3924 results for "RNA AND sequencing OR transcriptome"

in 42.18 milliseconds.

• Sequencing data for oesophageal and related samples - BOs release 2 (RNA)

  Dataset EGAD00001003840

• A novel subset of human CD33+ haematopoietic stem cells characterized at single-cell resolution

  This dataset comprises single-cell RNA sequencing of the human Lin-CD34+38-45RA-90+49f+ phenotype isolated from 2 normal cord donors. Library preparation was performed following a modified CEL-Seq2 protocol.

  Dataset EGAD00001003955

• Total RNAseq in the sporadic ALS and healthy control motor cortex

  The motor cortex is the earliest affected brain region in ALS. This dataset contains total RNA sequencing (stranded, 2x101bp) data derived from the motor cortex of 11 sporadic ALS patients and 8 healthy controls.

  Dataset EGAD00001006022

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing recovered to affected disease phase.

  Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006382

• RNA sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region RNAseq from 4 NSCLC patients, totaling 12 tumor samples and 7 matched control samples.

  Dataset EGAD00001008482

• Single cell RNA sequencing of colorectal cancer patients (KUL5)

  All libraries were sequenced on Illumina NextSeq or NovaSeq6000 until sufficient saturation was reached.

  Dataset EGAD00001008585

• Islet RFX6 Study Manuscript Data

  This submission includes raw FASTQ files (for bulk RNA-seq and 10X joint snATAC+snRNA multiome profiling experiments), sample phenotype files, and genotypes for the data included in the manuscript.

  Dataset EGAD00001008777

• WES and RNA-seq of triple-negative breast cancers from the MyBrCa cohort

  The dataset contains a genomics characterization of 35 triple-negative Asian breast tumours from the Malaysian Breast Cancer cohort. This includes whole-exome sequencing of tumour tissue at 80X, whole-exome sequencing of matched normal (blood) tissue at 40X, and RNA-seq of tumour tissue at 40X coverage (>15 million reads). Whole-exome libraries were prepared using the Nextera Rapid Capture Exome Kit; exome capture was performed in pools of 3 and subjected to paired end 75 sequencing on a NovaSeq 6000 platform. RNA libraries were prepared using the TruSeq Stranded Total RNA HT kit with Ribo-Zero Gold as per manufacturer’s instructions and also subjected to paired end 75 sequencing on a NovaSeq 6000 platform. Uploaded bam files have been mapped to the hs37d5 human genome and processed using the standard GATK pipelines. Paired clinical, demographic, genotyping, and overall survival data for these patients are available from the associated publications or by request.

  Dataset EGAD00001009311

• TN

  In order to comprehensively investigate the genetic relationship between PTC tumors and benign nodules, we totally collected 127 fresh-frozen biopsies samples from 28 patients with concurrent thyroid benign nodule and PTC (n=20) or simple benign nodule (n=8). We carried out whole-exome sequencing on all the 127 biopsies samples and RNA-sequencing in total of 40 samples.

  Dataset EGAD00001003351

• MPM patients

  - RNA-sequencing data: 5 normal pleurae and 40 malignant pleural mesotheliomas - Targeted DNA-sequencing of the 165 genes included in the “Solid and Haematological tumors” panel (BRIGHTCore, Brussels, Belgium): 6 MPM samples. 2 FASTQ files for each sample (paired).

  Dataset EGAD00001008740

• Juvenile Sjogren's Syndrome (JSS) Transcriptome Study

  Sjögren's disease (SjD) is a systemic autoimmune disorder with major clinical manifestations of dryness in the eyes and mouth, fatigue, and joint pain. Our interdisciplinary experts in SjD at the University of Florida newly discovered and established a cohort of SjD in children. Many of these patients with childhood SjD (cSjD) demonstrated a prominent feature of recurrent parotitis (RP). To understand the immunopathogenesis of childhood SjD (cSjD) for the first time in the field, we profiled the transcriptome of five groups of four PBMC samples by unbiased, high-throughput single-cell RNA sequencing (scRNA-seq): cSjD (n=4), non-cSjD (n=4), biopsy-positive non-cSjD (BP, n=4), biopsy-positive non-cSjD with RP (BPRP, n=4), and healthy controls (HC, n=4). In this study, RNA sequencing data, as well as all barcodes.tsv.gz, features.tsv.gz, and matrix.mtx.gz that may be used to create a Seurat object in R, will be availableTo protect the confidentiality of subjects, certain data were not assessed or collected in the subject phenotype dataset, such as race, age, height, weight, and education.

  Study phs003048

• Molecular Characterization of Prostate Cancer Specimens by Bulk and Single Cell Analysis

  Version 1: We performed single-cell RNA-sequencing (scRNA-seq) of fresh biopsies from metastatic castration resistant prostate cancer. Additionally, where available, we performed matched bulk whole exome sequencing (WXS; tumor and normal paired) and whole transcriptome sequencing for the same individuals. We also performed bulk whole exome (WXS) and RNA-sequencing (RNA-Seq) from FFPE pre-treatment biopsies from patients with clinically localized high-risk prostate cancer.Version 2: We added data from a randomized phase 2 trial of radium-223 with or without pembrolizumab in patients with Metastatic Castration-Resistant Prostate Cancer (mCRPC) to bone. After enrollment, study participants underwent bone biopsy and were randomized 2:1 to receive radium-223 at 55 kBq/kg every 4 weeks + pembrolizumab at 200 mg every 3 weeks (Arm A, R223+P) or radium-223 at 55 kBq/kg every 4 weeks alone (Arm B, R223). Stratification factors were alkaline phosphatase ≥220 vs. Data generated includes bulk whole exome sequencing (WXS), ultra-low pass whole genome sequencing (WGS) at 0.1X coverage, and targeted-capture sequencing. The ultra-low pass sequencing was used as part of the selection criteria for the target capture sequencing. Note: Two subjects in this study are linked to phs001577 and phs000915 respectively.

  Study phs001988

• Tumor gene expression profiles for the study "TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells"

  RNA was extracted from formalin-fixed and paraffin embedded tumors of a large cohort of bladder cancer patients before treatment with anti-PD-L1. RNA was sequenced using a capture based approach (exome capture, RNA access).

  Dataset EGAD00001003977

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. One possibility for this inefficiency is an incomplete understanding of the molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to develop a foundational dataset for identifying candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Study EGAS00001003667

• Single cell transcriptome sequencing of the developing human embryonic meninges

  There are no effective medical therapies for meningiomas, partly due to our limited understanding of their cellular origin and composition For this purpose, we generated data to make a comprehensive reference single cell and spatial transcriptomic atlas of human fetal meninges. Samples of meninges from human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development, Furthermore, this dataset should help discover cells of origin for meningiomas.

  Study EGAS50000000980

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• cHCC-ICC RNAseq

  The RNA-seq data of 97 tumor samples from 77 cHCC-ICC cases, data of two other HCC tumor samples were also included.

  Dataset EGAD00001005182

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Single-cell transcriptome landscape of developing fetal gonads defines somatic cell lineage specification in humans

  Single-cell RNA-seq dataset recovering the gene expression programs of around 128,000 single cells derived from 17 fetal testes and 16 fetal ovaries from 5 to 12 postconceptional weeks.

  Dataset EGAD00001009811

• FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls.

  FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls. The POP study placental biopsies were collected within 30 minutes of birth and flash frozen in RNAlater (ThermoFisher). For each biopsy, total placental RNA was extracted from approximately 5 mg of tissue using the “mirVana miRNA Isolation Kit” (Ambion) followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments. RNA-libraries were prepared from 1g of total placental RNA with the TruSeq Stranded mRNA Library Prep Kit (Illumina) which captures polyA-tailed transcripts by oligo-dT beads, then pooled and sequenced (single-end, 50bp) using a Single End V4 cluster kit and Illumina HiSeq2500

  Dataset EGAD00001006304

• Alpha synucleinopathy spectrum - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=44 samples. Tissue samples correspond to patients with different alpha synucleinopathies. Specifically, idiopathic Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=11). RNA seq was carried out using ribosomal depletion. The totality of these samples were also sequenced using single nucleus RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000430

• Alpha synucleinopathy spectrum - single nucleus RNA seq of prefrontal cortex

  Single nucleus RNA seq dataset from prefrontal cortex of a total of N=46 individuals with alpha synucleinopathies and healthy controls. Tissue samples correspond to patients with Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=13). RNA seq was carried out employing 10X Genomics Chromium. These samples were also sequenced using conventional bulk tissue RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000431

• Complex-I stratification of Parkinson's disease - single nucleus RNAseq

  Single nucleus RNA seq dataset for CI stratification of Parkinson's disease Single nucleus RNA seq dataset of prefrontal cortex tissue from a total of N=18 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=12) and neurologically healthy controls (N=6). Single nucleus RNA seq was carried out using 10X Genomics Chromium. This dataset corresponds to a subset of the samples sequenced using conventional bulk tissue RNA seq and available within this Study as a separate Dataset.

  Dataset EGAD50000000432

• Complex-I stratification of Parkinson's disease in the prefrontal cortex - bulk RNA seq

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=98 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=79) and neurologically healthy controls (N=19). RNA seq was carried out using ribosomal depletion. A subset of these samples was additionally sequenced using single nucleus RNA seq and is available in the same Study as an additional Dataset.

  Dataset EGAD50000000433

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  The dataset contains bulk RNA sequencing data from 12 pediatric thymus samples collected during cardiac surgeries. These samples represent immunologically healthy donors with a mean age of 6 months. The sequencing was performed using Illumina HiSeq4000, and the processed files are available in standard formats such as FASTQ.

  Dataset EGAD50000001120

• Bulk RNA sequencing validating an in vitro model mimicking the taNK phenotype.

  In order to obtain a sufficient amount of taNK cells for functional assays, we established an in vitro model to mimic the phenotype of taNK cells. BulkRNA sequencing was performed in order to validate the obtained phenotype comparing in vitro-generated CD103+CD49a+ (ta)NK cells with CD103-CD49a- non-taNK cells.

  Dataset EGAD50000002387

• Epigenomics and Single-cell Sequencing Define Cellular Heterogeneity in Langerhans Cell Histiocytosis

  Epigenomic and transcriptomic analysis of Langerhans cell histiocytosis (LCH) biopsies. Single-cell RNA-seq (10x Genomics) of seven LCH biopsies. ATAC-seq data from four sorted cell populations (in duplicate) from one LCH biopsy.

  Dataset EGAD00001005280

• Genomic analysis of pancreatic neuroendocrine tumour with MEN1, ATRX, or DAXX mutations

  This dataset includes 52 samples from 19 individuals with pancreatic neuroendocrine tumours. These samples were analyzed using RNA-sequencing, whole-exome sequencing, shallow (~0.3x) whole-genome sequencing, and a 21-gene panel targeted capture sequencing. Everything was sequenced using the Illumina HiSeq and is provided in BAM or FASTQ format.

  Dataset EGAD00001006001

• Single-Cell Analysis of Human Adipogenesis

  The data in this study consists of RNA sequencing reads and read counts from single-cell and single-nuclei RNA sequencing experiments performed on two cell lines to investigate the transcriptional landscape of human adipogenesis in both the brown and white adipose tissue lineage. The two cell lines are human preadipocytes collected and isolated from a defined anatomical location in the neck of a single individual. This depot is known to harbor white adipose tissue (WAT) and brown adipose tissue (BAT). These white and brown preadipocytes were immortalized for the purposes of studying human adipogenesis in vitro. In this study we induced differentiation of these two preadipocyte lines and performed RNA sequencing on over 135,000 single cells spanning a 20-day time course from unperturbed preadipocytes to mature adipocytes from both brown and white lineages. Additionally, we performed both single-cell and single-nuclei RNA sequencing to comprehensively compare the advantages and disadvantages of either technique.

  Study phs002461

• The acute effects of morning bright light on the human white adipose tissue transcriptome: exploratory post hoc analysis

  The circadian rhythm of the central brain clock in the suprachiasmatic nucleus (SCN) is synchronized by light. White adipose tissue (WAT) is one of the metabolic endocrine organs containing a molecular clock, and it is synchronized by the SCN; excess WAT is a risk factor for health issues including type 2 diabetes mellitus (DM2). We hypothesized that bright-light exposure would affect the human WAT transcriptome. Therefore, we analyzed WAT biopsies from two previously performed randomized cross-over trials (trial 1: lean healthy men, and trial 2: men with obesity and DM2). RNA sequencing results showed major group differences between men with obesity and DM2 and lean healthy men, as well as a differential effect of bright light exposure.

  Study EGAS50000001206

• Transcriptome data of WS patients and controls

  Fibroblasts of 4 WS patients and 4 sex matched controls were transformed into iPSCs, which were then differentiated to Neuroepithelial Stem Cells (NESCs), and further differentiated into neurons. RNA sequencing was performed at the NESC stage and after 4 and 8 weeks of neural development for 3 replicates per individual using the Illumina TruSeq stranded library polyA method on the NovaSeq6000 platform at NGI Stockholm. The data was preprocessed using the nf-core/rnaseq (https://nf-co.re/rnaseq) that includes quality control, data cleaning, and read alignment to GRCh38 (STAR, v2.6.1d)

  Dataset EGAD50000001728

• Transcriptome sequencing of hepatocellular carcinoma biopsies (TACE study)

  Illumina-based RNA-Seq analysis of 93 liver samples. Biopsies of tumors and non-tumor tissues are included. Samples are stratified by response and non-response to TACE treatment.

  Dataset EGAD00001008158

• 79 Human Hearts snRNAseq

  Using single-nucleus RNA sequencing, we characterized the transcriptome of 880,000 nuclei from 18 control and 61 failing, nonischemic human hearts with pathogenic variants in DCM and ACM genes or idiopathic disease.

  Dataset EGAD00001009292

• FLT3 is genetically essential for ITD-mutated leukemic stem cells but dispensable for human HSCs

  bulk RNA sequencing of AML patients It contains 18 samples from primary AML patients. Half of the samples are control samples and half of the samples are FLT3-ITD knock-out (edited for the FLT3-ITD mutation). It is using Illumina high-throughput technology

  Dataset EGAD50000000636

• RNA-sequencing data from vitamin C experiment

  Fasq-files from 3 unaffected TET2 mutation carriers, 2 mutation carriers diagnosed with lymphoma and 3 family members without TET2 mutation. Time series data collected from 0, 6 and 12 months after daily dose of 1g vitamin C.

  Dataset EGAD00001010009

• Single-cell short-read transcriptomes from CH, MDS and AML patients with splicing factor mutations

  Single-cell RNA sequencing from CH (n = 2), MDS (n = 6, MDS02 in 2 replicates) and AML (n = 1, in 2 replicates) samples with mutations in splicing factors (SF3B1 - n = 8, U2AF1 n = 1). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011283

• MPRA-SCZ

  RNA-Seq and ATAC-Seq of iPSC derived neurons under baseline and KCl stimulation conditions from 10 distinct donors, including 5 healthy controls and 5 schizophrenic individuals. scATAC of human post mortem prefrontal cortex from 4 adult individuals including 2 neurotypical individuals and 2 schizophrenic individuals.

  Dataset EGAD00001011335

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10345i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003107

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10360i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003108

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10592i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003109

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10679iA

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003110

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10360i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003111

• Endometrial RNASeq of Patients with MRKH Syndrome and Healthy Controls

  Raw FastQ Files of 69 samples of endometrial tissue from uterus (rudiments) of patients diagnosed with MRKH Type 1/2 or healthy controls. Each sample consists of 2 lanes paired-end RNA sequencing data.

  Dataset EGAD00001006345

• Patient-tailored design for selective co-inhibition of leukemic cell subpopulations

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells of 2 acute myeloid leukemia patients at refractory stage. The profiling was performed using 10x Genomics Chromium Single Cell 3ʹ Gene Expression platform. The raw data are available as fastq files.

  Dataset EGAD00001006360

• DIPG MEK inhibition RNASeq

  RNA sequencing of Diffuse intrinsic pontine gliomas, primary patient derived DIPG cell cultures and isogenic trametinib resistant clones

  Dataset EGAD00001008212

• Non-invasive prediction of immunotherapy response (NIPIT) project

  This project aims to find transcriptomic biomarkers for immunotherapy response prediction in several cancer types. So far, we have performed poly-A RNA-seq using whloe blood and peripheral blood mononuclear cells from 33 non-small cell lung cancer patients, collected before and after the start of immunotherapy.

  Study EGAS50000000266

• Transcriptional data of human isogenic iPSCs

  This dataset contains bulk RNA-seq data from 12 autosomally isogenic human iPSCs. Three biological replicas from XXY (sample ID 419295-7), XX (sample ID 419298-419300), XY (sample ID 419302, 419305-6), and XO (sample ID 419308, 419310, 419312) hiPSC. RNA for this dataset was collected using Trizol method, and polyA library type was implemented. The libraries were sequenced using Illumina device. The sample reads are deposited as fastq files. Analysis have been done using reference alignment to GRCh38 reference genome.

  Dataset EGAD50000001361

• Translation of non-canonical open reading frames as a cancer cell survival mechanism in childhood medulloblastoma - RNA-Seq

  This study aims to investigate the dysregulation of RNA translation and identify functional non-canonical open reading frames (ORFs) as potential targets for medulloblastoma treatment. The study involves ribosome profiling and RNAseq of medulloblastoma tissues and cell lines to observe the translation of non-canonical ORFs. Multiple CRISPR-Cas9 screens will be used to identify functional non-canonical ORFs implicated in medulloblastoma cell survival.

  Dataset EGAD00001011192

• BLUEPRINT September 2016, RNA-Seq Acute Lymphocytic Leukemia for precursor B cell from venous blood, on Genome GRCh38

  RNA-Seq data for 6 sample(s) Acute Lymphocytic Leukemia for precursor B cell from venous blood, on Genome GRCh38. 6 run(s), 6 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002963

• BLUEPRINT September 2016, RNA-Seq Acute Myeloid Leukemia for blast cell from bone marrow, on Genome GRCh38

  RNA-Seq data for 1 sample(s) Acute Myeloid Leukemia for blast cell from bone marrow, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002962

• BLUEPRINT September 2016, RNA-Seq for monocyte T=10day_S100A9_RANKL_M-CSF from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=10day_S100A9_RANKL_M-CSF from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002961

• BLUEPRINT September 2016, RNA-Seq for monocyte T=6day_S100A9_RANKL_M-CSF from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=6day_S100A9_RANKL_M-CSF from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002960

• BLUEPRINT September 2016, RNA-Seq for monocyte T=1day_M-CSF_S100A9_4hr_RANL from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=1day_M-CSF_S100A9_4hr_RANL from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002959

• BLUEPRINT September 2016, RNA-Seq for monocyte T=2day_RANK_M-CSF from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=2day_RANK_M-CSF from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002957

• BLUEPRINT September 2016, RNA-Seq T-cell lymphoma for helper T cell from venous blood, on Genome GRCh38

  RNA-Seq data for 2 sample(s) T-cell lymphoma for helper T cell from venous blood, on Genome GRCh38. 2 run(s), 2 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002956

• BLUEPRINT September 2016, RNA-Seq for monocyte T=0day from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=0day from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002955

• BLUEPRINT September 2016, RNA-Seq Acute Lymphocytic Leukemia for precursor B cell from bone marrow, on Genome GRCh38

  RNA-Seq data for 8 sample(s) Acute Lymphocytic Leukemia for precursor B cell from bone marrow, on Genome GRCh38. 8 run(s), 8 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002953

• BLUEPRINT September 2016, RNA-Seq Acute Myeloid Leukemia for myeloid cell from venous blood, on Genome GRCh38

  RNA-Seq data for 2 sample(s) Acute Myeloid Leukemia for myeloid cell from venous blood, on Genome GRCh38. 2 run(s), 2 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002968

• BLUEPRINT September 2016, RNA-Seq for monocyte T=6day_RANK_M-CSF from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=6day_RANK_M-CSF from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002967

• BLUEPRINT September 2016, RNA-Seq for monocyte T=10day_RANK_M-CSF from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=10day_RANK_M-CSF from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002966

• BLUEPRINT September 2016, RNA-Seq for monocyte T=2day_S100A9_RANKL_M-CSF from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=2day_S100A9_RANKL_M-CSF from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002965

• BLUEPRINT September 2016, RNA-Seq for monocyte T=1day_4hr_RANK from venous blood, on Genome GRCh38

  RNA-Seq data for 1 sample(s) for monocyte T=1day_4hr_RANK from venous blood, on Genome GRCh38. 1 run(s), 1 experiment(s), 0 alignment(s). Part of BLUEPRINT (September 2016).Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001002964

• BLUEPRINT release August 2015, RNA-Seq for class switched memory B cell, on genome GRCh38

  RNA-Seq data for 1 class switched memory B cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001531

• BLUEPRINT release August 2015, RNA-Seq for conventional dendritic cell, on genome GRCh38

  RNA-Seq data for 1 conventional dendritic cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001540

• BLUEPRINT release August 2015, RNA-Seq for memory B cell, on genome GRCh38

  RNA-Seq data for 1 memory B cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001542

• BLUEPRINT release August 2015, RNA-Seq for regulatory T cell, on genome GRCh38

  RNA-Seq data for 1 regulatory T cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001546

• BLUEPRINT release August 2015, RNA-Seq for segmented neutrophil of bone marrow, on genome GRCh38

  RNA-Seq data for 3 segmented neutrophil of bone marrow sample(s). 3 run(s), 3 experiment(s), 3 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001579

• BLUEPRINT release August 2015, RNA-Seq for macrophage, on genome GRCh38

  RNA-Seq data for 18 macrophage sample(s). 19 run(s), 18 experiment(s), 18 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001582

• BLUEPRINT release August 2015, RNA-Seq for alternatively activated macrophage, on genome GRCh38

  RNA-Seq data for 4 alternatively activated macrophage sample(s). 6 run(s), 4 experiment(s), 4 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001586

• BLUEPRINT release January 2015, RNA-Seq for effector memory CD4-positive, alpha-beta T cell

  RNA-Seq data for 1 effector memory CD4-positive, alpha-beta T cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001163

• BLUEPRINT release January 2015, RNA-Seq for endothelial cell of umbilical vein (proliferating)

  RNA-Seq data for 1 endothelial cell of umbilical vein (proliferating) sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001166

• BLUEPRINT release January 2015, RNA-Seq for central memory CD4-positive, alpha-beta T cell

  RNA-Seq data for 1 central memory CD4-positive, alpha-beta T cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001172

• BLUEPRINT release January 2015, RNA-Seq for CD4-positive, alpha-beta T cell

  RNA-Seq data for 10 CD4-positive, alpha-beta T cell sample(s). 10 run(s), 10 experiment(s), 10 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001173

• BLUEPRINT release January 2015, RNA-Seq for central memory CD8-positive, alpha-beta T cell

  RNA-Seq data for 1 central memory CD8-positive, alpha-beta T cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001175

• BLUEPRINT release January 2015, RNA-Seq for erythroblast

  RNA-Seq data for 7 erythroblast sample(s). 29 run(s), 7 experiment(s), 7 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001177

• BLUEPRINT release January 2015, RNA-Seq for CD8-positive, alpha-beta T cell

  RNA-Seq data for 2 CD8-positive, alpha-beta T cell sample(s). 2 run(s), 2 experiment(s), 2 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001137

• BLUEPRINT release January 2015, RNA-Seq for endothelial cell of umbilical vein (resting)

  RNA-Seq data for 1 endothelial cell of umbilical vein (resting) sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001142

• BLUEPRINT release January 2015, RNA-Seq for CD38-negative naive B cell

  RNA-Seq data for 2 CD38-negative naive B cell sample(s). 2 run(s), 2 experiment(s), 2 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001145

• BLUEPRINT release January 2015, RNA-Seq for CD14-positive, CD16-negative classical monocyte

  RNA-Seq data for 8 CD14-positive, CD16-negative classical monocyte sample(s). 8 run(s), 8 experiment(s), 8 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001148

• BLUEPRINT release January 2015, RNA-Seq for effector memory CD8-positive, alpha-beta T cell

  RNA-Seq data for 1 effector memory CD8-positive, alpha-beta T cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001153

• BLUEPRINT release January 2015, RNA-Seq for cytotoxic CD56-dim natural killer cell

  RNA-Seq data for 3 cytotoxic CD56-dim natural killer cell sample(s). 3 run(s), 3 experiment(s), 3 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001159

• BLUEPRINT release August 2015, RNA-Seq for mature neutrophil, on genome GRCh38

  RNA-Seq data for 14 mature neutrophil sample(s). 14 run(s), 14 experiment(s), 14 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001474

• BLUEPRINT release August 2015, RNA-Seq for CD8-positive, alpha-beta thymocyte, on genome GRCh38

  RNA-Seq data for 1 CD8-positive, alpha-beta thymocyte sample(s). 1 run(s), 1 experiment(s), 1 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001478

• BLUEPRINT release August 2015, RNA-Seq for CD8-positive, alpha-beta T cell, on genome GRCh38

  RNA-Seq data for 2 CD8-positive, alpha-beta T cell sample(s). 2 run(s), 2 experiment(s), 2 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001488

• BLUEPRINT release August 2015, RNA-Seq for CD4-positive, alpha-beta thymocyte, on genome GRCh38

  RNA-Seq data for 1 CD4-positive, alpha-beta thymocyte sample(s). 1 run(s), 1 experiment(s), 1 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001489

• BLUEPRINT release August 2015, RNA-Seq for CD38-negative naive B cell, on genome GRCh38

  RNA-Seq data for 2 CD38-negative naive B cell sample(s). 2 run(s), 2 experiment(s), 2 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001500

• BLUEPRINT release August 2014, RNA-Seq for CD8-positive, alpha-beta T cell

  RNA-Seq data for 1 CD8-positive, alpha-beta T cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release August 2014. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001000912

• BLUEPRINT release August 2014, RNA-Seq for erythroblast

  RNA-Seq data for 4 erythroblast sample(s). 22 run(s), 4 experiment(s), 4 alignment(s). Part of BLUEPRINT release August 2014. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001000911

• BLUEPRINT release August 2014, RNA-Seq for CD14-positive, CD16-negative classical monocyte

  RNA-Seq data for 7 CD14-positive, CD16-negative classical monocyte sample(s). 7 run(s), 7 experiment(s), 7 alignment(s). Part of BLUEPRINT release August 2014. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001000928

• Dataset of CageKid Normal RNA samples

  Dataset of CageKid Normal RNA samples

  Dataset EGAD00001000719

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - MS-275 (20h), on genome GRCh38

  RNA-Seq data for 1 Acute Promyelocytic Leukemia - MS-275 (20h) sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002500

• BLUEPRINT release August 2016, RNA-Seq for colony forming unit erythroid, on genome GRCh38

  RNA-Seq data for 1 colony forming unit erythroid sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002509

• BLUEPRINT release August 2016, RNA-Seq for immature conventional dendritic cell - GM-CSF_IL4_T=6_days, on genome GRCh38

  RNA-Seq data for 3 immature conventional dendritic cell - GM-CSF_IL4_T=6_days sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002526

• BLUEPRINT release August 2016, RNA-Seq for late basophilic and polychromatophilic erythroblast, on genome GRCh38

  RNA-Seq data for 1 late basophilic and polychromatophilic erythroblast sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002402