3659 results for "RNA AND sequencing OR transcriptome"

in 28.48 milliseconds.

• BLUEPRINT release January 2015, RNA-Seq for class switched memory B cell

  RNA-Seq data for 1 class switched memory B cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001164

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - ATRA, on genome GRCh38

  RNA-Seq data for 3 Acute Promyelocytic Leukemia - ATRA sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002356

• BLUEPRINT release August 2016, RNA-Seq for mature eosinophil, on genome GRCh38

  RNA-Seq data for 2 mature eosinophil sample(s). 3 run(s), 3 experiment(s), 2 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002326

• BLUEPRINT release August 2016, RNA-Seq for Acute Myeloid Leukemia - CTR, on genome GRCh38

  RNA-Seq data for 7 Acute Myeloid Leukemia - CTR sample(s). 7 run(s), 7 experiment(s), 7 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002443

• BLUEPRINT release August 2016, RNA-Seq for osteoclast, on genome GRCh38

  RNA-Seq data for 2 osteoclast sample(s). 2 run(s), 2 experiment(s), 2 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002479

• RNA sequencing of primary B-cells infected with Epstein-Barr virus (EBV), treated with heat-inactivated EBV, CpG or BCR-crosslinking in presence or absence of Linrodostat

  B cells were isolated from buffy coat preparations of healthy donors using CD19 magnetic beads. B cells were then infected with EBV using spinoculation or activated with heat-inactivated EBV, respectively. Additionally cells were treated with 5ng/ml CpG or a BCR-crosslinking mixture in presence or absence of 10 µM Linrodostat (IDO1 inhibitor). RNA samples were isolated at 2 days post-infection / post-activation and one day 0 control with non-infected B cells was included.

  Dataset EGAD50000000306

• Hypothalamic transcriptome in Prader-Willi syndrome

  Transcriptional analysis of brain tissue from people with molecularly defined causes of obesity may highlight novel disease mechanisms and therapeutic targets. Prader-Willi syndrome (PWS) is a genetic obesity syndrome characterised by severe hyperphagia. We performed RNA sequencing of the hypothalamus from 4 individuals with PWS and 4 age-matched controls.

  Study EGAS00001002901

• Facioscapulohumeral dystrophy transcriptome signatures correlate with different stages of disease and are marked by different MRI biomarkers

  This project includes RNA-sequencing data from human FSHD and control skeletal muscle biopsies. This project includes data from 28 FSHD patients (total 37 samples, including vastus lateralis and tibialis anterior muscles) and 12 control individuals (total 24 samples, including vastus lateralis and tibialis anterior muscles).

  Study EGAS00001005782

• RNA sequencing of CD8 T cells from melanoma patients prior to and during checkpoint immunotherapy and untreated healthy controls

  We are interested in inter-individual variation in transcriptional response to immune checkpoint blockade. We have analysed poly A purified RNA expression from CD8 T cells (297 transcriptomes in total) isolated from metastatic melanoma patients (n=106) prior to and during treatment with either single agent (Pembrolizumab) or combination (Ipilimumab/ Nivolumab) immune checkpoint blockade. We compare expression at different stages of treatment and additionally contrast this with that from healthy controls (n=68).

  Dataset EGAD00001005973

• Custom long non-coding RNA capture enhances detection sensitivity in different human sample types.

  Long non-coding RNAs (lncRNAs) are a heterogeneous group of transcripts that lack protein coding potential and display regulatory functions in various cellular processes. As a result of their cell- and cancer-specific expression patterns, lncRNAs have emerged as potential diagnostic and therapeutic targets. The accurate characterization of lncRNAs in bulk transcriptome data remains challenging due to their low abundance compared to protein coding genes. To tackle this issue, we describe a unique short-read custom lncRNA capture sequencing approach that relies on a comprehensive set of 565,878 capture probes for 49,372 human lncRNA genes. This custom lncRNA capture approach was evaluated on various sample types ranging from artificial high-quality RNA mixtures to more challenging formalin-fixed paraffin-embedded tissue and biofluid material. The custom enrichment approach allows the detection of a more diverse repertoire of lncRNAs, with better reproducibility and higher coverage compared to classic total RNA-sequencing.

  Study EGAS00001005418

• MPM patients

  - RNA-sequencing data: 5 normal pleurae and 40 malignant pleural mesotheliomas - Targeted DNA-sequencing of the 165 genes included in the “Solid and Haematological tumors” panel (BRIGHTCore, Brussels, Belgium): 6 MPM samples. 2 FASTQ files for each sample (paired).

  Dataset EGAD00001008740

• Dataset of Master Samples submitted to other HIPO projects

  RNA-Seq, WES and WGS data of 5 rare tumor/control pairs which were submitted to other HIPO projects, not MASTER. The sequencing was always paired.

  Dataset EGAD00001008905

• TN

  In order to comprehensively investigate the genetic relationship between PTC tumors and benign nodules, we totally collected 127 fresh-frozen biopsies samples from 28 patients with concurrent thyroid benign nodule and PTC (n=20) or simple benign nodule (n=8). We carried out whole-exome sequencing on all the 127 biopsies samples and RNA-sequencing in total of 40 samples.

  Dataset EGAD00001003351

• MuTHER_adipose_tissue_small_RNA_expression

  We investigate the naturally occurring variation of small RNA expression in conjunction with genetic and gene expression variation. We shall assess the variation in subabdominal fat tissue small RNA levels in 168 unrelated MuTHER individuals. Using gene expression data from the same samples, we can survey how much the small RNA expression contributes to the variance in gene expression profiles. We can also take advantage of the high density genotyping data on these samples to identify genetic associations of small RNA expression levels, and the downstream effect of the genetic variants in small RNA sequence. Previous small RNA sequencing efforts have also extended the repertoire of small RNAs, and we hope to potentially find additional small RNAs active in adipose tissue biology. Altogether, the project should provide an exciting view into small RNA biology in humans, and lead to development of new methodology for analysis of molecular phenotype data.

  Study EGAS00001000212

• Single-cell RNA sequencing of sorted regulatory T cells

  Single-cell RNA sequencing of flow cytometry enriched CD4+ CD127- CD25+ regulatory T cells from 8 systemic lupus erythematosus patients (SLE_001 to SLE_007, and SLE_009) collected at baseline (day 0, before interleukin-2 immunotherpay) and day 5 (after 1 treatment cycle of interleukin-2 immunotherapy). Sorted immune cells were hash tagged and then stained with TotalSeq Human Universal Cocktail (Biolegend) before further processing for single-cell RNA sequencing using the 10X-Genomics platform (incl. generation of TCR libraries). Samples from patients SLE_001, SLE_002, SLE_004, SLE_006 were collected and processed on the first day of experiment (Day 1), and samples from patients SLE_003, SLE_005, SLE_007, SLE_009 on the second day of experiment (Day 2). On each day, samples were pooled and distributed to four lanes on the chromium controller. Run ID 245269 and ID 245270 identify samples sequenced on separate flow cells. Provided are raw sequencing files.

  Dataset EGAD50000000663

• Single-cell multi-omic analysis of control and glioblastoma samples from the brain and border regions.

  Single-cell RNA-sequencing. Some samples were analyzed using CITE-Seq and samples were multiplexed and run on the same 10X reaction

  Dataset EGAD50000000045

• GBM Study Complete Raw Data

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside total RNA from the tumors.

  Dataset EGAD50000000650

• Single-cell/single-nucleus RNA-seq of diffuse hemispheric gliomas, H3G34-mutant.

  9 DHG-H3G34 patient samples were sequenced by paired-end scRNA-sequencing using the Smart-Seq2 protocol on a NextSeq 500 sequencer (Illumina). Illumina bcl2fastq 1.5 was used for demultiplexing. This dataset contains the resulting 9,408 fastq files of 4,704 single cells/nuclei sequenced.

  Dataset EGAD50000000760

• Single-cell RNA-sequencing data of human iPSC-derived (hiPSC-derived) astrocytes, both alone and in co-culture with neurons, to define the molecular response of astrocytes to misfolded alpha-synuclein.

  Samples were derived from an human iPSC-derived astrocyte line, both alone and in co-culture with neurons +/- alpha-synuclein oligomer treatment.

  Dataset EGAD50000001110

• single cell data from HPV-positive head and neck cancer patients receiving induction CTLA-4 and PD-1 immune checkpoint blockade

  Baseline and on-treatment tumor samples from human papillomavirus-positive oropharynx cancer patients receiving anti-CTLA-4 and anti-PD-1 immune checkpoint blockade were analyzed by single-cell RNA and TCR sequencing.

  Dataset EGAD50000000487

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• Tomoseq data set

  This object contains raw FATSq files and processed files of the sections of an entire EMD lesions of patient PT01A and PT10. The raw files represent bulk RNA sequencing of each of the sections. The processed file is a CSV file that contains gene expression.

  Dataset EGAD50000000335

• This dataset contains the Fastq files from the RNA sequencing

  Whole blood was stimulated Ex vivo with Heat Killed M abscessus and M haemophilum or left untreated with Saline for each individual Healthy Control and MH-infected participants

  Dataset EGAD50000001566

• Sequencing data for oesophageal and related samples - Mourikis et al (RNA)

  Data supporting: "Patient-specific detection of cancer genes reveals recurrently perturbed processes in esophageal adenocarcinoma." Mourikis et al. RNAseq (BAM files) 137 samples

  Dataset EGAD00001004776

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing recovered to affected disease phase.

  Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006382

• RNAseq data

  Bulk RNAseq of sigmoid colon biopsies from healthy volunteers and ulcerative colitis patients. Subjects were treated with Placebo or IL-22Fc at different doses, and biopsies were collected at day 0 and day 30 post treatment and prepared for RNA sequencing.

  Dataset EGAD00001008816

• Islet RFX6 Study Manuscript Data

  This submission includes raw FASTQ files (for bulk RNA-seq and 10X joint snATAC+snRNA multiome profiling experiments), sample phenotype files, and genotypes for the data included in the manuscript.

  Dataset EGAD00001008777

• Total RNAseq in the sporadic ALS and healthy control motor cortex

  The motor cortex is the earliest affected brain region in ALS. This dataset contains total RNA sequencing (stranded, 2x101bp) data derived from the motor cortex of 11 sporadic ALS patients and 8 healthy controls.

  Dataset EGAD00001006022

• Sequencing data for oesophageal and related samples - Ng, Contino et al (RNA)

  Data supporting: "Interplay of processes shapes structural variations undergoing selection in oesophageal adenocarcinoma" Ng, Contino et al. RNAseq (BAM files) 214 oesophageal adenocarcinoma samples

  Dataset EGAD00001007809

• A novel subset of human CD33+ haematopoietic stem cells characterized at single-cell resolution

  This dataset comprises single-cell RNA sequencing of the human Lin-CD34+38-45RA-90+49f+ phenotype isolated from 2 normal cord donors. Library preparation was performed following a modified CEL-Seq2 protocol.

  Dataset EGAD00001003955

• Sequencing data for oesophageal and related samples - Alex Frankell et al (RNA)

  Data supporting: "The landscape of selection in 551 Esophageal Adenocarcinomas defines genomic biomarkers for the clinic." Frankell et al. RNAseq (BAM files) 116 tumours

  Dataset EGAD00001004423

• RNA sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region RNAseq from 4 NSCLC patients, totaling 12 tumor samples and 7 matched control samples.

  Dataset EGAD00001008482

• Juvenile Sjogren's Syndrome (JSS) Transcriptome Study

  Sjögren's disease (SjD) is a systemic autoimmune disorder with major clinical manifestations of dryness in the eyes and mouth, fatigue, and joint pain. Our interdisciplinary experts in SjD at the University of Florida newly discovered and established a cohort of SjD in children. Many of these patients with childhood SjD (cSjD) demonstrated a prominent feature of recurrent parotitis (RP). To understand the immunopathogenesis of childhood SjD (cSjD) for the first time in the field, we profiled the transcriptome of five groups of four PBMC samples by unbiased, high-throughput single-cell RNA sequencing (scRNA-seq): cSjD (n=4), non-cSjD (n=4), biopsy-positive non-cSjD (BP, n=4), biopsy-positive non-cSjD with RP (BPRP, n=4), and healthy controls (HC, n=4). In this study, RNA sequencing data, as well as all barcodes.tsv.gz, features.tsv.gz, and matrix.mtx.gz that may be used to create a Seurat object in R, will be availableTo protect the confidentiality of subjects, certain data were not assessed or collected in the subject phenotype dataset, such as race, age, height, weight, and education.

  Study phs003048

• Postmortem Single Nuclei and Bulk RNA-seq data of the Motor Cortex and Spinal Cord for Healthy, C9ALS and sALS Patients

  This dataset contains both snRNA-seq and bulk RNA-seq data from 19 different patients, comprising of 9 healthy controls (4 Spinal Cord, 5 Motor Cortex) as well as 5 C9ALS patients and 5 sporadic ALS patients, each with paired data from the spinal cord and motor cortex. For the snRNA-seq data, fastq files containing the raw reads are provided, many of these samples were pooled for sequencing and subsequently require demultiplexing using SNPs using a tool such as freemuxlet. The paired bulk RNA-seq data (raw fastq files) can be used to acquire the ground truth per patient - a list of pooled samples can be found in map.txt. snRNA-seq data was produced using the 10X Genomics 3' v3 kit and bulk RNA-seq was produced using the Illumina TruSeq v2 kit.

  Dataset EGAD00001009686

• Single cell transcriptome sequencing of the developing human embryonic meninges

  There are no effective medical therapies for meningiomas, partly due to our limited understanding of their cellular origin and composition For this purpose, we generated data to make a comprehensive reference single cell and spatial transcriptomic atlas of human fetal meninges. Samples of meninges from human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development, Furthermore, this dataset should help discover cells of origin for meningiomas.

  Study EGAS50000000980

• Genomic analysis of pancreatic neuroendocrine tumour with MEN1, ATRX, or DAXX mutations

  This dataset includes 52 samples from 19 individuals with pancreatic neuroendocrine tumours. These samples were analyzed using RNA-sequencing, whole-exome sequencing, shallow (~0.3x) whole-genome sequencing, and a 21-gene panel targeted capture sequencing. Everything was sequenced using the Illumina HiSeq and is provided in BAM or FASTQ format.

  Dataset EGAD00001006001

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. One possibility for this inefficiency is an incomplete understanding of the molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to develop a foundational dataset for identifying candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Study EGAS00001003667

• ICARUS-LUNG01 dataset

  A total of 46 frozen tumor biopsies underwent WES analysis, while 41 blood samples were used as germline controls.Tumor samples qualified for whole exome sequencing (WES) if they contained ≥10% tumor cells. For bulk RNA-seq, 20 paired baseline and on-treatment frozen tumor biopsies were analyzed. Tumor samples qualified if they contained ≥30% tumor cells.

  Dataset EGAD50000001014

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  The dataset contains bulk RNA sequencing data from 12 pediatric thymus samples collected during cardiac surgeries. These samples represent immunologically healthy donors with a mean age of 6 months. The sequencing was performed using Illumina HiSeq4000, and the processed files are available in standard formats such as FASTQ.

  Dataset EGAD50000001120

• Human Neuroblastoma

  This dataset comprises single-nucleus transcriptomic profiles from 10 human neuroblastoma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001596

• Human Paraganglioma

  This dataset comprises single-nucleus transcriptomic profiles from 9 human paraganglioma samples. Nuclei were isolated and processed using the SMART-Seq2 protocol to enable full-length, high-resolution RNA sequencing at the single-nucleus level. cDNA libraries were generated and sequenced on the Illumina HiSeq 2500 platform. The resulting raw sequencing data are provided as .fastq files for downstream analysis.

  Dataset EGAD50000001689

• Epigenomics and Single-cell Sequencing Define Cellular Heterogeneity in Langerhans Cell Histiocytosis

  Epigenomic and transcriptomic analysis of Langerhans cell histiocytosis (LCH) biopsies. Single-cell RNA-seq (10x Genomics) of seven LCH biopsies. ATAC-seq data from four sorted cell populations (in duplicate) from one LCH biopsy.

  Dataset EGAD00001005280

• Single-Cell Analysis of Human Adipogenesis

  The data in this study consists of RNA sequencing reads and read counts from single-cell and single-nuclei RNA sequencing experiments performed on two cell lines to investigate the transcriptional landscape of human adipogenesis in both the brown and white adipose tissue lineage. The two cell lines are human preadipocytes collected and isolated from a defined anatomical location in the neck of a single individual. This depot is known to harbor white adipose tissue (WAT) and brown adipose tissue (BAT). These white and brown preadipocytes were immortalized for the purposes of studying human adipogenesis in vitro. In this study we induced differentiation of these two preadipocyte lines and performed RNA sequencing on over 135,000 single cells spanning a 20-day time course from unperturbed preadipocytes to mature adipocytes from both brown and white lineages. Additionally, we performed both single-cell and single-nuclei RNA sequencing to comprehensively compare the advantages and disadvantages of either technique.

  Study phs002461

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Peripheral clonal expansion of T cells (scRNA-seq)

  Single-cell RNA-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005464

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Tumor gene expression profiles for the study "TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells"

  RNA was extracted from formalin-fixed and paraffin embedded tumors of a large cohort of bladder cancer patients before treatment with anti-PD-L1. RNA was sequenced using a capture based approach (exome capture, RNA access).

  Dataset EGAD00001003977

• Identification of molecule relationship between intravenous leiomyomatosis and uterus myoma

  Up to now, there are two hypothesis about the pathogenesis of the relationship of intravenous leiomyomatosis and uterine myoma. One theory suggests that the IVL comes from the smooth muscle cell in the vessel wall.The other theory indicates that the IVL derives from the uterine myometrium. However, limited to the technology, few studies have been deeply explore the underlying relation. In this study, we employ the RNA sequencing to explore the molecule relationship between IVL and uterus myoma. In order to identify the molecule relationship between IVl and uterine myoma we conducted transcriptome sequencing and bioinformaitc analysis

  Dataset EGAD00001003356

• Single-cell transcriptome landscape of developing fetal gonads defines somatic cell lineage specification in humans

  Single-cell RNA-seq dataset recovering the gene expression programs of around 128,000 single cells derived from 17 fetal testes and 16 fetal ovaries from 5 to 12 postconceptional weeks.

  Dataset EGAD00001009811

• FLT3 is genetically essential for ITD-mutated leukemic stem cells but dispensable for human HSCs

  bulk RNA sequencing of AML patients It contains 18 samples from primary AML patients. Half of the samples are control samples and half of the samples are FLT3-ITD knock-out (edited for the FLT3-ITD mutation). It is using Illumina high-throughput technology

  Dataset EGAD50000000636

• RNA-sequencing data from vitamin C experiment

  Fasq-files from 3 unaffected TET2 mutation carriers, 2 mutation carriers diagnosed with lymphoma and 3 family members without TET2 mutation. Time series data collected from 0, 6 and 12 months after daily dose of 1g vitamin C.

  Dataset EGAD00001010009

• DIPG MEK inhibition RNASeq

  RNA sequencing of Diffuse intrinsic pontine gliomas, primary patient derived DIPG cell cultures and isogenic trametinib resistant clones

  Dataset EGAD00001008212

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10592i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003109

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10679iA

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003110

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10360i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003108

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10360i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003111

• Single cell mRNA sequencing of CD11b cells from a primary GBM - SF 10345i

  We collected fresh tissue from an untreated GBM directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine after selection of CD11b+ cells using magnetic beads.

  Dataset EGAD00001003107

• Single-cell short-read transcriptomes from CH, MDS and AML patients with splicing factor mutations

  Single-cell RNA sequencing from CH (n = 2), MDS (n = 6, MDS02 in 2 replicates) and AML (n = 1, in 2 replicates) samples with mutations in splicing factors (SF3B1 - n = 8, U2AF1 n = 1). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011283

• Endometrial RNASeq of Patients with MRKH Syndrome and Healthy Controls

  Raw FastQ Files of 69 samples of endometrial tissue from uterus (rudiments) of patients diagnosed with MRKH Type 1/2 or healthy controls. Each sample consists of 2 lanes paired-end RNA sequencing data.

  Dataset EGAD00001006345

• Patient-tailored design for selective co-inhibition of leukemic cell subpopulations

  Single-cell RNA sequencing was performed on bone marrow mononuclear cells of 2 acute myeloid leukemia patients at refractory stage. The profiling was performed using 10x Genomics Chromium Single Cell 3ʹ Gene Expression platform. The raw data are available as fastq files.

  Dataset EGAD00001006360

• MPRA-SCZ

  RNA-Seq and ATAC-Seq of iPSC derived neurons under baseline and KCl stimulation conditions from 10 distinct donors, including 5 healthy controls and 5 schizophrenic individuals. scATAC of human post mortem prefrontal cortex from 4 adult individuals including 2 neurotypical individuals and 2 schizophrenic individuals.

  Dataset EGAD00001011335

• Transcriptome data of WS patients and controls

  Fibroblasts of 4 WS patients and 4 sex matched controls were transformed into iPSCs, which were then differentiated to Neuroepithelial Stem Cells (NESCs), and further differentiated into neurons. RNA sequencing was performed at the NESC stage and after 4 and 8 weeks of neural development for 3 replicates per individual using the Illumina TruSeq stranded library polyA method on the NovaSeq6000 platform at NGI Stockholm. The data was preprocessed using the nf-core/rnaseq (https://nf-co.re/rnaseq) that includes quality control, data cleaning, and read alignment to GRCh38 (STAR, v2.6.1d)

  Dataset EGAD50000001728

• 79 Human Hearts snRNAseq

  Using single-nucleus RNA sequencing, we characterized the transcriptome of 880,000 nuclei from 18 control and 61 failing, nonischemic human hearts with pathogenic variants in DCM and ACM genes or idiopathic disease.

  Dataset EGAD00001009292

• Transcriptome sequencing of hepatocellular carcinoma biopsies (TACE study)

  Illumina-based RNA-Seq analysis of 93 liver samples. Biopsies of tumors and non-tumor tissues are included. Samples are stratified by response and non-response to TACE treatment.

  Dataset EGAD00001008158

• Single cell RNA-seq of 24 samples from 13 individual human embryonic meninges of PCW 5.0-13.0 using 10X chromium technology

  A total of 24 samples of meninges from 13 normal human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development. All libraries were sequenced on an Illumina NovaSeq 6000 using S4 to a target sequencing depth of 100,000 reads/cell. Final data after processing with STARSolo 2.7.10a, using human genome GRCh38.p12 and transcript annotations from ENSEMBL release 93 from reference package GRCh38-3.0.0 as available from 10Xgenomics, consists of 24 BAM files.

  Dataset EGAD50000001434

• Single cell RNA sequencing data in "Three-dimensional human alveolar stem cell culture models reveal infection response to SARS-CoV-2"

  This dataset includes a total of 5 single cell RNA sequencing (scRNAseq) data of SARS-CoV-2 infected human alveolar stem cell culture models. Two scRNAseq data were obtained from SARS-CoV-2 infection with MOI of 1.0 (1 for control and 1 for infected case) and the other three were obtained from SARS-CoV-2 infection with MOI of 0.1 in the study entitled "Three-dimensional human alveolar stem cell culture models reveal infection response to SARS-CoV-2". The 10x Chromium Single Cell 3' Reagent kits were used to generate libraries.

  Dataset EGAD00001006242

• Single-cell RNA-seq of human kidney tumors

  Fresh nephrectomy samples were collected from a total of 5 untreated ccRCC patients. Out of these 5 patients, 7 samples were obtained. Two samples consisted of fresh versus frozen single cells from the primary tumor site of one patient. Two other samples consisted of matched primary and distant thrombus sites (the vena cava) of a second patient. The three remaining samples came from the primary tumor sites of three distinct ccRCC patients. Single-cells were captured into 10x barcoded gel beads and RNA-sequencing library preparation was done using Chromium Single Cell 3' v2 chemistry. Sequencing was performed on a Illumina HiSeq 4000 sequencer.

  Dataset EGAD00001009306

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing muscle during affected phase to healthy control, and affected patient with and without additional EARS2 mutations.

  Illumina Nextseq total RNA sequencing profiles of skeletal muscle biopsies of 5 affected patients (F3/2M, F4/1F, F5/1M, F2/2F, F2/1M) compared to 6 control (Control040500, Control3509, Control3934, Control3949, Control4994, Control5106) and comparing 3 patients with additional EARS2 mutations (F2/2F, F2/1M, F5/1M) to 2 patients without (F3/2M, F4/1F). Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006381

• RNA-seq of longitudinal human blood and nose swab samples from a controlled human infection experiment with SARS-CoV-2 virus

  Controlled human infection experiments enable longitudinal profiling of immune responses to a pathogen. 36 healthy volunteers aged 18-29 years, with no evidence of previous infection or vaccination, were inoculated with SARS-CoV-2 virus and quarantined for 14 days. Blood samples (n=374) for RNA sequencing were collected into PAXgene tubes before virus challenge, 6 hours after challenge, daily thereafter for 14 days and on day 28. Mid-turbinate nose swabs (n=96) for RNA sequencing were collected before virus challenge, and on days 1, 3, 5, 7, 10 and 14 after challenge, preserved in RNAprotect. 18 of 36 participants developed a replicative SARS-CoV-2 infection as evidenced by consecutive PCR-positive swabs for the virus. For every participant, blood RNA from selected days were extracted and depleted for genomic DNA and globin mRNA, before cDNA libraries were constructed using KAPA RNA HyperPrep with RiboErase kits. Libraries were sequenced on the Illumina NovaSeq 6000 platform using NovaSeq 6000 S4 Reagent Kits (200 cycles). Nose swab RNA samples were extracted and depleted for genomic DNA before cDNA libraries were constructed using KAPA mRNA HyperPrep Kits. Libraries were sequenced on the Illumina NextSeq platform the using the NextSeq 500/550 High Output Kit (75 cycles).

  Dataset EGAD50000000942

• The acute effects of morning bright light on the human white adipose tissue transcriptome: exploratory post hoc analysis

  The circadian rhythm of the central brain clock in the suprachiasmatic nucleus (SCN) is synchronized by light. White adipose tissue (WAT) is one of the metabolic endocrine organs containing a molecular clock, and it is synchronized by the SCN; excess WAT is a risk factor for health issues including type 2 diabetes mellitus (DM2). We hypothesized that bright-light exposure would affect the human WAT transcriptome. Therefore, we analyzed WAT biopsies from two previously performed randomized cross-over trials (trial 1: lean healthy men, and trial 2: men with obesity and DM2). RNA sequencing results showed major group differences between men with obesity and DM2 and lean healthy men, as well as a differential effect of bright light exposure.

  Study EGAS50000001206

• RNA-seq BAM files from newborn screening dried blood spot samples

  Paired-end RNA-seq BAM files from 21 newborn screening dried blood spot (DBS) samples. These DBS samples were obtained from extremely low gestional age newborns, where 10 of them were affected by a fetal inflammatory response (FIR) before birth, and 11 were unaffected. Total RNA was sequenced using an Illumina NextSeq-500 instrument. The sample preparation protocol included the depletion of rRNA and globin mRNA using the Globin Zero Gold rRNA Removal Kit from Illumina. Libraries were prepared using the NebNext Ultra TM II Directionl RNA LIbrary Prep Kit (New England Biolabs). There is one BAM file per sample and there is an additional BAM file, corresponding to sample BS13, which was downsampled to 1/4 of its original depth (see BS13_README file for details).

  Dataset EGAD00001005009

• FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls.

  FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls. The POP study placental biopsies were collected within 30 minutes of birth and flash frozen in RNAlater (ThermoFisher). For each biopsy, total placental RNA was extracted from approximately 5 mg of tissue using the “mirVana miRNA Isolation Kit” (Ambion) followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments. RNA-libraries were prepared from 1g of total placental RNA with the TruSeq Stranded mRNA Library Prep Kit (Illumina) which captures polyA-tailed transcripts by oligo-dT beads, then pooled and sequenced (single-end, 50bp) using a Single End V4 cluster kit and Illumina HiSeq2500

  Dataset EGAD00001006304

• MOSAIC Window DLBCL Data

  This dataset will include Spatial Transcriptomics from the 10x Genomics Visium SD technology, Single-Cell RNA-Seq from the 10x Genomics Chromium Flex protocol, Bulk RNA-Seq (sequenced on Illumina), WES (sequenced on Illumina), H&E, and Clinical data from 10 DLBCL patients. For Visium and Chromium data we are sharing the outputs of respectively Space Ranger and Cell Ranger. For Bulk RNA-Seq we are including processed files such as counts.tsv, FPKM.tsv, fusion_genes.tsv, TPM count matrix.tsv, DESeq2 count matrix.tsv, multiqc_report. For WES, we are sharing the presence or absence of single nucleotide variants (SNVs), small insertions and deletions (indels), and copy number variants (CNVs).* Researchers from private or public institutions outside the MOSAIC Consortium will be able to apply to access this data and, pending approval, use the data for their research.

  Dataset EGAD50000001702

• MOSAIC Window Ovarian Data

  This dataset will include Spatial Transcriptomics from the 10x Genomics Visium SD technology, Single-Cell RNA-Seq from the 10x Genomics Chromium Flex protocol, Bulk RNA-Seq (sequenced on Illumina), WES (sequenced on Illumina), H&E, and Clinical data from 15 Ovarian patients. For Visium and Chromium data we are sharing the outputs of respectively Space Ranger and Cell Ranger. For Bulk RNA-Seq we are including processed files such as counts.tsv, FPKM.tsv, fusion_genes.tsv, TPM count matrix.tsv, DESeq2 count matrix.tsv, multiqc_report. For WES, we are sharing the presence or absence of single nucleotide variants (SNVs), small insertions and deletions (indels), and copy number variants (CNVs).* Researchers from private or public institutions outside the MOSAIC Consortium will be able to apply to access this data and, pending approval, use the data for their research.

  Dataset EGAD50000001704

• MOSAIC Window Mesothelioma Data

  This dataset will include Spatial Transcriptomics from the 10x Genomics Visium SD technology, Single-Cell RNA-Seq from the 10x Genomics Chromium Flex protocol, Bulk RNA-Seq (sequenced on Illumina), WES (sequenced on Illumina), H&E, and Clinical data from 10 Mesothelioma patients. For Visium and Chromium data we are sharing the outputs of respectively Space Ranger and Cell Ranger. For Bulk RNA-Seq we are including processed files such as counts.tsv, FPKM.tsv, fusion_genes.tsv, TPM count matrix.tsv, DESeq2 count matrix.tsv, multiqc_report. For WES, we are sharing the presence or absence of single nucleotide variants (SNVs), small insertions and deletions (indels), and copy number variants (CNVs).* Researchers from private or public institutions outside the MOSAIC Consortium will be able to apply to access this data and, pending approval, use the data for their research.

  Dataset EGAD50000001706

• single-cell RNA-sequencing of human/mouse colonic crypts

  Human colonic stem cells are slow cycling compared with murine rapid cycling stem cells. Our study aims to identify slow cycling stem cell in human normal colon in vivo and to analyze gene signatures among rapid cycling stem cells, slow cycling stem cells and secretory progenitor cells using single cell RNA-seqencing . We further investigated in vivo dynamics of human colonic stem cell using patient-derived gene-enginered organoids and orthotopic xenotransplantation.

  Study JGAS000550

• Single cell RNA-seq and ATAC-seq of human fetal forebrain tissue, weeks 8 to 11.

  Single cell RNA-seq from 6 and single nuclei ATAC-seq from 3 human fetal tissue samples. Samples from 8 to 11 weeks. Includes a 8.5 weeks samples with matching both ATAC-seq and RNA-seq runs. Data was sequenced using 10X Genomics chromium technology, for scRNA-seq samples belong to v2 and v3.

  Dataset EGAD00001008653

• single cell RNA-seq of bone marrow from infants with MLL-rearranged Acute Lymphoblastic Leukemia by single cell RNA-sequencing

  This dataset contains two experiments. 1) Single cell RNA-seq of diagnostic samples from patients with MLL-rearranged infant ALL that underwent relapse or not (samples ending in R relapsed, samples ending in N did not). For some of the patients, multiple indipendent plates were produced (each plate is a sample). 2) in vitro prednisolone exposure experiment. diagnostic bone marrow samples from patient 4662R were cultured for three days with and without prednisolone. Single cell experiments were conducted according to Muraro et al (cell systems, 2016, doi:10.1016/j.cels.2016.09.002). Cell barcodes and UMI sequences are embedded in the header of each fastq entry. Cell barcodes irrelevant to this experiment were removed before submission.

  Dataset EGAD00001005461

• RNA-seq of cultured human hematopoietic stem and progenitor cells from umblical cord blood in cytokine-rich ex vivo culture conditions following sphingolipid modulation

  In order to elucidate the biological pathways altered by sphingolipid modulation with N-(4-hydroxyphenyl) retinamide (4HPR) treatment in human HSPC that may contribute to the restraint in proliferation while promoting persistence of HSC self-renewal, as well as determine the mechanism of synergy in enhancement of HSC self-renewal with CB CD34+ agonists UM171 and StemRegenin 1 (SR1), we performed RNA-sequencing (RNA-Seq) of 3 pools of lin-CB cells following 2 or 4 days with DMSO, 4HPR, UM171+SR1 or 3-Factor (4HPR+UM171+SR1). We identified modulation of sphingolipid metabolism regulates self-renewal through activating coordinated stress pathways that coalesce on endoplasmic reticulum stress and autophagy programs.

  Dataset EGAD00001005140

• RNA-sequencing of a representative cohort of 209 AML cases

  Sample libraries were prepped using 500 ng of input RNA according to the KAPA RNA HyperPrep Kit with RiboErase (HMR) (Roche) using Unique Dual Index adapters (Integrated DNA Technologies, Inc.). Amplified sample libraries were paired-end sequenced (2x100 bp) on the Novaseq 6000 platform (Illumina) and aligned against the human genome (hg19) using STAR v2.5.4b2.

  Dataset EGAD00001007581

• RNAseq data of polyA+ RNA from Leukocytes from 624 individuals of the ProgeNIA cohort.

  We sequenced the polyA+ fraction of the RNA of the leukocytes from 624 sardinian individuals with RNAseq. Prior to library preparation we added either ERCC ExFold RNA Spike-In. An average of 60M reads per samples with 51 bp paired-end reads were generated on a HiSeq 2000 (Illumina). Sequencing reads were then aligned using STAR-2.2.0c2 to the h37d5 reference genome supplemented with the ERCC spike-ins sequences. We further provided an exon-exon junction database that we generated from the GENCODE v14 annotation. In order to remove a contamination from a parallel experiment, we discarded any reads that mapped to the genomic regions of CBLB (chr3:105370773-105592330) and BCL11A (chr2:60672555-60784156). Filtered aligned reads (bam format) are shared.

  Dataset EGAD00001003102

• single-cell RNA-seq Case-Control study of children progressing to Type1 diabetes

  It was a single-cell RNA sequencing study on the PBMC samples from four Finnish children at risk of developing Type 1 diabetes and their gender age and HLA matched control children. All four Case children were positive for multiple islet specific autoantibodies and two of them also progressed to clinical disease during the follow up whereas the control children remain negative for all autoantibodies. Single-cell analysis confirmed some of the signatures obtained from the bulk data. It identified that high IL32 in case samples in the bulk RNA-seq was contributed mainly by activated T cells and NK cells. Trajectory analysis of the scRNA-seq data suggested that IL32 expression increased as the T cells moved towards activated state.

  Dataset EGAD00001005768

• Bulk RNA and ATACseq of 2 XLP patients and 5-6 HD

  The dataset contains five samples from P1, one pre-HSCT and four post-HSCT, one sample from P2 and 5-6 HD. RNAseq reads were processed using the LUMC BIOWDL RNAseq pipeline v5.0.0 (https://github.com/biowdl/RNA-seq). Genes with log2CPM≥1 in at least 10% of all samples were retained for downstream analysis. Differential gene expression analysis was performed using the dgeAnalysis R-Shiny application (https://github.com/LUMC/dgeAnalysis/tree/v1.4.4). ATACseq reads were processed using the LUMC BIOWDL Chipseq pipeline 1.0.0-dev (https://github.com/biowdl/ChIP-seq).

  Dataset EGAD50000002072

• TTV018_RORC_IBD_associated_genotype_effects_on_RORgT_expression_and_function_in_ex_vivo_T_cells

  RNA sequencing of peripheral immune cells from patients +/- an IBD risk variant. Peripheral immune cells +/- in vitro test compound treatment.This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001001590

• Paired RNA-Seq was performed on 125 samples of low grade pediatric glioma

  Paired RNA-Seq was performed on 125 samples of low grade pediatric glioma. The sequencing was done with Illumina Novaseq 6000 and the Illumina TruSeq stranded mRNA kit.

  Dataset EGAD00001010171

• RNA-seq of Liver Cancer

  The present series corresponds to 161 RNA-seq samples from tumors with matched WES or WGS. Hepatocellular carcinoma (HCC) accounts for more than 90% of liver cancers, and is a major health problem. It is the 3rd cause of cancer-related mortality. Advances in genomic analyses have formed a comprehensive understanding of different underlying pathobiological layers resulting in hepatocarcinogenesis. Thus, the development of next-generation sequencing technologies has made it possible to generate more comprehensive catalogues of somatic alteration events (single nucleotide substitutions, structural variations, and epigenetic changes) in liver cancer genome than ever before.

  Dataset EGAD00001003993

• Epigenome cohort 30 Patient DNA and RNA

  This dataset includes RNA-seq, DNA and Chip-Seq data of samples from our paper.

  Dataset EGAD00001009041

• Genomics of enteropathy-associated T cell lymphoma (EATL)

  Whole exome sequencing of enteropathy-associated T cell lymphoma (EATL) tumors and paired normals, as well as RNA-sequencing of EATL tumors: including (1) 69 exome capture, paired-end Illumina Hiseq sequencing, BAM files from EATL tumor samples, (2) 36 exome capture, paired-end Illumina Hiseq sequencing, BAM files from EATL paired normal samples, and (3) 32 RNAseq, paired-end Illumina Hiseq sequencing, BAM files from EATL tumor samples.

  Dataset EGAD00001003284

• Non-invasive prediction of immunotherapy response (NIPIT) project

  This project aims to find transcriptomic biomarkers for immunotherapy response prediction in several cancer types. So far, we have performed poly-A RNA-seq using whloe blood and peripheral blood mononuclear cells from 33 non-small cell lung cancer patients, collected before and after the start of immunotherapy.

  Study EGAS50000000266

• RNA-seq data of human skeletal muscle biopsies

  These datasets contain RNA-seq data of human skeletal muscle biopsies before or after exercise. This contains data of three projects on skeletal muscle. Paired Fastq files are uploaded. - HeteroFiber: Individual muscle fibers from human biopsies, collected at rest from m. vastus lateralis. (n = 1044) - ExerFiber: Individual muscle fibers from human biopsies (m. vastus lateralis), collected immediately after or 3 hours after HIIT exercise session. (n = 2096) - Bulk muscle exercise: bulk muscle biopsies at rest, immediately after or 3h after HIIT exercise session. (n = 126)

  Dataset EGAD50000000612

• Transcriptional data of human isogenic iPSCs

  This dataset contains bulk RNA-seq data from 12 autosomally isogenic human iPSCs. Three biological replicas from XXY (sample ID 419295-7), XX (sample ID 419298-419300), XY (sample ID 419302, 419305-6), and XO (sample ID 419308, 419310, 419312) hiPSC. RNA for this dataset was collected using Trizol method, and polyA library type was implemented. The libraries were sequenced using Illumina device. The sample reads are deposited as fastq files. Analysis have been done using reference alignment to GRCh38 reference genome.

  Dataset EGAD50000001361

• BLUEPRINT release August 2016, RNA-Seq for blast forming unit erythroid, on genome GRCh38

  RNA-Seq data for 1 blast forming unit erythroid sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002365

• Translation of non-canonical open reading frames as a cancer cell survival mechanism in childhood medulloblastoma - RNA-Seq

  This study aims to investigate the dysregulation of RNA translation and identify functional non-canonical open reading frames (ORFs) as potential targets for medulloblastoma treatment. The study involves ribosome profiling and RNAseq of medulloblastoma tissues and cell lines to observe the translation of non-canonical ORFs. Multiple CRISPR-Cas9 screens will be used to identify functional non-canonical ORFs implicated in medulloblastoma cell survival.

  Dataset EGAD00001011192

• BLUEPRINT release August 2016, RNA-Seq for memory B cell, on genome GRCh38

  RNA-Seq data for 1 memory B cell sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002347