading cause of death in children over the age of 1, they are collectively rare, comprising approximately 1%&#8210;3% of cancers diagnosed annually in the United States. Information on diagnosis, treatment, and outcomes is often stored at the hospital or institution where a child is treated, making it difficult to answer scientific questions about childhood cancer. Sharing clinical care and research data generated by children's hospitals, clinics, or networks broadly with the community can help us learn faster and, on a scale much larger than any single institution caring for children can learn on its own. To exploit the rapid advances in high-throughput DNA sequencing technologies and realize the goals of precision cancer medicine, the UMICH Cancer Center established the Michigan Oncology Sequencing Center (MI-ONCOSEQ). This UMICH Cancer Center provisions genomic data derived from the Michigan Oncology Sequencing Center (MI-ONCOSEQ) clinical sequencing assay for patients that fall within the inclusion criteria of the CCDI data sharing initiative. An "integrative sequencing approach" carried out in a CLIA-certified laboratory is utilized to provide a comprehensive landscape of the genetic alterations in individual tumor specimens for the purpose of identifying informative and/or actionable mutations. Using a number of computational pipelines that we have developed in-house or have adapted from the public domain, candidate molecular aberrations are nominated and then analyzed by scientists for clinical significance and/or relevance. This approach enables the detection of point mutations, insertions/deletions, gene fusions and rearrangements, amplifications/deletions, and outlier expressed genes. Furthermore, we can identify certain germline alterations that may also be relevant.

  Study phs002431