3883 results for "RNA AND sequencing OR transcriptome"

in 30.19 milliseconds.

• BLUEPRINT release January 2015, RNA-Seq for memory B cell

  RNA-Seq data for 1 memory B cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001171

• BLUEPRINT release January 2015, RNA-Seq for regulatory T cell

  RNA-Seq data for 1 regulatory T cell sample(s). 1 run(s), 1 experiment(s), 1 alignment(s). Part of BLUEPRINT release January 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20140811/homo_sapiens/README_rnaseq_analysis_crg_20140811

  Dataset EGAD00001001174

• BLUEPRINT release August 2015, RNA-Seq for T-cell acute leukemia, on genome GRCh38

  RNA-Seq data for 1 T-cell acute leukemia sample(s). 1 run(s), 1 experiment(s), 1 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001469

• BLUEPRINT release August 2015, RNA-Seq for neutrophilic myelocyte, on genome GRCh38

  RNA-Seq data for 3 neutrophilic myelocyte sample(s). 3 run(s), 3 experiment(s), 3 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001477

• BLUEPRINT release August 2015, RNA-Seq for inflammatory macrophage, on genome GRCh38

  RNA-Seq data for 3 inflammatory macrophage sample(s). 3 run(s), 3 experiment(s), 3 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001480

• BLUEPRINT release August 2015, RNA-Seq for band form neutrophil, on genome GRCh38

  RNA-Seq data for 3 band form neutrophil sample(s). 3 run(s), 3 experiment(s), 3 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001504

• BLUEPRINT release August 2015, RNA-Seq for mature eosinophil, on genome GRCh38

  RNA-Seq data for 1 mature eosinophil sample(s). 1 run(s), 1 experiment(s), 1 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001525

• BLUEPRINT release August 2015, RNA-Seq for Acute promyelocytic leukemia, on genome GRCh38

  RNA-Seq data for 7 Acute promyelocytic leukemia sample(s). 7 run(s), 7 experiment(s), 7 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001555

• BLUEPRINT release August 2015, RNA-Seq for neutrophilic metamyelocyte, on genome GRCh38

  RNA-Seq data for 2 neutrophilic metamyelocyte sample(s). 2 run(s), 2 experiment(s), 2 alignment(s) on human genome GRCh38. Part of BLUEPRINT release August 2015. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20150820/homo_sapiens/README_rnaseq_analysis_crg_20150820

  Dataset EGAD00001001566

• BLUEPRINT release August 2016, RNA-Seq for mature eosinophil, on genome GRCh38

  RNA-Seq data for 2 mature eosinophil sample(s). 3 run(s), 3 experiment(s), 2 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002326

• BLUEPRINT release August 2016, RNA-Seq for Acute Lymphocytic Leukemia - CTR, on genome GRCh38

  RNA-Seq data for 1 Acute Lymphocytic Leukemia - CTR sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002332

• BLUEPRINT release August 2016, RNA-Seq for Mantle Cell Lymphoma, on genome GRCh38

  RNA-Seq data for 5 Mantle Cell Lymphoma sample(s). 5 run(s), 5 experiment(s), 5 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002336

• BLUEPRINT release August 2016, RNA-Seq for T-cell Acute Lymphocytic Leukemia, on genome GRCh38

  RNA-Seq data for 1 T-cell Acute Lymphocytic Leukemia sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002287

• BLUEPRINT release August 2016, RNA-Seq for neutrophilic myelocyte, on genome GRCh38

  RNA-Seq data for 3 neutrophilic myelocyte sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002288

• BLUEPRINT release August 2016, RNA-Seq for monocyte, on genome GRCh38

  RNA-Seq data for 2 monocyte sample(s). 2 run(s), 2 experiment(s), 2 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002375

• BLUEPRINT release August 2016, RNA-Seq for Acute Myeloid Leukemia - SAHA, on genome GRCh38

  RNA-Seq data for 2 Acute Myeloid Leukemia - SAHA sample(s). 2 run(s), 2 experiment(s), 2 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002343

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - MC2884, on genome GRCh38

  RNA-Seq data for 1 Acute Promyelocytic Leukemia - MC2884 sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002352

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - CTR, on genome GRCh38

  RNA-Seq data for 3 Acute Promyelocytic Leukemia - CTR sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002353

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - ATRA, on genome GRCh38

  RNA-Seq data for 3 Acute Promyelocytic Leukemia - ATRA sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002356

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - MC2392, on genome GRCh38

  RNA-Seq data for 1 Acute Promyelocytic Leukemia - MC2392 sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002359

• BLUEPRINT release August 2016, RNA-Seq for neutrophilic metamyelocyte, on genome GRCh38

  RNA-Seq data for 3 neutrophilic metamyelocyte sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002366

• BLUEPRINT release August 2016, RNA-Seq for macrophage, on genome GRCh38

  RNA-Seq data for 6 macrophage sample(s). 7 run(s), 6 experiment(s), 6 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002507

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - MC2884 (4h), on genome GRCh38

  RNA-Seq data for 1 Acute Promyelocytic Leukemia - MC2884 (4h) sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002513

• BLUEPRINT release August 2016, RNA-Seq for Chronic Lymphocytic Leukemia, on genome GRCh38

  RNA-Seq data for 7 Chronic Lymphocytic Leukemia sample(s). 7 run(s), 7 experiment(s), 7 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002518

• BLUEPRINT release August 2016, RNA-Seq for Multiple Myeloma, on genome GRCh38

  RNA-Seq data for 14 Multiple Myeloma sample(s). 14 run(s), 14 experiment(s), 14 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002401

• BLUEPRINT release August 2016, RNA-Seq for T-cell Prolymphocytic Leukemia, on genome GRCh38

  RNA-Seq data for 3 T-cell Prolymphocytic Leukemia sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002426

• BLUEPRINT release August 2016, RNA-Seq for Acute Promyelocytic Leukemia - MC2884 (24h), on genome GRCh38

  RNA-Seq data for 1 Acute Promyelocytic Leukemia - MC2884 (24h) sample(s). 1 run(s), 1 experiment(s), 1 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002461

• BLUEPRINT release August 2016, RNA-Seq for Acute Myeloid Leukemia, on genome GRCh38

  RNA-Seq data for 27 Acute Myeloid Leukemia sample(s). 27 run(s), 27 experiment(s), 27 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002465

• BLUEPRINT release August 2016, RNA-Seq for osteoclast, on genome GRCh38

  RNA-Seq data for 2 osteoclast sample(s). 2 run(s), 2 experiment(s), 2 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002479

• BLUEPRINT release August 2016, RNA-Seq for band form neutrophil, on genome GRCh38

  RNA-Seq data for 3 band form neutrophil sample(s). 3 run(s), 3 experiment(s), 3 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002446

• BLUEPRINT release August 2016, RNA-Seq for Acute Myeloid Leukemia - CTR, on genome GRCh38

  RNA-Seq data for 7 Acute Myeloid Leukemia - CTR sample(s). 7 run(s), 7 experiment(s), 7 analysis(s) on human genome GRCh38. Part of BLUEPRINT release August 2016. Analysis documentation available at http://ftp.ebi.ac.uk/pub/databases/blueprint/releases/20160816/homo_sapiens/README_rnaseq_analysis_crg_20160816

  Dataset EGAD00001002443

• Raw RNA-seq data for clinical efficacy and biomarker analysis of neoadjuvant atezolizumab in operable urothelial carcinoma in the ABACUS trial

  ABACUS is a single arm phase 2 study that investigated 2 cycles of atezolizumab (1200mg Q3) prior to cystectomy in 95 patients with muscle invasive transitional cell cancer (T2-4N0M0). Pathological complete response (pCR) occurring in ≥20% of patients was the primary endpoint. Biomarker analysis on sequential tissue was a co-primary endpoint. This dataset includes the raw RNA-seq data.

  Dataset EGAD00001006205

• RNA-seq of endometrial organoids from MRKH patients and controls grown under expansion medium or hormonal treatment

  Raw, unfiltered fastq files obtained through RNA-seq of endometrial organoids from MRKH patients and controls. The dataset divides into three parts, depending on the growth conditions of the organoids, ie expansion medium or treated with hormones. Each sample consists of two paired-end fastq files.

  Dataset EGAD00001008453

• Bulk and Single-Nuclei RNA-seq with ATAC-seq of Breast Tumors Pre- and Post-Palbo ciclib/Endocrine Therapy

  This dataset comprises bulk and single-nuclei multiomic profiles from patients with ER+/HER2- early breast cancer enrolled in the NeoRHEA phase 2 trial. The bulk RNA-seq component includes 78 pre-treatment and 49 post-treatment tumor samples from 97 patients. The single-nuclei component includes matched pre- and post-treatment samples from 37 patients, totaling 63 samples analyzed by simultaneous snRNA-seq and snATAC-seq. Combined, the data contains bulk transcriptional profiles and single-nuclei gene expression/chromatin accessibility matrices for over 226,000 high-quality nuclei, encompassing tumor, immune, and stromal cells. Technologies used include Illumina NovaSeq 6000 for sequencing and the 10x Genomics Chromium platform (Multiome kit for single-nuclei, standard RNA library prep for bulk).

  Dataset EGAD50000002038

• Single-cell genotype-to-phenotype (scG2P) of normal esophageal epithelium

  Single-cell genotype-to-phenotype (scG2P) of normal esophageal epithelium, based on targeted DNA genotyping of mutation hot spots and targeted RNA capture.

  Dataset EGAD50000002066

• The Dynamic Immune Behavior of Primary and Metastatic Ovarian Carcinoma

  Single-cell RNA-seq data of prospectively collected normal ovarian tissue sample from 1 healthy individual and tumor tissue samples with or without chemotherapy from 19 HGSOC patients.

  Dataset EGAD50000000057

• Transcriptomic profiles of neuroblastoma PDXs and primary tumors

  This dataset contains bam files for RNA-seq experiments for 6 neuroblastoma PDXs (Patient Derived Xenograft) and 3 pairs of neuroblastoma tumors at diagnosis and at relapse.

  Dataset EGAD00001003393

• macIDR validation data

  RNA-seq of 24 M-CSF differentiated human peripheral monocyte-derived macrophages (MDMs) activated with short exposure (3hours) to LPS, or long exposure (24 hours) to LPS, LPS with IFNγ, IFNγ, IL-4, IL-10, and dexamethasone.

  Dataset EGAD00001004584

• Proteogenomic Landscape of Curable Prostate Cancer

  Aligned RNA-seq sequences in this dataset are from the Proteogenomic Landscape of Curable Prostate Cancer study

  Dataset EGAD00001004875

• Human normal brain single-cell

  We profiled two human fetal brainstem specimens at 17 and 19 post-conception weeks by single-cell RNA-seq using 10X Chromium Single Cell 3'. The BAM files are provided.

  Dataset EGAD00001005128

• WCDT deep RNA-seq

  This dataset includes fastq files for total RNAseq of 104 patient biopsies with metastatic castration resistant prostate cancer. The RNAseq libraries were rRNA depleted and sequenced at 150bp paired-end on Illumina Novaseq.

  Dataset EGAD00001008799

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line RNA-Seq

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009759

• bulkRNA seq from fibroblasts stimmulated with bead or CD8 T cell supernatant

  CD8 T cells (5 Samples treated, 5 samples control) form the same donors (5 donors, paired design) was subject to RNA-seq (Illumina stranded mRNA) processing. Single end fastq-files are supplied.

  Dataset EGAD00001010004

• Single-Cell DNA and RNA Sequencing over A 29-Year Period of A CLL Patient Demonstrating Evolution of Multiple Cell Clones

  Chronic lymphocytic leukemia (CLL) is a frequent B-cell malignancy characterized by recurrent somatic chromosome alterations and a low level of point mutations. Here we present single nucleotide polymorphism (SNP) microarray analyses of a single CLL patient over 29-years of observation and treatment, and transcriptome and whole genome sequencing at selected timepoints. We identified chromosome alterations of 13q14-, 6q- and 12q+ in early cell clones, elimination of clonal populations following therapy, and subsequent appearance of a clone containing trisomy 12 and a chromosome 10 copy neutral loss of heterogeneity (LOH) that marks a major population dominant at death. Serial single cell RNA sequencing revealed elevated mRNA expression of the FOS, JUN and KLF4 genes just before the appearance of acute disease requiring therapy. This gene expression pattern became undetectable following therapy, but reoccurred following relapse. Transcriptome evolution indicates that complex expression changes occur over time. In conclusion, CLL can evolve gradually during indolent phases, and undergo rapid changes following therapy.

  Study phs001181

• Whole-genome and transcriptome sequencing of primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma

  Primary cutaneous CD8+ aggressive epidermotropic cytotoxic T-cell lymphoma (pcAECyTCL) is a rare variant of cutaneous T-cell lymphoma with an aggressive clinical course and a very poor prognosis. We subjected tumor biopsies from patients with pcAECyTCL to whole-genome sequencing and RNA-sequencing to investigate genomic alterations and deregulated gene expression in the disease.

  Study EGAS00001004332

• Custom long non-coding RNA capture enhances detection sensitivity in different human sample types.

  Long non-coding RNAs (lncRNAs) are a heterogeneous group of transcripts that lack protein coding potential and display regulatory functions in various cellular processes. As a result of their cell- and cancer-specific expression patterns, lncRNAs have emerged as potential diagnostic and therapeutic targets. The accurate characterization of lncRNAs in bulk transcriptome data remains challenging due to their low abundance compared to protein coding genes. To tackle this issue, we describe a unique short-read custom lncRNA capture sequencing approach that relies on a comprehensive set of 565,878 capture probes for 49,372 human lncRNA genes. This custom lncRNA capture approach was evaluated on various sample types ranging from artificial high-quality RNA mixtures to more challenging formalin-fixed paraffin-embedded tissue and biofluid material. The custom enrichment approach allows the detection of a more diverse repertoire of lncRNAs, with better reproducibility and higher coverage compared to classic total RNA-sequencing.

  Study EGAS00001005418

• DCM-cases

  DCM-cases (149 human DCM samples) human heart biopsies from 149 patients with dilated cardiomyopathy (DCM) were subjected to RNA sequencing in order to assess transcriptome variation. We used Illumina HiSeq2000 technology. Each sample-dataset contains the output from tophat-1.4.1 (one *.bam file with the aligned reads and two *.fq files one with the not aligned forward read and one with the revers unaligned reads). We reveal extensive differences of gene expression and splicing between dilated cardiomyopathy patients and controls.

  Dataset EGAD00001003390

• DCM-controls

  DCM-controls (113 human non-DCM samples) human heart biopsies from 113 non-diseased controls were subjected to RNA sequencing in order to assess transcriptome variation. We used Illumina HiSeq2000 technology. Each sample-dataset contains the output from tophat-1.4.1 (one *.bam file with the aligned reads and two *.fq files one with the not aligned forward read and one with the revers unaligned reads). We reveal extensive differences of gene expression and splicing between dilated cardiomyopathy patients and controls.

  Dataset EGAD00001003391

• Hypothalamic transcriptome in Prader-Willi syndrome

  Transcriptional analysis of brain tissue from people with molecularly defined causes of obesity may highlight novel disease mechanisms and therapeutic targets. Prader-Willi syndrome (PWS) is a genetic obesity syndrome characterised by severe hyperphagia. We performed RNA sequencing of the hypothalamus from 4 individuals with PWS and 4 age-matched controls.

  Study EGAS00001002901

• Facioscapulohumeral dystrophy transcriptome signatures correlate with different stages of disease and are marked by different MRI biomarkers

  This project includes RNA-sequencing data from human FSHD and control skeletal muscle biopsies. This project includes data from 28 FSHD patients (total 37 samples, including vastus lateralis and tibialis anterior muscles) and 12 control individuals (total 24 samples, including vastus lateralis and tibialis anterior muscles).

  Study EGAS00001005782

• (RNA-seq) Shifted assembly and function of mSWI/SNF family subcomplexes underlie targetable dependencies in endometriod carcinomas

  Raw and processed RNA-seq data from a patient-derived xenograft (yielding 18 samples) and the VOA1066 undifferentiated endometrial carcinoma cell-line (yielding 15 samples). PDX samples were treater with either compound-14, dBRD9, or were untreated. VOA1066 samples were treated with either compound-12, dBRD9, or were untreated. Samples were sequenced on an Illumina NextSeq 500 using 37-bp single-end sequencing. Raw fastq files and gene count tables are included for each sample.

  Dataset EGAD50000001471

• RNA sequencing of primary B-cells infected with Epstein-Barr virus (EBV), treated with heat-inactivated EBV, CpG or BCR-crosslinking in presence or absence of Linrodostat

  B cells were isolated from buffy coat preparations of healthy donors using CD19 magnetic beads. B cells were then infected with EBV using spinoculation or activated with heat-inactivated EBV, respectively. Additionally cells were treated with 5ng/ml CpG or a BCR-crosslinking mixture in presence or absence of 10 µM Linrodostat (IDO1 inhibitor). RNA samples were isolated at 2 days post-infection / post-activation and one day 0 control with non-infected B cells was included.

  Dataset EGAD50000000306

• RNA sequencing of CD8 T cells from melanoma patients prior to and during checkpoint immunotherapy and untreated healthy controls

  We are interested in inter-individual variation in transcriptional response to immune checkpoint blockade. We have analysed poly A purified RNA expression from CD8 T cells (297 transcriptomes in total) isolated from metastatic melanoma patients (n=106) prior to and during treatment with either single agent (Pembrolizumab) or combination (Ipilimumab/ Nivolumab) immune checkpoint blockade. We compare expression at different stages of treatment and additionally contrast this with that from healthy controls (n=68).

  Dataset EGAD00001005973

• RNA-seq Revision

  The dataset comprises bulk RNA‑seq libraries generated on the Illumina NextSeq 500 platform, including primary human hepatocytes (four donors), colon tissue (four masked replicates), and a comprehensive set of iPSC‑derived samples from the JHU106, ChiPSC18, ChiPSC22, and H9 lines. The collection covers multiple differentiation stages from iPSC to DE to HLC and cultivation protocols (CEL, HAY, SPH) with at least three replicates per condition. All sequencing data are provided as raw FASTQ files, with colon samples delivered as masked FASTQ in accordance with patient consent requirements.

  Dataset EGAD00001008951

• Postmortem Single Nuclei and Bulk RNA-seq data of the Motor Cortex and Spinal Cord for Healthy, C9ALS and sALS Patients

  This dataset contains both snRNA-seq and bulk RNA-seq data from 19 different patients, comprising of 9 healthy controls (4 Spinal Cord, 5 Motor Cortex) as well as 5 C9ALS patients and 5 sporadic ALS patients, each with paired data from the spinal cord and motor cortex. For the snRNA-seq data, fastq files containing the raw reads are provided, many of these samples were pooled for sequencing and subsequently require demultiplexing using SNPs using a tool such as freemuxlet. The paired bulk RNA-seq data (raw fastq files) can be used to acquire the ground truth per patient - a list of pooled samples can be found in map.txt. snRNA-seq data was produced using the 10X Genomics 3' v3 kit and bulk RNA-seq was produced using the Illumina TruSeq v2 kit.

  Dataset EGAD00001009686

• Sequencing Data for Sample 51_Hf01_BlCM_Ct

  Sequencing Data for DEEP Paper: "reChIP-seq reveals widespread bivalency of H3K4me3 and H3K27me3 in CD4+ memory T-Cells" Sample: 51_Hf01_BlCM_Ct (human, female, Blood, CD4+ central memory cell, normal control) Sequencing types are: total RNA, Whole Genome Bisulfite, ChipSeq (H3K27ac, H3K9me3, H3k36me3, H3K4me1, H3k27me3, H3K4me3, Input), reChipSeq (H3K27me3, H3K4me3)

  Dataset EGAD00001002255

• Sequencing files for "A Unifying Paradigm for Transcriptional Heterogeneity and Squamous Features in Pancreatic Ductal Adenocarcinoma."

  Files from DNA and RNA sequencing from primary tumors and metastases from pancreatic cancer patients along with matched normal tissues.

  Dataset EGAD00001005519

• Sequencing data for Hepatoblastoma samples

  This dataset contains DNA sequencing data for twelve hepatoblastoma tumor samples, four of which have matched normals. Nine of the samples also have RNA sequencing data from the tumor sample. The dataset comprises six samples from patient tissues and six from cell lines; see metadata for details.

  Dataset EGAD00001006621

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, single-cell RNA-sequencing analysis of peripheral blood CD4+ T cells from healthy control, CD4+ T cells in muscles and bronchoalveolar lavage fluid (BALF) from patients with idiopathic inflammatory myopathy were conducted.

  Study JGAS000648

• PD1-targeted delivery of an IL-2 variant induces a multifaceted anti-tumoral T cell response in human lung cancer

  To explore PD1-IL2v-specific effects on CD8 and CD4 T cells at a transcriptomic level, we performed single-cell RNA sequencing of patient-derived tumor fragments (PDTFs) which were treated with either Isotype (DP47), Isotype-IL2v (DP47-IL2v), anti-PD1 (PembroPGLALA) or PD1-IL2v (PembroPGLALA-IL2v) for 48 hours.

  Study EGAS50000000396

• Transcriptomic analysis of hiPSC-derived vascular cells from CADASIL and isogenic control patient lines

  Bulk-RNA sequencing from hiPSC-derived cells (hiPSC; Endothelial Cells; Neural Crests Cells; Vascular Smooth Muscle Cells) from CADASIL patient lines (n=3) and respective isogenic-controls (n=3). CADASIL is a hereditary brain small vessel disease caused by pathogenic variants in the NOTCH3 gene, which lead to deposits of NOTCH3 protein in the walls of small arteries. This causes pathological vessel wall changes including degeneration of vascular smooth muscle cells. To investigate the impact of pathogenic NOTCH3 variants in hiPSC and differentiated cells we performed a bulk-RNA sequencing.

  Dataset EGAD50000002181

• RNA-seq from B-ALL patients treated on the ALLG ALL09 study

  Dataset contains RNA-sequencing data (fastq files) from 46 patients treated on the Australasian Leukaemia and Lymphoma Group (ALLG) ALL09 study (ACTRN12618001734257). All patients were diagnosed with CD19 positive B-cell acute lymphoblastic leukaemia and were negative for Philadelphia chromosome positive disease. Patient samples (bone marrow or peripheral blood) were taken at diagnosis. mRNA was extracted from lymphoblasts and underwent paired-end sequencing using either the illumina NextSeq (75 bp PE) or MGI DNABSEQ-G400 (100bp PE) platforms. Transcriptomic data was used for identification of genomic drivers of acute lymphoblastic leukaemia (ALL).

  Dataset EGAD50000001603

• 10X single cell RNA- and feature barcode sequencing of 38 AML samples

  This dataset contains fastq-files from single cell 3' RNA- and feature barcode sequencing of AML samples using 10X technology (Chromium Single Cell 3ʹ Reagent Kit v3). In total, the dataset contains data from 38 AML samples from either bone marrow or peripheral blood, representing the following genetic subtypes: NPM1-mutated, myelodysplasia related, TP53-mutated, CBFB::MYH11, RUNX1::RUNX1T1, AML without class-defining mutations, and AML meeting criteria of two subtypes. The data consists of sequenced gene expression libraries from 38 samples and feature barcoding libraries covering a panel of 10-14 surface proteins for 34 samples.

  Dataset EGAD50000001577

• B-ALL bone marrow and CNS xenograft RNA sequencing

  This dataset includes TruSeq paired-end, total RNA sequencing data from primary B-precursor acute lymphoblastic leukaemia (B-ALL) xenografts. It comprises 43 pairs of matched bone marrow (BM) and central nervous system (CNS) human leukaemia cells from individual immunodeficient mice. Xenografts were generated from 6 patients with B-ALL and include samples taken at diagnosis and relapse from 3 of 6 patients.

  Dataset EGAD00001008183

• Multi-region RNA-Seq data of 10 neuroblastoma cases

  To investigate intratumour heterogeneity and to better understand tumour evolution in neuroblastoma, we have performed a multi-region RNA sequencing on a total of 51 spatially separated tumor samples from 9 primary neuroblastomas (2 low-risk, 1 intermediate-risk and 6 high-risk) and 1 relapsed neuroblastoma. We also assessed the impact of chemotherapy on the clonal expansion by sequencing tumour regions from one medium risk and one high-risk tumour for which we had matched samples obtained at diagnosis and after chemotherapy.

  Dataset EGAD00001008133

• WES and RNA-seq of triple-negative breast cancers from the MyBrCa cohort

  The dataset contains a genomics characterization of 35 triple-negative Asian breast tumours from the Malaysian Breast Cancer cohort. This includes whole-exome sequencing of tumour tissue at 80X, whole-exome sequencing of matched normal (blood) tissue at 40X, and RNA-seq of tumour tissue at 40X coverage (>15 million reads). Whole-exome libraries were prepared using the Nextera Rapid Capture Exome Kit; exome capture was performed in pools of 3 and subjected to paired end 75 sequencing on a NovaSeq 6000 platform. RNA libraries were prepared using the TruSeq Stranded Total RNA HT kit with Ribo-Zero Gold as per manufacturer’s instructions and also subjected to paired end 75 sequencing on a NovaSeq 6000 platform. Uploaded bam files have been mapped to the hs37d5 human genome and processed using the standard GATK pipelines. Paired clinical, demographic, genotyping, and overall survival data for these patients are available from the associated publications or by request.

  Dataset EGAD00001009311

• Molecular Characterization of Prostate Cancer Specimens by Bulk and Single Cell Analysis

  Version 1: We performed single-cell RNA-sequencing (scRNA-seq) of fresh biopsies from metastatic castration resistant prostate cancer. Additionally, where available, we performed matched bulk whole exome sequencing (WXS; tumor and normal paired) and whole transcriptome sequencing for the same individuals. We also performed bulk whole exome (WXS) and RNA-sequencing (RNA-Seq) from FFPE pre-treatment biopsies from patients with clinically localized high-risk prostate cancer.Version 2: We added data from a randomized phase 2 trial of radium-223 with or without pembrolizumab in patients with Metastatic Castration-Resistant Prostate Cancer (mCRPC) to bone. After enrollment, study participants underwent bone biopsy and were randomized 2:1 to receive radium-223 at 55 kBq/kg every 4 weeks + pembrolizumab at 200 mg every 3 weeks (Arm A, R223+P) or radium-223 at 55 kBq/kg every 4 weeks alone (Arm B, R223). Stratification factors were alkaline phosphatase ≥220 vs. Data generated includes bulk whole exome sequencing (WXS), ultra-low pass whole genome sequencing (WGS) at 0.1X coverage, and targeted-capture sequencing. The ultra-low pass sequencing was used as part of the selection criteria for the target capture sequencing. Note: Two subjects in this study are linked to phs001577 and phs000915 respectively.

  Study phs001988

• Juvenile Sjogren's Syndrome (JSS) Transcriptome Study

  Sjögren's disease (SjD) is a systemic autoimmune disorder with major clinical manifestations of dryness in the eyes and mouth, fatigue, and joint pain. Our interdisciplinary experts in SjD at the University of Florida newly discovered and established a cohort of SjD in children. Many of these patients with childhood SjD (cSjD) demonstrated a prominent feature of recurrent parotitis (RP). To understand the immunopathogenesis of childhood SjD (cSjD) for the first time in the field, we profiled the transcriptome of five groups of four PBMC samples by unbiased, high-throughput single-cell RNA sequencing (scRNA-seq): cSjD (n=4), non-cSjD (n=4), biopsy-positive non-cSjD (BP, n=4), biopsy-positive non-cSjD with RP (BPRP, n=4), and healthy controls (HC, n=4). In this study, RNA sequencing data, as well as all barcodes.tsv.gz, features.tsv.gz, and matrix.mtx.gz that may be used to create a Seurat object in R, will be availableTo protect the confidentiality of subjects, certain data were not assessed or collected in the subject phenotype dataset, such as race, age, height, weight, and education.

  Study phs003048

• G&T-seq: parallel sequencing of the genomes and transcriptomes of single cells

  The ability to simultaneously sequence the genome and transcriptome of the same single cell offersa powerful means to dissect functional genetic heterogeneity at the cellular level. Here we describeG&T-seq, a method for separating and sequencing genomic DNA and full-length mRNA from singlecells. By applying G&T-seq to over 220 single cells we reveal cellular properties that cannot beinferred from DNA or RNA sequencing alone, including associations between DNA copy numbervariation and gene expression dosage. We further demonstrate the detection of coding interchromosomalfusions and single nucleotide variants in both the genomes and transcriptomes ofindividual cells. G&T-seq enables the study of genotype-phenotype associations in single cells, andthe investigation of DNA cell lineage trees of healthy and diseased tissues with transcriptome inferredcell types and states.

  Study EGAS00001001204

• SCIMAP ACTUAL D0, D3, D6, D8, D14, D49

  The first experiment with multimodal sequencing in the SCI-MAP project. Here, human induced pluripotent stem cells underwent differentiation to chondrocytes for 21 days following an established protocol. Nuclei were isolated and sequenced in two modalities simultaneously; RNA and ATAC.

  Dataset EGAD50000002520

• Epigenomic dataset of Human Hepatocellular Carcinoma for EpiHK

  This dataset is generated for EpiHK. It contains Histone PTM ChIP-seq, WGBS, RNA-seq of 7 Human Hepatocellular Carcinoma and 7 tumor adjacent normal tissue sample.

  Dataset EGAD50000000058

• Single cell mRNA sequencing of primary GBM - SF 10282

  We collected fresh tissue from an untreated GBM (SF10282) directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine, resulting in sequencing libraries from 96 individual cells.

  Dataset EGAD00001002270

• Single cell mRNA sequencing of primary GBM - SF 10360

  We collected fresh tissue from an untreated GBM (SF10360) directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine, resulting in sequencing libraries from 96 individual cells.

  Dataset EGAD00001002272

• Single cell mRNA sequencing of primary GBM - SF 10345

  We collected fresh tissue from an untreated GBM (SF10345) directly from the operating room and subjected the biopsy to single-cell RNA-seq with the fluidigm C1 machine, resulting in sequencing libraries from 96 individual cells.

  Dataset EGAD00001002271

• HPS1 patient monocyte-derived macrophage and control macrophage RNAseq with and without infection

  4 HPS1 patient monocyte-derived macrophages and 4 controls were RNA sequenced at baseline and after Salmonella Typhimurium infection. We used paired end sequencing on an Illumina HiSeq 4000. Each sample was run on 3 lanes for sequencing depth, which we combined for our analysis.

  Dataset EGAD00001006978

• RNA-seq as a tool for evaluating human embryo competence

  The majority of embryos that are created through IVF do not implant. One possibility for this inefficiency is an incomplete understanding of the molecular factors affecting embryo competence. Currently, the process of selecting an embryo for uterine transfer utilizes an ad-hoc combination of morphological criteria, the kinetics of development, and genetic testing for aneuploidy. However, no single criterion can ensure selection of a viable embryo. In contrast, RNA-sequencing of embryos could yield highly dimensional data, which may provide additional insight and illuminate the discrepancies among current selection criteria. Indeed, recent advances enabling the production of RNA-sequencing (RNA-seq) libraries from single cells have facilitated the application of this technique to the study of some transcriptional events in early human development. However, these studies have not assessed the quality of their constituent embryos relative to commonly used embryological criteria. Here, we perform proof-of-principle advancement to clinical selection procedures by generating high quality RNA-seq libraries from a trophectoderm biopsy as well as the remaining whole embryo. We combine state-of-the-art embryological methods with low-input RNA-seq to develop the first transcriptome-wide approach for use in future predictive embryology studies. Specifically, we demonstrate the capacity of RNA-seq as a promising tool in preimplantation screening by showing that biopsies of an embryo can capture valuable information content available in the whole embryo from which they are derived. Furthermore, we show that this technique can be used to generate a RNA-based digital karyotype, and to develop a foundational dataset for identifying candidate competence-associated genes. Together, these data establish the foundation for a future RNA-based diagnostic in IVF.

  Study EGAS00001003667

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354

• Single-cell RNA-sequencing data of human iPSC-derived (hiPSC-derived) astrocytes, both alone and in co-culture with neurons, to define the molecular response of astrocytes to misfolded alpha-synuclein.

  Samples were derived from an human iPSC-derived astrocyte line, both alone and in co-culture with neurons +/- alpha-synuclein oligomer treatment.

  Dataset EGAD50000001110

• GBM Study Complete Raw Data

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside total RNA from the tumors.

  Dataset EGAD50000000650

• Single-cell/single-nucleus RNA-seq of diffuse hemispheric gliomas, H3G34-mutant.

  9 DHG-H3G34 patient samples were sequenced by paired-end scRNA-sequencing using the Smart-Seq2 protocol on a NextSeq 500 sequencer (Illumina). Illumina bcl2fastq 1.5 was used for demultiplexing. This dataset contains the resulting 9,408 fastq files of 4,704 single cells/nuclei sequenced.

  Dataset EGAD50000000760

• single cell data from HPV-positive head and neck cancer patients receiving induction CTLA-4 and PD-1 immune checkpoint blockade

  Baseline and on-treatment tumor samples from human papillomavirus-positive oropharynx cancer patients receiving anti-CTLA-4 and anti-PD-1 immune checkpoint blockade were analyzed by single-cell RNA and TCR sequencing.

  Dataset EGAD50000000487

• RNAseq of preneoplasia lung adenocarcinoma

  RNA sequencing of 168 pulmonary samples including lung preneoplasia atypical adenomatous hyperplasia (AAH, N=38), adenocarcinoma in situ (AIS, N=22), minimally invasive adenocarcinoma (MIA, N=19) and invasive lung adenocarcinoma (ADC, N=38) and adjacent lung tissues (Normal, N=62).

  Dataset EGAD50000000395

• Sequencing data for oesophageal and related samples - BOs release 2 (RNA)

  Dataset EGAD00001003840

• A novel subset of human CD33+ haematopoietic stem cells characterized at single-cell resolution

  This dataset comprises single-cell RNA sequencing of the human Lin-CD34+38-45RA-90+49f+ phenotype isolated from 2 normal cord donors. Library preparation was performed following a modified CEL-Seq2 protocol.

  Dataset EGAD00001003955

• Total RNAseq in the sporadic ALS and healthy control motor cortex

  The motor cortex is the earliest affected brain region in ALS. This dataset contains total RNA sequencing (stranded, 2x101bp) data derived from the motor cortex of 11 sporadic ALS patients and 8 healthy controls.

  Dataset EGAD00001006022

• Transcriptomic profiling of RIRCD patient skeletal muscle, comparing recovered to affected disease phase.

  Illumina MiSeq total RNA sequencing profiles of skeletal muscle biopsies from patient F3/1M during affected disease phase (4 replicates: F3-1M_Affected_1, F3-1M_Affected_2, F3-1M_Affected_3, F3-1M_Affected_4) compared to recovered phase (F3-1M_Recovered_1, F3-1M_Recovered_2, F3-1M_Recovered_3, F3-1M_Recovered_4).

  Dataset EGAD00001006382

• RNA sequencing of 12 NSCLC samples from 4 patients at MDACC

  Multi-region RNAseq from 4 NSCLC patients, totaling 12 tumor samples and 7 matched control samples.

  Dataset EGAD00001008482

• Islet RFX6 Study Manuscript Data

  This submission includes raw FASTQ files (for bulk RNA-seq and 10X joint snATAC+snRNA multiome profiling experiments), sample phenotype files, and genotypes for the data included in the manuscript.

  Dataset EGAD00001008777

• Single cell RNA sequencing of colorectal cancer patients (KUL5)

  All libraries were sequenced on Illumina NextSeq or NovaSeq6000 until sufficient saturation was reached.

  Dataset EGAD00001008585

• TN

  In order to comprehensively investigate the genetic relationship between PTC tumors and benign nodules, we totally collected 127 fresh-frozen biopsies samples from 28 patients with concurrent thyroid benign nodule and PTC (n=20) or simple benign nodule (n=8). We carried out whole-exome sequencing on all the 127 biopsies samples and RNA-sequencing in total of 40 samples.

  Dataset EGAD00001003351

• MPM patients

  - RNA-sequencing data: 5 normal pleurae and 40 malignant pleural mesotheliomas - Targeted DNA-sequencing of the 165 genes included in the “Solid and Haematological tumors” panel (BRIGHTCore, Brussels, Belgium): 6 MPM samples. 2 FASTQ files for each sample (paired).

  Dataset EGAD00001008740

• Tumor gene expression profiles for the study "TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells"

  RNA was extracted from formalin-fixed and paraffin embedded tumors of a large cohort of bladder cancer patients before treatment with anti-PD-L1. RNA was sequenced using a capture based approach (exome capture, RNA access).

  Dataset EGAD00001003977

• Single cell transcriptome sequencing of the developing human embryonic meninges

  There are no effective medical therapies for meningiomas, partly due to our limited understanding of their cellular origin and composition For this purpose, we generated data to make a comprehensive reference single cell and spatial transcriptomic atlas of human fetal meninges. Samples of meninges from human embryos of post-conceptional week (PCW) 5.0-13.0 were dissected and subject to 10Xgenomics chromium single cell RNA sequencing with the purpose of identifying cell types and gene expression programs for normal meninges development, Furthermore, this dataset should help discover cells of origin for meningiomas.

  Study EGAS50000000980

• FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls.

  FASTQ files of the polyA+ (oligo-dT) RNA-Seq dataset from the POPS SGA (Small for Gestational Age) samples and their matched controls. The POP study placental biopsies were collected within 30 minutes of birth and flash frozen in RNAlater (ThermoFisher). For each biopsy, total placental RNA was extracted from approximately 5 mg of tissue using the “mirVana miRNA Isolation Kit” (Ambion) followed by DNase treatment (“DNA-free DNA Removal Kit”, Ambion). RNA quality was assessed with the Agilent Bioanalyzer and all the samples with RIN values ≥ 7.0 were used in the downstream experiments. RNA-libraries were prepared from 1g of total placental RNA with the TruSeq Stranded mRNA Library Prep Kit (Illumina) which captures polyA-tailed transcripts by oligo-dT beads, then pooled and sequenced (single-end, 50bp) using a Single End V4 cluster kit and Illumina HiSeq2500

  Dataset EGAD00001006304

• Alpha synucleinopathy spectrum - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=44 samples. Tissue samples correspond to patients with different alpha synucleinopathies. Specifically, idiopathic Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=11). RNA seq was carried out using ribosomal depletion. The totality of these samples were also sequenced using single nucleus RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000430

• Alpha synucleinopathy spectrum - single nucleus RNA seq of prefrontal cortex

  Single nucleus RNA seq dataset from prefrontal cortex of a total of N=46 individuals with alpha synucleinopathies and healthy controls. Tissue samples correspond to patients with Parkinson's disease (PD, N=20) monogenic PD caused by LRRK2 mutations (LRRK2-PD, N=7), multiple system atrophy (MSA, N=6) and neurologically healthy controls (N=13). RNA seq was carried out employing 10X Genomics Chromium. These samples were also sequenced using conventional bulk tissue RNA seq, and available within the same study as a separate dataset.

  Dataset EGAD50000000431

• Complex-I stratification of Parkinson's disease - single nucleus RNAseq

  Single nucleus RNA seq dataset for CI stratification of Parkinson's disease Single nucleus RNA seq dataset of prefrontal cortex tissue from a total of N=18 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=12) and neurologically healthy controls (N=6). Single nucleus RNA seq was carried out using 10X Genomics Chromium. This dataset corresponds to a subset of the samples sequenced using conventional bulk tissue RNA seq and available within this Study as a separate Dataset.

  Dataset EGAD50000000432

• Complex-I stratification of Parkinson's disease in the prefrontal cortex - bulk RNA seq

  Dataset corresponding to the bulk RNA seq dataset from prefrontal cortex for a total of N=98 samples. Tissue samples correspond to patients with idiopathic Parkison's disease (PD) with varying levels of Complex-I activity (N=79) and neurologically healthy controls (N=19). RNA seq was carried out using ribosomal depletion. A subset of these samples was additionally sequenced using single nucleus RNA seq and is available in the same Study as an additional Dataset.

  Dataset EGAD50000000433

• Single-Cell Analysis of Human Adipogenesis

  The data in this study consists of RNA sequencing reads and read counts from single-cell and single-nuclei RNA sequencing experiments performed on two cell lines to investigate the transcriptional landscape of human adipogenesis in both the brown and white adipose tissue lineage. The two cell lines are human preadipocytes collected and isolated from a defined anatomical location in the neck of a single individual. This depot is known to harbor white adipose tissue (WAT) and brown adipose tissue (BAT). These white and brown preadipocytes were immortalized for the purposes of studying human adipogenesis in vitro. In this study we induced differentiation of these two preadipocyte lines and performed RNA sequencing on over 135,000 single cells spanning a 20-day time course from unperturbed preadipocytes to mature adipocytes from both brown and white lineages. Additionally, we performed both single-cell and single-nuclei RNA sequencing to comprehensively compare the advantages and disadvantages of either technique.

  Study phs002461

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178