10639 results for "800k fc coins Navštivte Buyfc26coins.com Speciální balíčky na prázdniny a dovolené..dQVy"

in 41.04 milliseconds.

• All you need to know about our new DAC Portal

  With the DAC Portal, it is possible to streamline the process of managing access to sensitive data, ensuring that researchers have the necessary resources to advance scientific discovery while maintaining the highest standards of data protection and privacy. We know that, as a new tool, its first use can be complex. For this reason, in this article we will try to show all the elements of interest. Enjoy! Credentials: who needs to create a new user to access the DAC Portal and who doesn't? Only new users (since September the 12th) need to create an EGA account to access the DAC Portal. The EGA team went one step ahead by creating EGA accounts for former DAC members to login to the DAC Portal. These accounts are linked to the personal email used in the DAC structure: To check the linked email, DAC members can paste the DAC ID right after this link: https://metadata.ega-archive.org/dacs/ (e.g. https://metadata.ega-archive.org/dacs/EGAC00001002543) In case of password oblivion, it is possible to set a new one. All the process is channelled through the personal email. Some DAC members may be interested in updating the DAC email. This action can be done contacting our Helpdesk team. For the correct functioning of the DAC Portal, users must add the missing information of the DAC Profile. For a deeper dive, check out our documentation. The first step: knowing your workspace on the Portal Once logged in to the platform using the EGA User credentials, note the sections available: DACs and Policies. In the first one it is possible to check all user's registered DACs by default. It provides a comprehensive overview of each DAC, including its EGA accessions (EGAC), title, status, and the number of data access requests associated with each DAC. Whereas the Policies section is where users can manage and view all their registered policies, along with their associated EGA accessions, links, and titles. A drop-down menu is available with shortcuts to the most useful pages in the top right corner. It is possible to check DACs and policies, as well as creating new ones. In this menu, users can also contact the Helpdesk team using the “Need Help?” section to make inquiries about DACs and policies. Comprehending the DACs list & making the most of all the features Colours are crucial in the DAC's section as they will indicate the user role and the status in every committee, namely: Yellow: you are the administrator of the DAC and have full control to add other contacts, modify the content, and manage data access requests. Orange: you are a member of the DAC and have the authority to manage data access requests but cannot make any changes to the content. Blue: you have been invited to join the DAC and need to either accept or decline the invitation. Grey: the DAC is currently pending validation by the EGA Helpdesk team. Red: the DAC has been declined by the EGA Helpdesk team. Discover more information on how to view the message from Helpdesk containing the declination reason or how to validate or reject a DAC invitation by taking the tour of the DAC Portal. How to create, register and edit a DAC Creating a DAC is an easy process that only requires users to complete the necessary information. After that, the EGA Helpdesk team will review the proposal and validate the proposal. Once the DAC is validated it is possible for authorised users with admin role to edit it at any time, ensuring that all information and contacts associated with the committee is accurate and up to date. Membership management is controlled by searching for the EGA user looking for their username, email, or organisation. Please, note that for a person's details to appear in this search engine, they must have registered as a EGA user. Data Access Committee administrators manage two types of permissions that apply to contacts: Main contact and Role. Both can be modified at any time: Main contact refers to the primary person we firstly contact for any inquiry about the DAC (please, note that we can contact all DAC members, and this refers to the person we will contact first). Role defines the actions that can be taken by each contact. There are two possible status, admin and member, details of which can be found in the Take the Tour. Keep in mind that, to save the modifications, it is always necessary to click on “Update”. Moreover, it is also possible to delete any contact in a DAC whenever it is needed. The data request process: how to manage access requests The data request process is now channelled through the EGA website. Once a user sends a request access, the petition will go directly to the DAC Portal profile of the DAC members liked to the requested dataset. Whenever a request is received, a sand clock symbol will be displayed next to the DAC responsible for the dataset involved. By clicking on the DAC, it is possible to discover more information about requester(s). In this section, DAC Portal users will also be able to modify the display of the data access requests. It is possible to group requests by dataset accession or username, depending on the user preferences. Additionally, it is possible to isolate specific requests by user or dataset. To accept a request, users must slide the button to the right. Once the button turns green, it signifies that the request is accepted; the requester will be granted access to the requested dataset. To make lives easier, we have implemented a “Select all” button to easily accept or revoke multiple requests at once. To decline requests, it is necessary to slide the button to the left. A red button means the requester will not be granted access to the dataset. The DAC Portal will always ask to submit the reason why the data access was denied. Please, note that any decision, grant or denial, must be confirmed clicking the "Apply" button. This will update the status of the request and notify the requester accordingly. Taking control of the activity in the DAC Portal: checking the requests history The History button is a useful feature that allows users to access a list of all the requests that have been granted. This is especially useful for auditing purposes, as it enables to keep track of who has been granted access to the data and when. To facilitate control for those users with several requests we have included a filtering option. It allows to filter requests by user, mail, dataset, EGA ID, and date (these are combinable to boost the search). Don't forget about policies: creation, management, and update Similarly to the DACs section, in the Policies one users can manage and view all their registered policies. By clicking on any policy, it is possible to view its details as well as making any necessary updates or modifications. The sheets symbol and its adjacent number indicate the quantity of objects using a policy. By clicking in the location symbol users will go directly to the DAC page on the DAC Portal to see more information about that DAC. DAC Portal users can create new policies. The first step requires to link the policy to a registered DAC. After defining the title, users can either add a link to an external URL containing terms & conditions or write the policy content directly on the DAC Portal. Keep in mind that both options can be included. Data Use Ontology (DUO) codes can be added to new policies. These codes are used to specify the permitted and prohibited uses of the data. Please, note that some of them require a modifier to provide additional specificity. Find out more by checking out this specific content on the DAC Portal Tour. Policies can be modified at any given time by clicking on one registered policy, which will display the current information.

  Blog new-dac-portal

• Detection of Colorectal Cancer Susceptibility Loci Using Genome-Wide Sequencing

  The Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO) is a collaborative effort comprised of a coordinating center and scientific researchers from well-characterized cohort and case-control studies. This international consortium aims to accelerate the discovery of common and rare genetic risk variants for colorectal cancer by conducting large-scale meta-analyses of existing and newly generated genome-wide association study (GWAS) data, whole genome sequencing, replicating and fine-mapping of genetic discoveries, and investigating how genetic risk variants are modified by environmental risk factors. To expand these efforts, we assembled case-control sets or nested case-control sets from 6 different North American or European studies. Summary descriptions and study participant inclusions/exclusion criteria for each of these studies are detailed below. Cancer Prevention Study II (CPS II): The CPS II Nutrition cohort is a prospective study of cancer incidence and mortality in the United States, established in 1992 and described in detail elsewhere (Calle et al., 2002 PMID:12015775; Campbell et al., 2014 PMID:25472679). At enrollment, participants completed a mailed self-administered questionnaire including information on demographic, medical, diet, and lifestyle factors. Follow-up questionnaires to update exposure information and to ascertain newly diagnosed cancers were sent biennially starting in 1997. Reported cancers were verified through medical records, state cancer registry linkage, or death certificates. The Emory University Institutional Review Board approves all aspects of the CPS II Nutrition Cohort. We restricted to samples that had blood DNA source. Controls were matched to cases in a case/control ratio of 2:1 on reference year and sex. Darmkrebs: Chancen der Verhütung durch Screening (DACHS): This German study was initiated as a large population-based case-control study in 2003 in the Rhine-Neckar-Odenwald region (southwest region of Germany) to assess the potential of endoscopic screening for reduction of colorectal cancer risk and to investigate etiologic determinants of disease, particularly lifestyle/environmental factors and genetic factors. Cases with a first diagnosis of invasive colorectal cancer (International Classification of Diseases 10 codes C18-C20) who were at least 30 years of age (no upper age limit), German speaking, a resident in the study region, and mentally and physically able to participate in a one-hour interview, were recruited by their treating physicians either in the hospital a few days after surgery, or by mail after discharge from the hospital. Cases were confirmed based on histologic reports and hospital discharge letters following diagnosis of colorectal cancer. All hospitals treating colorectal cancer patients in the study region participated. Based on estimates from population-based cancer registries, more than 50% of all potentially eligible patients with incident colorectal cancer in the study region were included. Community-based controls were randomly selected from population registries, employing frequency matching with respect to age (5-year groups), sex, and county of residence. Controls with a history of colorectal cancer were excluded. Controls were contacted by mail and follow-up calls. The participation rate was 51%. During an in-person interview, data were collected on demographics, medical history, family history of CRC, and various life-style factors, as were blood and mouthwash samples. Routine formalin-fixed, paraffin-embedded (FFPE) tumor samples from the patients enrolled were requested from the pathology institutes and used for tumor tissue analyses. This analysis includes participants with blood source DNA that were recruited up to 2010 in this ongoing study. Controls were matched to cases on reference age and sex in a case/control ratio of 2:1. Health Professionals Follow-up Study (HPFS): A parallel prospective study to the NHS (Nurses' Health Study). The HPFS cohort comprised 51,529 men aged 40-75 who, in 1986, responded to a mailed questionnaire (Rimm et al., 1990 PMID:2090285). Participants provided information on health related exposures, including current and past smoking history, age, weight, height, diet, physical activity, aspirin use, and family history of colorectal cancer. Colorectal cancer and other outcomes were reported by participants or next-of-kin and were followed up through review of the medical and pathology record by physicians. Overall, more than 97% of self-reported colorectal cancers were confirmed by medical record review. Information was abstracted on histology and primary location. Incident cases were defined as those occurring after the subject provided the blood sample. Prevalent cases were defined as those occurring after enrollment in the study but before the subject provided the blood sample. Follow-up evaluation has been excellent, with 94% of the men responding to date. Colorectal cancer cases were ascertained through January 1, 2008. In 1993-1995, 18,825 men in the HPFS mailed blood samples by overnight courier, which were aliquoted into buffy coat and stored in liquid nitrogen. In 2001-2004, 13,956 men in the HPFS who had not provided a blood sample previously mailed in a swish-and-spit sample of buccal cells. Incident cases were defined as those occurring after the subject provided a blood or buccal sample. Prevalent cases were defined as those occurring after enrollment in the study in 1986, but before the subject provided either a blood or buccal sample. Participants with histories of cancer (except nonmelanoma skin cancer), ulcerative colitis, or familial polyposis, case-control sets were excluded. Control participants were required to be free of invasive colorectal cancer and non-invasive (stage 0 in situ) colorectal cancer. For this study, only European ancestry participants with blood source DNA and incident colorectal cancer cases were eligible for selection. Since enrollment year and sex matched exactly, controls were randomly selected in a case/control ratio of 2:1. Nurses Health Study (NHS): The NHS cohort began in 1976 when 121,700 married female registered nurses age 30-55 years returned the initial questionnaire that ascertained a variety of important health-related exposures (Belanger et al., 1978 PMID:248266). Since 1976, follow-up questionnaires have been mailed every 2 years. Colorectal cancer and other outcomes were reported by participants or next-of-kin and followed up through review of the medical and pathology record by physicians. Overall, more than 97% of self-reported colorectal cancers were confirmed by medical-record review. Information was abstracted on histology and primary location. The rate of follow-up evaluation has been high: as a proportion of the total possible follow-up time, follow-up evaluation has been more than 92%. Colorectal cancer cases were ascertained through June 1, 2008. In 1989-1990, 32,826 women in NHS I mailed blood samples by overnight courier, which were aliquoted into buffy coat and stored in liquid nitrogen. In 2001-2004, 29,684 women in NHS I who did not previously provide a blood sample mailed a swish-and-spit sample of buccal cells. Incident cases were defined as those occurring after the subject provided a blood or buccal sample. Prevalent cases were defined as those occurring after enrollment in the study in 1976 but before the subject provided either a blood or buccal sample. Participants with histories of cancer (except nonmelanoma skin cancer), ulcerative colitis, or familial polyposis, case-control sets were excluded. For this study, only European ancestry participants with blood source DNA and incident colorectal cancer cases were eligible for selection. Since enrollment year and sex matched exactly, controls were randomly selected in a case/control ratio of 2:1. Prostate, Lung, Colorectal and Ovarian Cancer Screening Trail (PLCO): PLCO enrolled 154,934 participants (men and women, aged between 55 and 74 years) at ten centers into a large, randomized, two-arm trial to determine the effectiveness of screening to reduce cancer mortality. Sequential blood samples were collected from participants assigned to the screening arm. Participation was 93% at the baseline blood draw. White colorectal cancer cases with a family history of colorectal cancer (no history of ulcerative colitis, Crohn's Disease, diverticulitis, Gardner's syndrome, Familial Polyposis) and successful genotyping from previous Peters GWAS were selected for this project. Controls were matched to cases on reference age and sex in a case/control ratio of 2:1. Women's Health Initiative (WHI): WHI is a long-term national health study that has focused on strategies for preventing heart disease, breast and colorectal cancer, and osteoporotic fractures in postmenopausal women. The original WHI study included 161,808 postmenopausal women enrolled between 1993 and 1998. The Fred Hutchinson Cancer Research Center in Seattle, WA serves as the WHI Clinical Coordinating Center for data collection, management, and analysis of the WHI. The WHI has two major parts: a partial factorial randomized Clinical Trial (CT) and an Observational Study (OS); both were conducted at 40 Clinical Centers nationwide. The CT enrolled 68,132 postmenopausal women between the ages of 50-79 into trials testing three prevention strategies. If eligible, women could choose to enroll in one, two, or all three of the trial components. The components are: Hormone Therapy Trials (HT): This double-blind component examined the effects of combined hormones or estrogen alone on the prevention of coronary heart disease and osteoporotic fractures, and associated risk for breast cancer. Women participating in this component with an intact uterus were randomized to estrogen plus progestin (conjugated equine estrogens [CEE], 0.625 mg/d plus medroxyprogesterone acetate [MPA] 2.5 mg/d) or a matching placebo. Women with prior hysterectomy were randomized to CEE or placebo. Both trials were stopped early, in July 2002 and March 2004, respectively, based on adverse effects. All HT participants continued to be followed without intervention until close-out. Dietary Modification Trial (DM): The Dietary Modification component evaluated the effect of a low-fat and high fruit, vegetable and grain diet on the prevention of breast and colorectal cancers and coronary heart disease. Study participants were randomized to either their usual eating pattern or a low-fat dietary pattern. Calcium/Vitamin D Trial (CaD): This double-blind component began 1 to 2 years after a woman joined one or both of the other clinical trial components. It evaluated the effect of calcium and vitamin D supplementation on the prevention of osteoporotic fractures and colorectal cancer. Women in this component were randomized to calcium (1000 mg/d) and vitamin D (400 IU/d) supplements or a matching placebo. The Observational Study (OS) examines the relationship between lifestyle, environmental, medical and molecular risk factors and specific measures of health or disease outcomes. This component involves tracking the medical history and health habits of 93,676 women not participating in the CT. Recruitment for the observational study was completed in 1998 and participants were followed annually for 8 to 12 years. All centrally confirmed White cases of invasive colorectal cancer, or death from colorectal cancer were selected as potential cases from the March, 2011 database. Case priory lists are: 1) have positive family history of colorectal cancer; 2) randomly select cases until we get a total of n=800 cases. Control participants were required to be White, free of invasive colorectal cancer and non-invasive (stage 0 in situ) colorectal cancer. Centrally denied cases of colorectal cancer were not allowed into the control pool. Case and control participants were subject to the following exclusion criteria: (1) had prior history of colorectal cancer at baseline; (2) had no available DNA (DNA searching as Nov 15, 2012); (3) cannot be deposited to dbGaP; (4) lost to follow-up after enrollment; (5) selected for WHI study M26 Phase II. Controls were matched to cases in a case/control ratio of 2:1. In order to get 2 cases with 1 control, cases were grouped by enrollment year (a total of 5 groups). For each year group, around 50% cases were selected to match controls. In total, 401 cases were selected to match controls. Matching was done on enrollment year, which was matched exactly. For additional information, see dbGaP: phs000200 and ClinicalTrials: NCT00000611.

  Study phs001554

• The complex SNP and CNV genetic architecture of the increased risk of congenital heart defects in Down syndrome

  Here we aimed to contribute to the description of the genetic architecture of Congenital heart defect (CHD) in Down syndrome (DS), and report the results of a genome-wide association study using samples from DS individuals with and without CHD. CHD is a common developmental defect of DS occurring in 40% of cases. This case-control GWAS includes 187 DS with CHD as cases, and 151 DS without CHD as controls.

  Study EGAS00000000129

• DO NOT USE - Whole genome sequencing of SI-NETs from five patients

  Small intestine neuroendocrine tumor (SI-NET), the most common cancer of the small bowel, often displays a curious multifocal phenotype with several intestinal tumors centered around a regional lymph node metastasis, yet the typical path of evolution of these lesions remains unclear. Here, we determined the complete genome sequences of 37 tumors from 5 patients with multifocal SI-NET, allowing elucidation of phylogenetic relationships between multiple intestinal tumors and metastases in individual patients.

  Study EGAS00001004435

• Next Generation Mendelian Genetics: Familial Combined Hyperlipidemia

  The NHGRI Next Generation Mendelian Genetics project uses exome resequencing to identify variants in unsolved Mendelian diseases. The research study procedures included the collection of a fasting blood sample, 2 medical history/life style questionnaires and a measurement of subjects' waist circumference that were completed many years ago. Blood samples were analyzed for metabolic markers including cholesterol, HDL, triglycerides and APOE. Genetic tests targeted known and novel genes and polymorphisms associated with carotid artery disease.

  Study phs000538

• Sequencing of Cervical Cancer

  Precision mapping of genetic alterations in cancer can enable better selection of therapies and improved outcomes when combined with new sequencing diagnostics. We describe whole-exome sequences from cervical adenocarcinomas and paired normal samples in Hong Kong Chinese women. These data uncover a heterogeneous genomic landscape but identify commonly aberrant loci including FAT1, ARID1A, ERBB2 and PIK3CA that may provide a focus for the development of individualized targeted therapies for Chinese women with cervical adenocarcinoma.

  Study phs000723

• Andersen-Tawil Syndrome: Genotype-phenotype correlation and longitudinal study

  Andersen-Tawil Syndrome (ATS) is a rare, genetic disorder that causes episodes of muscle weakness, potentially life-threatening changes in heart rhythm, and developmental abnormalities. Disease symptoms can vary, the cause of some ATS cases remains unknown, and no specific treatment has been identified. The purpose of this multi-site study is to better characterize ATS, establish whether symptoms change over time, and determine if symptoms are related to a mutation in the KCNJ2 gene.

  Study phs001289

• Gene Expression of Small Cell Carcinoma of the Ovary-Hypercalcemic Type (SCCOHT)

  Small cell carcinoma of the ovary-hypercalcemic type (SCCOHT) is a rare and aggressive form of ovarian cancer afflicting young women at a median age of 24 years. SCCOHTs are characterized by loss of protein expression of SWI/SNF chromatin remodeling ATPases SMARCA4 and SMARCA2 through mutation and epigenetic silencing, respectively. This study aims to establish gene expression profiles of this cancer through RNA-Seq of fourteen pathologically confirmed cases of SCCOHT tumors.

  Study phs001528

• Stand Up 2 Cancer (SU2C) Genomics-Enabled Medicine for Melanoma (GEMM) Trial

  The goal of the GEMM Trial is to ascertain if comprehensive and systematic interrogation of a patient's tumor molecular profile improves outcomes compared to the current practice of physician's choice for metastatic melanoma patients who have progressed following first line therapy. The data shared here includes tumor/normal exome and tumor RNAseq data for the trial patients, as well as archival data for a subset of patients.

  Study phs001786

• The PUWMa (

  The PUWMa GWAS of ADHD is a multi-site collaboration initiated to conduct a family-based association study from existing research samples. The source sample of ADHD families was ascertained at Massachusetts General Hospital (MGH, N=309 trios), Washington University at St. Louis (WASH-U, N=272 trios), and University of California at Los Angeles (UCLA, N=156 trios). All offspring met criteria for DSM-IV-TR attention-deficit hyperactivity disorder with childhood onset.

  Study phs000358

• Germline Sequencing for Aggressive Prostate Carcinoma

  This study aims to elucidate the genetic determinants of susceptibility to aggressive prostate carcinoma. To this end, germ line whole exome sequence has been generated from patients with aggressive prostate cancer. Whole genome sequence for a representative subset of tumors from patients whose cancer was resistant to primary therapy is included as well. This deep genomic interrogation will allow the identification of rare, functionally disruptive variants that may play a role in disease progession and response to treatment.

  Study phs000661

• Ataxia Gene Identification by Integrated Genomic Analysis

  Ataxias are a group of diseases that result in a lack of coordinated muscle movement. Hereditary ataxias are genetically heterogeneous and it is reported that 40% of suspected genetic ataxias currently have an unknown cause. We used exome sequencing to detect mutations responsible for ataxia. We sequenced, when available, multiple individuals per family to identify family specific mutations and further confirmed segregation of variants using samples from available affected and unaffected family members.

  Study phs000757

• Breast Cancer Family Registry Early-onset Breast Cancer GWAS

  In order to enhance our understanding of the genetic etiology of breast cancer, this study analyzed 1,265,548 Hapmap3 single-nucleotide polymorphisms (SNP) among a discovery set of 3,523 EOBC incident cases and 2,702 age-matched population control women, all of whom were age 50 or younger at enrollment. Subjects were recruited from the eight sites, some of which oversampled cases with a personal or family history of breast cancer.

  Study phs001589

• Immune Dysregulation in Human Subjects with Heterozygous Germline Mutations in

  We identified germline heterozygous mutations in CTLA4 in members of four families with severe immune dysregulation. Human CTLA4 haploinsufficiency caused dysregulation of FoxP3+ regulatory T (Treg) cells and lymphocytic infiltration of target organs, mimicking Ctla4 homozygous mice. Patients also exhibited a B cell phenotype, with progressive loss of B cells and accumulation of autoreactive CD21lo B cells. This study demonstrates a critical quantitative role for CTLA-4 in human immune homeostasis.

  Study phs000797

• Identification of Novel Therapeutic Targets for Calcific Aortic Valve Stenosis Using Integrative Genomics

  In order to identify novel therapeutic targets for calcific aortic valve stenosis, we have generated a large transcriptomic dataset from RNA sequencing of human aortic valve tissues from 500 individuals undergoing aortic valve replacement or heart transplant at the Institut universitaire de cardiologie et de pneumologie de Québec – Université Laval (QUEBEC-CAVS-RNA). This dataset represents a unique resource to understand the molecular mechanisms underlying aortic valve diseases.

  Study phs003541

• High-Fidelity, Large-Scale Targeted Profiling of Microsatellites

  This study developed a novel method of targeted sequencing of microsatellites. We optimized every aspect of targeted hybridization capture geared towards minimizing artifacts that commonly occur in laboratory manipulation of microsatellite-containing DNA. This achieved a higher fidelity for microsatellite sequencing than standard targeted DNA sequencing. In the accompanying manuscript, we also introduce two computational tools for design of targeted microsatellite capture panels and for analyzing the resulting microsatellite sequencing data.

  Study phs003679

• Single cell and spatial transcriptomics of adult human adrenal glands

  Adrenal glands are endocrine organs secreting a variety of hormones, known to undergo tissue remodelling through constant cellular turnover. Here we employed single cell and spatial transcriptomics to investigate thoroughly adult human adrenals from 14 individuals with a focus on adrenocortical cell types and cell states. By including both male and female tissue donors of various ages, we extended the study to sexual dimorphic features of the adult gland.

  Study EGAS50000000269

• HGG panel sequencing

  NGS panel sequencing of pediatric high-grade gliomas (HGG), including diffuse midline gliomas and hemispheric HGG. This is a population-based dataset from the Hospital for Sick Children (Toronto, Canada), of patients <18 years of age at diagnosis, and diagnosed between 2000-2022. The goal of the study was to define the genetic drivers in pediatric HGG, including the rates of different genetic drivers, such as H3 and BRAF mutations, in a single-site population based cohort.

  Study EGAS50000000221

• Prognostic whole-genome and transcriptome signatures in colorectal cancers

  Colorectal cancer (CRC) is caused by a sequence of somatic genomic alterations affecting driver genes in core cancer pathways1. To understand the functional and prognostic impact of cancer-causing somatic mutations, we analysed the whole genomes and transcriptomes of 1,063 primary CRCs in a population-based cohort with long-term follow-up. This study constitutes the largest integrated genome and transcriptome analysis of CRC to date, and links mutations, gene expressions and patient outcomes.

  Study EGAS50000000124

• Targeting Heterochromatin Eliminates Malignant Stem Cells in Chronic Myelomonocytic Leukemia Through Reactivation of Retroelements and Innate Immune pathways

  Hematopoietic stem cell (HSC) aging involves heterochromatin reorganization. These repressive marks together with DNA methylation are essential for suppressing transposable elements (TEs). In this study we analyze heterochromatin and transcriptomic changes occurring at genes and TEs in HSCs from chronic myelomonocytic leukemia, a severe myeloid malignancy affecting the elderly, compared to age-matched cells, and in the presence or absence of a combination of epidrugs.

  Study EGAS50000000367

• Targeting Heterochromatin Eliminates Malignant Stem Cells in Chronic Myelomonocytic Leukemia Through Reactivation of Retroelements and Innate Immune pathways

  Hematopoietic stem cell (HSC) aging involves heterochromatin reorganization. These repressive marks together with DNA methylation are essential for suppressing transposable elements (TEs). In this study we analyze heterochromatin and transcriptomic changes occurring at genes and TEs in HSCs from chronic myelomonocytic leukemia, a severe myeloid malignancy affecting the elderly, compared to age-matched cells, and in the presence or absence of a combination of epidrugs.

  Study EGAS50000000688

• Whole Exome Sequencing of controls performed at the Broad Institute on a cohort from Bristol, UK

  These data were generated as part of a collaboration between University of Bristol, UK and the Stanley Center at the Broad Institute. This project sequenced and analysed the whole exomes of 2969 samples from the Avon Longitudinal Study of Parents and Children (ALSPAC). ALSPAC is a population-based pregnancy cohort with participants acting as ‘controls’ for this project. Genomic DNA from each sample was sequenced to a mean depth of 20x. The exome used Twist capture and samples were sequenced on Illumina NovaSeq 6000 machines producing CRAM files. ALSPAC recruited pregnant women in the Avon County of south-west England between 1991 and 1992. Of the 15,447 pregnancies, 14,901 children were alive at 1 year of age.  DNA was extracted from child blood samples taken between ages 7 and 24.

  Dataset EGAD50000000716

• Patient-derived models of primary breast cancer for preclinical development of novel neoadjuvant therapies

  Generation of the first large-scale cohort of mouse intraductal patient-derived xenograft (MIND-PDX) models of primary invasive breast cancer (IBC) and a collection of matched PDX-derived organoids (PDXO) representing all molecular subtypes of IBC, including estrogen receptor (ER-) positive breast cancer. Furthermore, we show that our IBC-MIND cohort can serve as a platform to test experimental neoadjuvant treatment options in different molecular subtypes of breast cancer.

  Study EGAS50000000398

• Transcriptome-Wide Association Study (TWAS) to Identify Susceptibility Genes for Colorectal Cancer

  This study included genotype data from 420 study participants of East Asian descent, along with RNA-seq (n=300) and small RNA seq data (n=400) generated from their colorectal tissue samples. We used the transcriptome data and genotype data from these individuals to build a prediction model for each coding gene and long non-coding RNA, and perform a Transcriptome-Wide Association Study (TWAS) of colorectal cancer in East Asian populations.

  Study phs002813

• Precision Interception of Gastric Cancer Precursors Through Molecular and Cellular Risk Stratification

  The GAstric Precancerous conditions Study (GAPS, NCT04191551) is a cross-sectional study of patients undergoing endoscopy who are at increased risk of gastric cancer. Enrolled patients are administered a standardized questionnaire, undergo clinical biopsy collection using the Sydney system, and consent for the collection of saliva, blood, and additional gastric tissue. All patients are scored for intestinal metaplasia using the operative link on gastric intestinal metaplasia (OLGIM) scoring system.

  Study phs003648

• Understanding Determinants of Racial Disparities in Lung Cancer Incidence

  This is a nested case-control study designed to evaluate the association between common genetic variants and the risk of lung cancer. The study included 1258 cases and 1252 controls selected from the Southern Community Cohort Study (SCCS), a large, prospective observational cohort. Cases were identified from cancer registries across the catchment area of the SCCS. Cases and controls were frequency matched on age, sex, race, and enrollment site (community health center vs general population).

  Study phs003789

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  99 FFPE derived tumor tissue DNA, 9 circulating tumor DNA samples and 38 paired germline DNA were used. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) at the National Genomic Analysis Center (CNAG, Barcelona, Spain) was performed.

  Study EGAS50000000371

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• Intratumoral Heterogeneity and Clonal Evolution Induced by HPV Integration

  The human papillomavirus (HPV) genome is integrated into host DNA in most HPV-positive cancers, but the consequences for chromosomal integrity are unknown. We used continuous long-read sequencing of oropharyngeal cancers and cervical cancer cell lines to resolve structural variation induced by HPV. We discovered a previously undescribed form of structural variation, "heterocateny," characterized by diverse, interrelated, and repetitive patterns of concatemerized virus and host DNA segments within a cancer.

  Study phs003396

• Whole genome sequencing data of pediatric TCF3::PBX1 acute lymphoblastic leukemia

  TCF3::PBX1 leukemia is a rare subtype of B-cell acute lymphoblastic leukemia (B-ALL), occurring in approximately 3–5% of pediatric cases. It results from a chromosomal translocation t(1;19)(q23;p13), generating the TCF3::PBX1 fusion gene, which disrupts normal transcriptional regulation and contributes to leukemogenesis. Although historically associated with poor prognosis, contemporary risk stratification and intensified therapy have significantly improved outcomes, and both 5-years DFS and OS are nowadays ≥ 0.96.

  Study EGAS50000001257

• Multi-omics analysis reveals immune programs delineating disease severity in extrapulmonary tuberculosis

  This study investigates the immune response in extrapulmonary tuberculosis (EPTB) using a combination of bulk and single-cell RNA sequencing. Hierarchical clustering of patient transcriptomes identified three distinct levels of disease severity, uncovering immunological pathways involved in disease progression, including interferon and IL-1β-mediated signaling. The findings also led to the development of a diagnostic gene expression signature for both EPTB and pulmonary TB, offering potential improvements in TB diagnosis and treatment.

  Study EGAS50000000668

• Cell-free DNA methylome and fragmentome analysis for disease relapse monitoring in patients with Ewing Sarcoma

  We conducted whole-genome and methylome sequencing of cfDNA from 87 serial samples of 23 patients with EwS and 3 patients with CIC-rearranged sarcoma (CIC). With EwingSign, a new machine learning model, we identified EwS or CIC in a test set for 11 out of 16 patients at diagnosis and 15 out of 18 clinically confirmed relapse events. 0 out of 24 non-cancer controls were detected positive with EwingSign.

  Study EGAS50000001415

• RNAseq of medulloblastoma data (MB_COMICS cohort)

  Medulloblastoma (MB) is the most common malignant brain tumor in children. It is a neuroectodermal tumor located in the cerebellum. International consensus recognizes four distinct subgroups of MBs including Wingless (WNT), Sonic Hedgehog (SHH), Group 3 (G3), and Group 4 (G4) with distinct molecular characteristics, prognoses, and mortality rates in patients. Here, we have compiled and evaluated a large international MB cohort for which we generated transcriptomic data (RNAseq) for 208 primary MB patient samples.

  Study EGAS50000000410

• Whole-exome sequencing of Helicobacter pylori-uninfected normal gastric gland

  Recent studies showed that somatic mutations accumulate in normal tissues with age; however, mutation accumulation in the Helicobacter pylori-uninfected normal gastric mucosa has not been reported. A total of 18 biopsied gastric mucosa were obtained from nine subjects without Helicobacter pylori-infection or gastric cancer. Gastric epithelia were manually dissociated from the lamina propria. Subsequently, single glands were picked up under a stereomicroscope. Genomic DNA isolated from each gland was subjected to whole-exome sequencing.

  Study JGAS000313

• Development of blood-based biomarkers for precision medicine in castration-resistant prostate cancer

  Cell-free DNA (cfDNA) testing is emerging as a tool for cancer precision medicine. However, little is known about the clinical significance of low-frequency variants detected in circulating cell-free tumor DNA (ctDNA) from castration-resistant prostate cancer (CRPC) patients. We conducted targeted sequencing of cfDNA and paired leukocyte DNA from CRPC patients using molecular barcodes, and ctDNA variants with a variant allele frequency ??? 0.1% were detected using an in-house pipeline.

  Study JGAS000330

• Deciphering the aggressive nature of morphoeic basal cell carcinoma

  Morphoeic basal cell carcinoma (mBCC) has a high risk of local recurrence compared to the more indolent nodular subtype reflected by a different set of driver mutations including FLNB and HECTD4. Surrounding mBCC stroma is abnormal, containing mutations such as EPHA3. Hedgehog pathway over-expression is seen in both the tumour and stroma of morphoeic tissue with the latter potentially being partly responsible for its aggressive nature and risk of recurrence.

  Study EGAS00001001915

• Sarcopenia related to Head and Neck squamous cell carcinomas: transcriptome modifications of muscle cells induced by distant malignant cells

  The biological mechanisms of sarcopenia are still very poorly understood, particularly in the case of Head and Neck Squamous Cell Carcinomas (HNSCC). However, there is good reason to believe that diffusible factors originating from tumor cells exert a distant deleterious effect on muscle cells. To test this hypothesis we implemented a dual approach based both on experiments carried out in vitro and on the study of muscle fragments from patients.

  Study EGAS50000000669

• High Altitude Pulmonary Hypertension

  The Central Asian Kyrgyz highland population provides a unique opportunity to address genetic diversity and understand the genetic mechanisms underlying hypoxia-induced high altitude pulmonary hypertension (HAPH). While a significant fraction of the population is unaffected, there are susceptible individuals who display HAPH in the absence of any lung, cardiac or hematologic disease. We report herein the analysis of the whole genome sequencing of healthy individuals compared with HAPH patients and other controls.

  Study EGAS00001003171

• IgCaller

  IgCaller is a python program designed to fully characterize the immunoglobulin (IG) gene rearrangements and oncogenic translocations in lymphoid neoplasms from whole-genome sequencing (WGS) data. Using a cohort of 331 patients comprising different subtypes of B-cell neoplasms, we demonstrate that IgCaller identifies both heavy and light chain rearrangements providing additional information on their functionality, somatic mutational status, class switch recombination, and oncogenic IG translocations. We provided here IG reads of the previously unpublished WGS.

  Study EGAS00001004298

• Sequencing of an organoid biobank for childhood soft tissue sarcoma.

  Rhabdomyosarcomas are diverse tumors of mesenchymal origin and the most common childhood soft tissue sarcoma. Patients receive intense treatment with a nevertheless poor prognosis for high-risk patients. New therapy would benefit from additional preclinical models and their rapid establishment. Tumor organoid models (tumoroids) have so far only been established from epithelial cancers. Here, we describe generation and characterization of a collection of pediatric RMS tumoroids comprising all major subtypes.

  Study EGAS00001005912

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• Egypt_Genome_Project___low_coverage_whole_genome_sequencing

  All humans outside Africa are descendants of the same single exit, usually dated at 50-70 thousand years ago. However, the route taken out of Africa is still debated. The two main candidates are a northern route via Egypt and the Levant, or a southern route via Ethiopia and the Arabian Peninsula. We are generating genetic data to evaluate these two possibilities. In this study we propose to generate low-coverage sequencing data for 100 Egyptian samples.

  Study EGAS00001000480

• Exploration_of__mutational_processes_in_human_cancer_cell_lines__Exome

  Approximately 25 cell lines representative of 11 mutation signatures have been selected and will be grown from a single cell, referred to as parental clone, for a period of 3 months to allow accumulation of mutations. Following that period, we will obtain 2 subclones from each of the parental clone for sequencing analysis. In total we will be sequencing 2 parental clones and 4 subclones per cell line for approximately 25 cell lines.

  Study EGAS00001000790

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• Whole_genome_sequencing_of_a_Grem1_mutant_human_tumour

  The BMP antagonist Grem1 has been shown to be associated with a rare human polyposissyndrome (HMPS). We have shown that there is a 40KB duplication on chrom 15 found insome patients with HMPS. Traditional serrated adenomas (rare sporadic polyps) share somemorphological features with HMPS polyps and it has long been hypothesised that they are thesporadic version of HMPS polyps. We have obtained of one of theselesions and in this project we aim to characterise this tumour.

  Study EGAS00001000562

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Much ado about nothing? - Off-target amplification can lead to false positive bacterial brain microbiome detection in healthy and Parkinson's disease individuals

  Recent studies suggested the existence of (poly-)microbial infections in human brains. Using 16S rRNA gene amplicon sequencing, we tested the hypothesis that there is a bacterial brain microbiome. We evaluated brain samples from healthy human subjects and individuals suffering from PD (olfactory bulb and pre-frontal cortex). We identified off-target amplification as a major confounding factor in low-bacterial/high-host-DNA scenarios.

  Study EGAS00001004757

• Spatial Heterogeneity in CLL

  A whole-genome/exome sequencing (WGS/WES) characterization of the spatial heterogeneity found in chronic lymphocytic leukemia (CLL) at diagnosis. Fifteen synchronous peripheral blood and lymph node samples were analyzed by WGS (n=2) or WES (n=13). Subtle differences in the global architecture of the tumor at peripheral blood and lymph node were observed only in a fraction of patients. Spatial heterogeneity was not found among the well-established CLL driver alterations.

  Study EGAS00001003803

• Distinct genomic profile and specific targeted drug responses in adult cerebellar glioblastoma

  Only a few studies have reported the molecular characteristics of adult cerebellar glioblastoma (C-GBM), a subtype comprising 1% of glioblastoma cases located within the infratentorial brain region due to the rarity. By identifying genomic profiles from 19 adult C-GBM samples, we revealed the genetic intertumoral heterogeneity in C-GBM as well as distinct genomic characteristics from those of supratentorial glioblastomas (S-GBMs), emphasizing the need of individualized therapies for C-GBM patients.

  Study EGAS00001002517

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Whole-exome sequencing of ovarian clear cell carcinoma in clinical outliers

  Whole-exome sequencing dataset for the Australian Ovarian Cancer Study (AOCS) and The Jikei University School of Medicine (JIKEI) ovarian clear cell carcinoma (OCCC) clinical outliers project, representing 10 donors. Although OCCC are commonly resistant to platinum based chemotherapy, good clinical outcomes are observed in a subset of patients. Exome sequencing was performed in 10 patients who had either unusually long survival (N=5) or had a very short time to progression (N=5).

  Study EGAS00001004248

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Nasal epithelial cells of PCD and non-PCD patients grown at air-liquid interface for RNAseq analysis

  Raw RNAseq data files of genetically unsolved PCD patients used for transcriptomic analysis aming to uplift the diagnostic rate. The non-PCD patients were used as a clinical comparator to the PCD patients. Majority of the nasal epithelial cells used for RNAseq were cultured at an air-liquid interface for 21 days, unless the data file name indicates a different air-liquid-culture time-point.

  Study EGAS00001006632

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• Genetic scoring guide for personalized risk assessment in pediatric B-cell precursor Acute Lymphoblastic Leukemia

  In this study a next-generation sequencing based method was applied to comprehensively screen for recurrent, disease-relevant copy number aberrations in a cohort of Hungarian patients. Diagnostic bone marrow samples from 260 children with B-cell acute lymphoblastic leukemia and were investigated by digital multiplex ligation-dependent probe amplification using the disease-specific D007 probemix. Whole chromosome gains and losses, as well as subchromosomal copy number aberrations were simultaneously profiled.

  Study EGAS00001007239

• Clonal_selection_after_gene_therapy_in_SCD___Duplex_sequencing

  This study includes the targeted duplex sequencing data relating to this study. A custom targeted panel was used including 29 AML-associated genes, and a set of mutations from driver-containing clones that were sequenced during the WGS tree-building phase of the study. Targeted sequencing is performed on each of 6 individuals included at the study at at least 3 time points per individual: one prior to gene therapy, and two post-therapy time points.

  Study EGAS00001007253

• RNA sequencing in primary human macrophages overexpressing ETS2

  We investigated an intergenic haplotype on chr21q22, linked to five different inflammatory diseases, and discovered a mechanism that orchestrates macrophage responses during chronic inflammation. We delineated how the risk haplotype increases expression of the causal gene, ETS2, and demonstrated that ETS2 is necessary for inflammatory macrophage effector functions. To establish whether ETS2 is sufficient to drive inflammatory responses, we overexpressed ETS2 in a dose-dependent manner and performed RNA-sequencing to characterise the transcriptional effects.

  Study EGAS00001007554

• Somatic mutation and clonal evolution in premalignant lung disease - WGS (2020-01-15)

  Cancer is a genetic disease caused by an accumulations of mutations, however many of these mutations have been identified in pathologically normal tissue. We aim to use laser-capture microscopy (LCM) to sample individual clones from the lung tissue of individuals with a variety of lung diseases (COPD, UIP, IPF, Emphysema, pulmonary hypertension). This will allow us to identify whether cancer-associated mutations appear in this normal tissue, assess the mutational burden present, and identify the mutational processes causing these mutations. Smoking is a large risk factor for developing many of these lung diseases so we are particularly keen to determining whether there is evidence of a smoking signature in these patients. . This dataset contains all the data available for this study on 2020-01-15.

  Dataset EGAD00001005786

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• Evaluating gene expression in aggressive B-cell lymphoma using a quantitative nuclease protection assay

  Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma (NHL), comprising 25-30% of all NHL in developed countries with an annual incidence in the USA of 7 cases/100000 persons/year. Collectively, DLBCL is classified based on a common morphological appearance of diffuse growth of large transformed B-cells, immunophenotype, high proliferation rate and aggressive behaviour. Despite these similarities, DLBCLs are a heterogeneous collection of malignancies with distinct clinical and molecular characteristics that do not always correlate with immunohistological features. This gene expression dataset includes transcriptomes of ABC-DLBCLs and of GCB-DLBCLs where cell of origin is determined by the HTG-EdgeSeq quantitative nuclease protection assay. Also included are clonality results from BCR profiling from high-grade B-cell lymphomas sequenced using a NOVA sequencer

  Dataset EGAD00001011309

• Organ maturation in preparation for birth (Peds RFA) to develop a tissue resource and a single-cell atlas of organ development and maturation for dissemination among the scientific and clinical community: RNA (2025-10-14)

  Knowledge about abnormal organ development is important to understand pathology and to develop novel treatment approaches for individuals with congenital and acquired disease. Most of our current understanding is based on examination of tissues from the embryo and early foetus, collected from women undergoing termination of pregnancy in the first trimester (third) of pregnancy. There is very little known about normal and abnormal organ development from a developmental perspective during the crucial last two-thirds of pregnancy when much remodelling of foetal tissues occurs. This study will generate a single-cell atlas of late-foetal lungs, blood, heart, bone and immune organs. . This dataset contains all the data available for this study on 2025-10-14.

  Dataset EGAD00001015737

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria (2018-03-14)

  Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria. There are more than 100 genes known for congenital disorders of glycosylation and new disorders are discovered each year. WE included patients with a so far unsolved glycosylation disease. The diagnostic group 3-methyglutaconic aciduria is a heterogenous group of disorders mostly caused by abnormal phospholipid synthesis or in association with mitochondrial dysfunction. We included patients with a so far unsolved disease and 3-methylglutaconic aciduria. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ . This dataset contains all the data available for this study on 2018-03-14.

  Dataset EGAD00001004038

• Acquisition of additional mutations drives accelerated progression of NPM1 positive CMML to AML

  This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ We performed exome sequencing on serial samples from a patient with CMML who progressed to AML. The exome sequencing suggests that NPM1, TET2 and DNMT3a mutations were present in the dominant clone in the CMML sample and that NRAS is a new subclonal mutation in the AML sample. Diagnostic data shows the presence of a FLT3-ITD mutation in the AML sample, which is likely to have driven progression. Here we are performing re-sequencing of the putative driver and some passenger mutations which appear to be in the same clone to validate these mutations and to verify the relative quantification of these abnormalities .

  Dataset EGAD00001002194

• Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations

  It is well established that autism spectrum disorders (ASD) have a strong genetic component; however, for at least 70% of cases, the underlying genetic cause is unknown. Under the hypothesis that de novo mutations underlie a substantial fraction of the risk for developing ASD in families with no previous history of ASD or related phenotypes-so-called sporadic or simplex families-we sequenced all coding regions of the genome (the exome) for parent-child trios exhibiting sporadic ASD, including 189 new trios and 20 that were previously reported. Additionally, we also sequenced the exomes of 50 unaffected siblings corresponding to these new (n = 31) and previously reported trios (n = 19), for a total of 617 individual exomes from 209 families deposited in dbGaP. Here we show that de novo point mutations are overwhelmingly paternal in origin (4:1 bias) and positively correlated with paternal age, consistent with the modest increased risk for children of older fathers to develop ASD. Moreover, 39% (49 of 126) of the most severe or disruptive de novo mutations map to a highly interconnected beta-catenin/chromatin remodelling protein network ranked significantly for autism candidate genes. In proband exomes, recurrent protein-altering mutations were observed in two genes: CHD8 and NTNG1. Mutation screening of six candidate genes in 1,703 ASD probands identified additional de novo, protein-altering mutations in GRIN2B, LAMC3 and SCN1A. Combined with copy number variant (CNV) data, these results indicate extreme locus heterogeneity but also provide a target for future discovery, diagnostics and therapeutics.

  Study phs000482

• Case Report: Pre-Clinical Combination Targeting VEGF and PI3K in a Rare, Aggressive Mixed Endometrial Carcinoma

  We report a rare case of a young patient (VENUS 167) initially diagnosed with grade 1 endometrioid endometrial cancer, which, following endocrine treatment, presented with mixed aggressive carcinoma with three distinct histologic patterns: grade 1 endometrioid, large cell neuroendocrine, and undifferentiated carcinoma. The surgical specimen at the time of disease progression was used to establish OPTO.85, a patient-derived organoid (PDO), followed by a corresponding organoid-derived xenograft (ODX). Multi-omic analyses confirmed that OPTO.85 accurately reflected the patient’s tumor characteristics. WES analysis identified oncogenic alterations in PIK3CA, ARID1A, and CTNNB1. Further RNA-seq and ATAC-seq analyses revealed enrichment in VEGF and Wnt signaling pathways, suggesting therapeutic vulnerabilities. A high-throughput drug screen was conducted using ApexBio-Approved and Epigenetic Drug Libraries, along with Kinase Inhibitor and Tool Compound Libraries developed at the Ontario Institute of Cancer Research. The OPTO.85 PDO exhibited sensitivity to PI3K inhibitors and responsiveness to VEGF inhibition. Cediranib demonstrated synergy with BKM120, significantly reducing organoid growth. This combination also showed in vivo efficacy in the ODX model, where dual inhibitors significantly suppressed tumor growth compared to single compounds. This case exemplifies the impact of genomic profiling and patient-derived models in identifying actionable molecular changes in rare cancers with limited therapeutic options and poor prognosis. It highlights that high-throughput sequencing for individual patient tumors and generation of patient-derived models are feasible in endometrial cancer. This preclinical model may assist clinical decision and personalized therapy requiring validation in prospective studies.

  Study EGAS50000001665

• Analysis of the Elements Involved in the Enrichment of a Panel of Genomic Regions by Nanopore Sequencing Using Adaptive Sampling

  DNA sequencing using nanopore technologies with the affordable MinION device is useful for the identification and characterization of structural variants, long haplotypes, sequencing of repetitive regions and identification of epigenetic modifications. The main limitation of this approach is the low coverage obtained, which might be avoided by adaptive sampling, a computationally controlled method of enrichment for targeted genomic regions. This study dissects the factors involved in the enrichment by adaptive sampling of a panel of 18 human genome regions containing 20 genes implicated in breast cancer sequenced in 16 patients with familial breast cancer negative for NGS screening. An average coverage of 2.0x was obtained for the whole genome and 5.1x for selected regions. Sequencing time was the main factor improving coverage. The selection of long reads (&amp;gt;1 Kb) did not improve the enrichment. The length of the selected region, which in our study ranged from 126 to 565 Kb, did not play a significant role in enrichment. However, the region containing PMS2 showed significantly lower coverage, which could be explained by the high number of PMS2 pseudogenes (N = 14), which were also enriched. Our study shows new evidence of enrichment obtained by adaptive sampling in a panel of genomic regions and shows parameters, the relevance of sequencing time and the role of pseudogenes, that improve the enrichment yield with no library reloading or GPU use, data useful for a more efficient application of this procedure in future studies.

  Study EGAS00001007375

• Prader-Willi Syndrome and Early-onset Morbid Obesity Natural History Protocol

  This observational study will involve the comprehensive assessment of the medical, behavioral and nutritional history and the clinical features of individuals with Prader-Willi syndrome and individuals with features of PWS-like/EMO. A blood sample will be obtained from the participants in order to create a DNA and RNA repository. In those PWS participants with a known deletion a blood sample will be collected for DNA in order to perform array comparative genome hybridization (aCGH) microarray or Methylation-Specific Multiplex Ligation-dependent Probe Amplification (MS-MLPA) studies to characterize the extent of the deletion. DNA samples will be sent to the Consortium Center at Baylor College of Medicine for the performance of the aCGH studies and to either Dr. Driscoll or Dr. Butler lab for MS-MLPA analysis. No drugs or treatments will be administered through this protocol. Our goal is to enroll as many participants as possible over a 8 year period. Currently we have enrolled 297 total subjects of which 265 have PWS and 32 EMO. Our original goal was to have enrolled over the first 5 years a clinical database of 200 individuals with PWS and 100 with EMO. We have exceeded expectations in PWS enrollment, but have fallen short in the enrollment of individuals with EMO. Therefore, we would like to reset our goals. We now propose to have an enrollment goal of 400 total subjects of which 350 will have PWS and 50 will have EMO. Eligible participants will be initially enrolled in the natural history study from the 4 clinic sites currently involved with PWS (University of Florida, Kansas University Medical Center, Vanderbilt University and University of California at Irvine). Participants assessed will serve to provide a background of information and a willing cohort for future interventional studies. All participants will have had standard genetic testing at a commercial laboratory prior to entry into the study. The PWS participants will be classified into one of the 3 main molecular classes (deletion, UPD and ID). The EMO participants will have had laboratory testing ruling out PWS and chromosomal aneuploidy (e.g., trisomy 21, Klinefelter syndrome, etc.). Going forward we feel it is important that all newly recruited EMO subjects have an aCGH as part of their evaluation so we can identify those with discrete deletions, duplications or copy number variants (CNV) and compare them to those without aCGH abnormalities. The participants will be assessed annually (0-3 years of age) or biennially (&#62; 3 years) in the Clinical Research Center (or equivalent facility) using standardized protocol including photographs for documentation purposes to compare the evolution of the clinical phenotype.

  Study phs000575

• The Role of CDX2 in Controlling ABCB1 Expression and Chemosensitivity in Human Colon Cancer

  This study reports the results of RNA sequencing (RNA-seq) experiments performed on two human colon cancer cell lines (HT-29, DLD-1) that were genetically engineered to achieve either the constitutive expression (in HT-29 cells) or the selective inactivation (in DLD-1 cells) of the transcription factor CDX2, a master regulator of embryonic gut development and a key regulator of multi-lineage differentiation in adult colon epithelial cells. Our previous studies had identified lack of CDX2 expression as a prognostic biomarker of poor prognosis and a predictive biomarker of benefit from adjuvant chemotherapy in Stage-II and Stage-III colon cancer patients (Dalerba et al., NEJM, 374:211-222, 2016; PMID: 26789870). The molecular basis of these associations, however, remained poorly understood. The present study was designed to identify which genes are under the transcriptional control of CDX2, in order to clarify their role in shaping colon cancer resistance to chemotherapy. Of the two lines included in this study, the first (HT-29) is CDX2-negative at baseline, and was infected with a lentivirus vector encoding for the cDNA of the human CDX2 gene under the control of a constitutive promoter (CMV). The second line (DLD-1) is CDX2-positive at baseline, and was infected with a series of lentivirus vectors encoding for CRISPR/Cas9 constructs designed to selectively inactivate the CDX2 gene. In both cases, infected cells were purified by fluorescence-activated cell sorting (FACS), based on the differential expression of a green fluorescent reporter (EGFP) that was also encoded by the lentivirus vectors, and transcribed in tandem with either the CDX2 cDNA (HT-29) or CRISPR/Cas9 gRNAs targeting CDX2 (DLD-1). The experiments were designed to include 3 experimental replicates per condition, and to compare the transcriptional profile of genetically engineered cells with that of autologous controls (i.e., HT-29 cells infected with an "empty" version of the same lentivirus vector used to over-express CDX2, DLD-1 cells engineered with a "non-targeting" CRISPR/Cas9 gRNA). In the specific case of DLD-1 cells engineered with CRIPSR-Cas9 constructs targeting CDX2, infected cells were sorted based on the differential expression of EGFP and then plated as single-cells, in order to sub-culture three isogenic clones, all of which were genetically sequenced to confirm bi-allelic knock-out of the CDX2 gene, and confirmed to lack CDX2 protein expression by Western blot. The results of our experiments demonstrate that, in human colon epithelial cells, CDX2 controls the expression of the ABCB1 efflux pump, by positively regulating the transcription of the corresponding gene.

  Study phs002903

• Genome-Wide Association Studies of Prematurity and Its Complications (African American)

  Preterm delivery resulting in the birth of a premature infant is a complex problem with a devastating impact on individuals, families and society. The prevalence of preterm birth has increased steadily in developed countries over the last 20 years and more than three million children die of preterm birth worldwide each year. Despite the importance of the problem and its disproportionate occurrence in poor and minority populations, the underlying causes have been difficult to identify. Spontaneous preterm labor has as its suspected triggers infection, stress, poor nutrition and inherited factors. The single best predictor for preterm delivery is a previous preterm birth. Studies of twins and of recurrences within families provide evidence that genetic factors underlie a substantive component of the risk for prematurity. One major challenge in studying genetic factors in prematurity is that the risk case is not truly established. The genetic risk could reside either in the mother and her uterus or in the infant/placenta. Identification of genetic factors in the mother and/or infant could provide insights into identifying relevant environmental covariates that may be more amenable to rapid interventions but difficult to find using standard epidemiology alone. A comprehensive genome-wide association study (GWAS) is the ideal way to identify those genes that would not be suspected based on our current understanding of the biology of parturition. We are using 2200 African American samples with term or preterm labor. A subset of these (~800) are infant samples recruited by the Neonatal Research Network as part of a study on cytokines and infection in extremely low birth weight infants (Schelonka RL, et al., 2011. PMID: 21145756). Therefore, this group consists of infants &lt;1,000 grams with clinical outcome data for the infant allowing study of the genetic contributors for not only preterm birth but also the complications that often accompany preterm birth. The result will enable a better understanding of the biology of parturition and suggest environmental modifications that can prolong gestations to improve neonatal and adult outcomes. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to preterm birth through large-scale genome-wide association studies of African-American cases and controls from multiple sites in the United States. Genotyping was performed at the Johns Hopkins University Center for Inherited Disease Research (CIDR). Data cleaning and harmonization were done at the GEI-funded GENEVA Coordinating Center at the University of Washington.

  Study phs000353

• A Clone's Genomic Stability as a Biomarker of Its DNA-Damage Resilience

  A main problem in the treatment of advanced cancers, including gastric cancers and glioblastoma, is the incertitude at which we predict how individual patients will respond to DNA-damaging agents, especially on the long run. Knowing the mechanism behind a patient's response, or the lack thereof, will help us depart from the oversimplified &#8220;more-is-better&#8221; and &#8220;one-size-fits-all&#8221; principles according to which DNA-damaging agents are administered. This will improve clinical outcome by allowing us to pinpoint those who would respond better and longer to lower doses than to higher doses of DNA-damaging agents. Under the assumption that the success of DNA-damaging therapy increases with the proliferation rate of a relatively homogeneous tumor population, there was little reason to assume anything other than monotonic dose-response relations. With the recent paradigm shift that most cancers are in fact DNA mosaic products of ongoing evolution, comes the urgency to reconsider these fundamental principles behind DNA-damaging therapy administration. As the developers of one of the first DNA deconvolution methods and with access to technologies to profile the transcriptomes of up to 10,000 cells simultaneously, we are equipped to embark on first personalized dose-finding strategies for DNA-damaging therapies. We will test the potential of the very long-term legacy that DNA-damage entails on a cell &#8220;genomic instability&#8221; as new biomarker of DNA-damage response. Our preliminary studies showed that, for most cancer types, DNA-damaging agents change a clone's genomic instability and that clones succumb to a limit in the amount of genomic instability they can tolerate. In particular, our results showed that patients with intermediate genomic instability have a very poor outcome and that this relation is only evident among treatment-naive patients, but not among patients treated with DNA-damaging agents. Further they show that we can measure genomic instability per clone and that clones with extreme genomic instability typically don't grow large. Our hypothesis that genomic instability, rather than proliferation rate, determines how sensitive a tumor is to DNA-damaging agents on the long-term, is founded on two unexpected findings. Patients with extremely high genomic instability per tumor clone have an exceptionally good outcome. Aim 1 will integrate exome- and single cell RNA-Seq (scRNA-Seq) data to characterize clones and to measure how much genomic instability they can tolerate. Low genomic instability is associated with reduced benefit from DNA-damaging agents. Aim 2 will use comet assays and treatment history to quantify DNA damage per clone, relating it to the clones' ability to tolerate DNA damage and to changes in the genomic instability of therapy-surviving clones.

  Study phs003762

• A Phase I Study of the Treatment of Recurrent Malignant Glioma with CAN-3110 (AKA rQNestin34.5v.2), a Genetically Engineered HSV-1 Virus

  This study is a "first-in-human" phase 1 trial of recurrent, IDH wild-type glioblastoma (rGBM) patients treated with CAN-3110 (aka rQNestin34.5v.2), a genetically modified oncolytic herpes simplex virus 1 (HSV-1). The study was a 3+3 dose-escalation study starting at a single intra-tumoral injection of 106 PFU CAN-3110 going up to 1010 PFU in half-log increments (cohorts 1-9). An expansion cohort (cohort 10) was treated with 109 PFU injected into up to 5 sites within a single tumor. Principal findings of the study conclude that:CAN-3110 was safe at all tested doses (no dose-limiting toxicities reached)HSV-1 seropositive patients survived significantly longer than HSV-1 seronegative patients in this study - longer than expected based on historical rGBM controlsHSV-1 seropositive patients were significantly more likely to clear CAN-3110 (HSV-1) antigen from their tumors based on immunohistochemical stainingCAN-3110 treatment-induced CD8+/CD4+ T-cell recruitment to injected tumor sites altered TCR beta diversity in both tumor infiltrating leukocytes (TILs) and PBMCs, and initiated changes in specific TCR beta clonotypes and immune gene signatures which were associated with post-treatment survival.Data provided in dbGaP for this study include:Bulk RNA-Seq data for 13 pre/post-treatment pairs of rGBM tumors corresponding to 12 unique patients (patient 28 was treated with CAN-3110 at two different timepoints). This data is provided as raw sequencing reads (.fastq), kallisto pseudoalignment transcript-level read counts (abundance.tsv files), gene-level abundance matrix (Gene_Level_Expression_Matrix.tsv), and immune gene signature scores matrix (Immune_Gene_Signatures_Matrix.tsv). Sequencing was performed as paired 150bp sequencing on NovaSeq6000 S4 Illumina flow cells. Library preparation varied by batch as described in the included RNAseq_Metadata.xlsx table.TCR beta DNA sequencing performed by Adaptive Biotechnologies for 21 pre/post-treatment pairs of rGBM tumors and PBMCs representing 20 unique patients (patient 28 was treated with CAN-3110 at two different timepoints). Note that all tumor pairs with TCR beta sequencing data also have available bulk RNA-Seq data. The TCR beta sequencing data is provided as an excel spreadsheet (TCRbeta_Sample_Overview.xslx), which provides a broad level summary of the sequencing on a per-sample basis (# of TCRbeta templates, T cell fraction, TCR beta diversity metrics, etc.) and as a large tab separated value file (Full_TCRbeta_Rearrangement_Details.tsv), which provides information per sample at the level of each unique TCR beta sequence (amino/nucleic acid sequence, VDJ gene usage, etc.).An excel table of de-identified metadata for the patients involved in this study.

  Study phs003378

• Providing safe access to sensitive human data across borders: Federated EGA becomes a reality

  Enabling discovery and access to sensitive data across national boundaries is vital for improving human health. It enables more powerful and efficient research by increasing the volume and diversity of data available for analysis. It allows us to better understand the causes of diseases – cancer, rare diseases, infectious diseases like COVID-19 – and develop new medicines and treatments. Sensitive human omics data are typically generated by research initiatives and shared using specialist repositories which provide services for data submission, discovery, and access. The EGA is one such repository. Established in 2008 at EMBL’s European Bioinformatics Institute (EMBL-EBI) in the UK, since 2012 the EGA (“Central EGA”) has been jointly managed by EMBL-EBI and the Centre for Genomic Regulation (CRG) in Spain. Many countries have emerging personalised medicine programmes which generate data from national initiatives. These programmes are driving a transition in human genomics from being research-driven to receiving funding through healthcare. Data generated in a clinical context are subject to stricter governance than research data and must follow national data protection legislation. To solve these challenges, the Federated EGA provides a network of connected resources to enable transnational discovery of and access to human omics data for research, while also respecting jurisdictional data protection regulations. In this way, the Federated EGA infrastructure supports the goals of European initiatives such as the 1+ Million Genomes initiative (1+MG), the European Health Data Space, and a number of EU-funded 1+MG implementation projects including Beyond 1 Million Genomes. The Federated EGA is made up of “Nodes” – typically nationally funded and operated – which store and manage data locally while allowing global discovery within the Federated EGA network. Since 2016, multiple parallel efforts, supported by ELIXIR and other transnational and national initiatives, have created technical and legal frameworks for establishing the Federated EGA. In 2022, the first five Nodes – Finland, Germany, Norway, Spain, and Sweden – officially joined the Federated EGA by signing Federated EGA Collaboration Agreements with Central EGA. The Finnish FEGA Node is operated by CSC - IT Center for Science and provides data management services according to national laws and the requirements of the EU General Data Protection Regulation (GDPR). These services provide tools and support for the whole life-cycle of sensitive research data from collating to analysis, publication, and authorised re-use. The development of the services has been a joint effort with the other Nordic nodes within NeIC's Tryggve and Heilsa projects, and funded by Finnish Ministry of Education and Culture and projects coordinated by ELIXIR Finland. Read more about Finnish FEGA signing. The German Human Genome-Phenome Archive (GHGA) strives to provide a national infrastructure as well as an ethical and legal framework that balances FAIR omics data usage and data protection needs for Germany. As a Germany-wide consortium funded by the German Research Foundation under the umbrella of the NFDI association, GHGA combines the expertise of 21 universities and research institutions to form a federated national infrastructure. Read more about GHGA signing. The German Human Genome-Phenome Archive (GHGA) strives to provide a national infrastructure as well as an ethical and legal framework that balances FAIR omics data usage and data protection needs for Germany. As a Germany-wide consortium funded by the German Research Foundation under the umbrella of the NFDI association, GHGA combines the expertise of 21 universities and research institutions to form a federated national infrastructure. Read more about GHGA signing. In Norway, a key component of the infrastructure is the services of The Sensitive Data Service (TSD) offered by USIT at University of Oslo. The Federated EGA Norway Node is developed by ELIXIR Norway and operated by the University of Oslo as the responsible legal entity. Core software modules are developed jointly with the other Nordic nodes in the NeIC Tryggve and Heilsa projects. Read more about FEGA Norway signing. The Spanish FEGA (es-FEGA) is a national service for storing sensitive biomedical data in Spain. Supported by the Spanish Institute of Bioinformatics (INB) in collaboration with Central EGA, sensitive research datasets are primarily hosted at the Barcelona Supercomputing Centre facilities. The Swedish Sensitive Data Archive is a secure data archive and sharing platform for sensitive datasets. It was developed by the National Bioinformatics Infrastructure Sweden (NBIS) in collaboration with other Nordic ELIXIR Nodes through the Tryggve and Heilsa projects funded by NeIC and coordinated with Central EGA through ELIXIR. Read more about the Swedish Node signing. The Swedish Sensitive Data Archive is a secure data archive and sharing platform for sensitive datasets. It was developed by the National Bioinformatics Infrastructure Sweden (NBIS) in collaboration with other Nordic ELIXIR Nodes through the Tryggve and Heilsa projects funded by NeIC and coordinated with Central EGA through ELIXIR. Read more about the Swedish Node signing. By providing a solution for secure and efficient management of human omics data, the Federated EGA aims to foster data reuse, enable reproducibility, accelerate biomedical research, and improve human health. Find out more Interested in setting up your own Federated EGA Node? Check out the FEGA Onboarding Knowledge Base for more information. The ELIXIR Federated Human Data Community is a great entry point for anyone interested in learning more about the Federated EGA. You can: Join the ELIXIR Federated Human Data Community mailing list (select “Human Data”) Attend the ELIXIR Federated Human Data Community calls

  Blog safe-access-to-sensitive-human-data-federated-ega

• National Human Genome Research Institute (NHGRI) GENEVA Genome-Wide Association Study of Venous Thrombosis (GWAS of VTE)

  Overview: Our overall long-term goal is to determine risk factors for the complex (multifactorial) disease, venous thromboembolism (VTE), that will allow physicians to stratify individual patient risk and target VTE prophylaxis to those who would benefit most. In this genome-wide association case-control study (1300 cases and 1300 controls) we hope to identify susceptibility variants for VTE. Mutations within genes encoding for important components of the anticoagulant, procoagulant, fibrinolytic, and innate immunity pathways are risk factors for VTE. We hypothesize that other genes within these four pathways or within other pathways also are VTE disease-susceptibility genes. Therefore, we performed a genome wide association (GWA) screen and analysis using the Illumina 660W platform to identify SNPs within 1,300 clinic-based, non-cancer VTE cases primarily from Minnesota and the upper Midwest USA, and 1300 clinic-based, unrelated controls frequency-matched on patient age, gender, myocardial infarction/stroke status and state of residence. This is a subset of a slightly larger candidate gene study using 1500 case-control pairs to identify haplotype-tagging SNPs (ht-SNPs) in a large set of candidate genes (n~750) within the anticoagulant, procoagulant, fibrinolytic, and innate immunity pathways. Study Populations. Cases. VTE cases were consecutive Mayo Clinic outpatients with objectively-diagnosed deep vein thrombosis (DVT) and/or pulmonary embolism (PE) residing in the upper Midwest and referred by Mayo Clinic physician to the Mayo Clinic Special Coagulation Laboratory for clinical diagnostic testing to evaluate for an acquired or inherited thrombophilia, or to the Mayo Clinic Thrombophilia Center. Any person contacted to be a control but discovered to have had a VTE was evaluated for inclusion as a case. Cases were primarily residents from Minnesota, Wisconsin, Iowa, Michigan, Illinois, North or South Dakota, Nebraska, Kansas, Missouri and Indiana. A DVT or PE was categorized as objectively diagnosed when (a) confirmed by venography or pulmonary angiography, or pathology examination of thrombus removed at surgery, or (b) if at least one non-invasive test (compression duplex ultrasonography, lung scan, computed tomography scan, magnetic resonance imaging) was positive. A VTE was defined as: Proximal leg deep vein thrombosis (DVT), which includes the common iliac, internal iliac, external iliac, common femoral, superficial [now termed "femoral"] femoral, deep femoral [sometimes referred to as "profunda" femoral] and/or popliteal veins. (Note: greater and lesser saphenous veins, or other superficial or perforator veins, were not included as proximal or distal leg DVT). Distal leg DVT (or "isolated calf DVT"), which includes the anterior tibial, posterior tibial and/or peroneal veins. (Note: gastrocnemius, soleal and/or sural [e.g., "deep muscular veins" of the calf] vein thrombosis was not included as distal leg DVT). Arm DVT, which includes the axillary, subclavian and/or innominate (brachiocephalic) veins. (Note: jugular [internal or external], cephalic and brachial vein thrombosis was not included in "arm DVT"). Hepatic, portal, splenic, superior or inferior mesenteric, and/or renal vein thrombosis. (Note: ovarian, testicular, peri-prostatic and/or pelvic vein thrombosis was not included). Cerebral vein thrombosis (includes cerebral or dural sinus or vein, saggital sinus or vein, and/or transverse sinus or vein thrombosis). Inferior vena cava (IVC) thrombosis Superior vena cava (SVC) thrombosis Pulmonary embolism Patients with VTE related to active cancer, antiphospholipid syndrome, inflammatory bowel disease, vasculitis, a rheumatoid or other autoimmune disorder, a vascular anomaly (e.g., Klippel-Tr&#233;naunay syndrome, etc.), heparin-induced thrombocytopenia, or a mechanical cause for DVT (e.g., arm DVT or SVC thrombosis related to a central venous catheter or transvenous pacemaker, portal and/or splenic vein thrombosis related to liver cirrhosis, IVC thrombosis related to retroperitoneal fibrosis, etc.), with hemodialysis arteriovenous fistula thrombosis, or with prior liver or bone marrow transplantation were excluded. Controls. A Mayo Clinic outpatient control group was prospectively recruited for this study. Controls were frequency-matched on the age group (18-29, 30-39, 40-49, 50-59, 60-69, 70-79, and 80+ years), sex, myocardial infarction/stroke status, and state of residence distribution of the cases. We selected clinic-based controls using a controls&#39; database of persons undergoing general medical examinations in the Mayo Clinic Departments of General Internal Medicine or Primary Care Internal Medicine. Additionally persons undergoing evaluation at the Mayo Clinic Sports Medicine Center, and the Department of Family Medicine were screened for inclusion as controls. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to venous thrombosis through large-scale genome-wide association studies of 1,300 clinic-based, VTE cases and 1300 clinic-based, unrelated controls. Genotyping was performed at the Johns Hopkins University Center for Inherited Disease Research (CIDR). Data cleaning and harmonization were done at the GEI-funded GENEVA Coordinating Center at the University of Washington.

  Study phs000289

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-RW9277

  WGS and RNA-Seq data from a GBM patient PT-RW9277

  Dataset EGAD00001004259

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genome and transcriptome sequence data from a diffuse aarge B-cell lymphoma (relapse) tumor patient

  Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015308

• Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm tumor patient

  Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015312

• Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor tumor patient

  Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015322

• Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour tumor patient

  Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015327

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• How to upload Crypt4GH files

  Uploading files Users who hold an ega-box-XXX account can upload files using either INBOX or FTP. Users who have a Submitter role associated with their email will only be able to upload files using INBOX. Before uploading your files, please make sure that any files that will be uploaded to EGA do not use special characters in their naming convention, such as # ? ( ) [ ] / \ = + < > : ; " ' , * ^ | &. This can cause issues with the archiving process, leading to problems for end users. The EGA is a shared, public service with limited storage. To manage the available resources, we enforce a limit of 10TB per submission account at any one time. If you exceed this limit, a “permission denied” message will be displayed. This will prevent you from uploading more files, but connecting to your inbox.For submissions larger than 10TB, please perform uploads in 10TB batches: register all the metadata and then finalise the submission. Upload the next batch of files and repeat the same metadata registration and finalisation process until you have completed the file upload. Further information can be found in the SP documentation. INBOX FTP The INBOX is only compatible with files encrypted using the Crypt4gh tool Before uploading If you are not a registered EGA user, you will first need an EGA user account. Please note that it may take a few days for your account to be activated, as it needs to be vouched for by the EGA Helpdesk. Once your account is validated, you will be able to request a submitter role. [Optional] Meanwhile, you can create and add your public key to your EGA account profile. This option is not available for old submission accounts (e.g., ega-box-NNN). As soon as you have been granted a submitter role, you will be able to connect with your username and password to the EGA inbox using the SFTP protocol. If you have also registered a public key in your profile, you can also connect using this key. To upload files to your account, you can use the graphical user interface (GUI) or the command line. Graphical User Interface (GUI)We recommend using FileZilla, a free, open-source FTP client. However, you can use any other GUI that allows connecting over the SFTP protocol. For FileZilla as your GUI, follow these steps to upload files: Create a new connection in Site Manager (File > Site Manager) and select the following options (Figure 1): Protocol: SFTP - SSH File Transfer ProtocolHost: __EGA_INBOX_DOMAIN__Logon Type: Key fileUser: your EGA usernameKey file: Path/to/your/private_keyFigure 1: Process of establishing a new connection to __EGA_INBOX_DOMAIN__ using a key file as the logon method in FileZilla. The figure showcases the FileZilla version 3.52.2 operating on IOS v11.2.3. By following the depicted steps, users can create a secure and efficient connection to the inbox, ensuring seamless data transfers.Click Connect, and you will log in remotely to your home directory. You can think of this folder as a storage "in the EGA cloud" in which you will add your files for the EGA. The uploading area has three folders:To-encrypt: Files uploaded in this folder will be encrypted automatically on the fly.Encrypted: Files uploaded in this folder must already be encrypted with Crypt4gh. Upload your files here if your connection is unstable or you have problems completing the upload into-encrypt.Etc: This folder contains two files that allow the server to show you your username and group instead of some internal numbers. Please do not upload files here; otherwise, you will obtain a permission denied error. Find the files you want to upload by browsing your local storage (left side of your screen in FileZilla). Select all the files you want to upload, then right-click on them and select Upload (Figure 2). Figure 2: Step-by-step process of manually uploading files to __EGA_INBOX_DOMAIN__ using FileZilla, with FileZilla version 3.52.2 operating on IOS v11.2.3. The figure demonstrates how users can transfer data from their local storage to the "EGA cloud" by following the depicted steps Please note that regardless of which folder you upload your files in, both folders (to-encrypt, encrypted) will point to the same path (/) (Figure 3). Therefore, you will see your files in both folders. Figure 3: Both folders, to-encrypt and encrypted, point to the same path (/)" If your connection is unstable, please encrypt your files first using Crypt4gh. Then upload them to the ‘encrypted’ folder. The example above shows how to connect to __EGA_INBOX_DOMAIN__ using the private key. However, if you prefer to log in using your credentials, you can do so. Please go to the Frequently Asked Questions (FAQs)  for more information. SFTP command line To upload files securely to your private area of the EGA, you can use SFTP(Secure File Transfer Protocol) with your favorite FTP client. Here's what you need to know to get started: Connect to the target host __EGA_INBOX_DOMAIN__. This is the new hostname for the EGA SFTP service. Log in with your EGA username and key files (or password). Upload files to your private EGA inbox to ensure that only you can access the files. By following these steps, you can securely upload your files to the EGA for safe storage and sharing. Using the SFTP command line client in Linux/Unix Open a terminal and type sftp username@hostnameEnter your EGA passwordTo see a list of available SFTP commands, type helpsftp> put – Upload filesftp> get – Download filesftp> cd path – Change remote directory to ‘path’sftp> pwd – Display remote working directorysftp> lcd path – Change the local directory to ‘path’sftp> lpwd – Display local working directorysftp> ls – Display the contents of the remote working directorysftp> lls – Display the contents of the local working directoryType the "put" command to upload files. For example: put *.bamUse the bye command to close the connection (SFTP session). After uploading- Once you have uploaded files to the inbox, please bear in mind that the checksum needs to be calculated, which can take up to two days. You will only be able to link your files to a run/analysis once the encrypted checksum has been calculated.- When linking your files to the 'Run' or 'Analysis', ensure that the file name matches the file path '/name' in the INBOX folder.- Please delete the files from your SFTP INBOX after all the runs/analyses have been registered and files are ingested (SP > Files > Files ingested). This will clear your inbox space an allow you to upload more files. This will also prevent the files from reappearing in your Submitter Portal inbox. Frequently Asked Questions Specific to the inbox What username should I use to log in to my inbox? The authentication process for logging in to the EGA website, as well as accessing your inbox and outbox, requires the use of your username.  If you have forgotten your registered username, please contact our Helpdesk team for assistance. How are checksums calculated in your inbox? If you encrypt the file beforehand and upload it to the "encrypted" folder, the unencrypted checksum will not be calculated until the file is ingested (i.e., until it is used in a run/analysis). If the file is uploaded to the "to-encrypt" folder, then both checksums are calculated.Please bear in mind that after files have been uploaded to the inbox, the checksum must be calculated, which can take from a few hours to two days.  Specific to using keys to authenticate Can I access one EGA account from different devices? Yes, you can access your account from different devices by linking several public keys to your EGA account. Each device can generate a unique public-private key pair, and the corresponding public keys can be linked to the same account. This way, you can use different public keys on different devices and still have access to the same account and data. I have several keys and I don't remember which one is which When generating SSH keys, it's a good practice to add a comment using the -C flag. This will allow you to add a descriptive tag to your key, making it easier to identify later on. Here's an example command that generates an SSH key with a comment: ssh-keygen -t ed25519 -C work-pass In this example, we're generating an ed25519 SSH key with the comment work-pass. Once you have multiple keys with different comments, you can use the comments to easily identify each key. To view the comments for your existing SSH keys, you can use the following command: ssh-keygen -l -f /path/to/key This will display the key fingerprint and the associated comment. By checking the comments, you should be able to identify which key is which. What if I can't find my SSH keys for uploading files with a key file, and how can I use new keys? If you can't find your SSH keys, don't worry - you can make new ones. To do this, open your terminal or command prompt and type a command to make a new SSH key. You can pick a name for the key, and choose a password to keep it safe. After making the key, you can add the new key to your account or server where you want to upload files using the key file. This usually involves copying and pasting the key's "public" (e.g. file.pub) part to the right place. If you lose track of the key again, just make a new one and add it again. Keep in mind that SSH keys belong to you and your computer, so if you switch computers or accounts, you'll need to make new keys. I don't want to type the passphrase every time I use the key. What can I do? You can use an ssh-agent to avoid typing the passphrase every time you use the key. An ssh-agent is a program that stores your private keys in memory and provides them to ssh when needed. You can add your key to the ssh-agent using the command ssh-add followed by the path to your key file.Here's an example of the steps to follow: Open a terminal window.Start the ssh-agent by typing the command eval $(ssh-agent).Add your key to the ssh-agent by typing the command ssh-add [key filepath]. For instance, if your key file is located in the home directory with the name mykey, the command will look like this: ssh-add ~/mykey After adding your, key to the ssh-agent, you should be able to use ssh without having to enter your passphrase every time. Can I use my password for authentication (without my private key)? If you prefer to use your username and password for authentication instead of your private key, you can still do so. When using a Graphical User Interface (GUI) such as FileZilla, you can select Ask for password as your Logon Type (Figure 3). This option will prompt you to enter your password when you click Connect, instead of using your private key. Figure 3: This option will prompt you to enter your password when you click "Connect", instead of using your private key. Figure 3: Process of establishing a new connection to __EGA_INBOX_DOMAIN__ using your password as the logon method in FileZilla. The figure showcases the FileZilla version 3.52.2 operating on IOS v11.2.3. By following the depicted steps, users can create a secure and efficient connection to the inbox, ensuring seamless data transfers. It's worth noting that using a password for authentication can be less secure than using an SSH key, as passwords can be more easily compromised through various means. However, if you choose to use your password for authentication, selecting "Ask for password" as your Logon Type is a good way to do so securely via a GUI. Why is it better to use my key and not my password? SSH keys for authentication is generally considered to be more secure and convenient than using passwords. SSH keys are more difficult to crack than passwords, and they can be restricted to specific users and machines, giving you more control over access. Once you set up your SSH keys, you can use them to authenticate quickly and easily, without having to enter a password every time. This makes automation of tasks, such as uploading encrypted files, much simpler. Additionally, SSH keys provide better logging, allowing you to keep track of who is accessing your systems and when. All in all, using SSH keys is a good practice for improving security and convenience in your authentication process.

  Documentation submission/data/uploading-files/inbox

• Germ Cell and Associated Heme Malignancies Evolve from a Common Shared Precursor

  Germ cell tumors (GCTs) are the most common cancer in men between the ages of 15-40. While most patients are cured, those with disease arising in the mediastinum have distinctly poor outcomes. One in every 17 patients with primary mediastinal non-seminomatous GCTs develop an incurable hematologic malignancy and prior data intriguingly suggests a clonal relationship exists between hematologic malignancies and GCTs in these cases. To date however, the precise clonal relationship between GCTs and the diverse additional somatic malignancies arising in such individuals has not been determined. Here, we traced the clonal evolution and characterized the genetic features of each neoplasm from a cohort of fifteen patients with GCTs and associated hematologic malignancies. We discovered that GCTs and hematologic malignancies developing in such individuals evolved from a common shared precursor, nearly all of which harbored allelically imbalanced TP53 and/or RAS pathway mutations. Hematologic malignancies arising in this setting genetically resembled mediastinal GCTs rather than de novo myeloid neoplasms. Our findings argue that this scenario represents a unique clinical syndrome, distinct from de novo GCTs or hematologic malignancies, initiated by an ancestral precursor which gives rise to the parallel evolution of GCTs and blood cancers in these patients. Reprinted from PMID: 32897884, with permission from JCI.

  Study phs002231