11930 results for "division 2 coins fc 26 Visit Buyfc26coins.com Kupiłem(a) duży pakiet monet FC 26 i dostałem(a) dodatkowy rabat. Świetnie!.fXzt"

in 27.34 milliseconds.

• Prognostic whole-genome and transcriptome signatures in colorectal cancers

  Colorectal cancer (CRC) is caused by a sequence of somatic genomic alterations affecting driver genes in core cancer pathways1. To understand the functional and prognostic impact of cancer-causing somatic mutations, we analysed the whole genomes and transcriptomes of 1,063 primary CRCs in a population-based cohort with long-term follow-up. This study constitutes the largest integrated genome and transcriptome analysis of CRC to date, and links mutations, gene expressions and patient outcomes.

  Study EGAS50000000124

• Targeting Heterochromatin Eliminates Malignant Stem Cells in Chronic Myelomonocytic Leukemia Through Reactivation of Retroelements and Innate Immune pathways

  Hematopoietic stem cell (HSC) aging involves heterochromatin reorganization. These repressive marks together with DNA methylation are essential for suppressing transposable elements (TEs). In this study we analyze heterochromatin and transcriptomic changes occurring at genes and TEs in HSCs from chronic myelomonocytic leukemia, a severe myeloid malignancy affecting the elderly, compared to age-matched cells, and in the presence or absence of a combination of epidrugs.

  Study EGAS50000000367

• Targeting Heterochromatin Eliminates Malignant Stem Cells in Chronic Myelomonocytic Leukemia Through Reactivation of Retroelements and Innate Immune pathways

  Hematopoietic stem cell (HSC) aging involves heterochromatin reorganization. These repressive marks together with DNA methylation are essential for suppressing transposable elements (TEs). In this study we analyze heterochromatin and transcriptomic changes occurring at genes and TEs in HSCs from chronic myelomonocytic leukemia, a severe myeloid malignancy affecting the elderly, compared to age-matched cells, and in the presence or absence of a combination of epidrugs.

  Study EGAS50000000688

• Whole Exome Sequencing of controls performed at the Broad Institute on a cohort from Bristol, UK

  These data were generated as part of a collaboration between University of Bristol, UK and the Stanley Center at the Broad Institute. This project sequenced and analysed the whole exomes of 2969 samples from the Avon Longitudinal Study of Parents and Children (ALSPAC). ALSPAC is a population-based pregnancy cohort with participants acting as ‘controls’ for this project. Genomic DNA from each sample was sequenced to a mean depth of 20x. The exome used Twist capture and samples were sequenced on Illumina NovaSeq 6000 machines producing CRAM files. ALSPAC recruited pregnant women in the Avon County of south-west England between 1991 and 1992. Of the 15,447 pregnancies, 14,901 children were alive at 1 year of age.  DNA was extracted from child blood samples taken between ages 7 and 24.

  Dataset EGAD50000000716

• Patient-derived models of primary breast cancer for preclinical development of novel neoadjuvant therapies

  Generation of the first large-scale cohort of mouse intraductal patient-derived xenograft (MIND-PDX) models of primary invasive breast cancer (IBC) and a collection of matched PDX-derived organoids (PDXO) representing all molecular subtypes of IBC, including estrogen receptor (ER-) positive breast cancer. Furthermore, we show that our IBC-MIND cohort can serve as a platform to test experimental neoadjuvant treatment options in different molecular subtypes of breast cancer.

  Study EGAS50000000398

• Transcriptome-Wide Association Study (TWAS) to Identify Susceptibility Genes for Colorectal Cancer

  This study included genotype data from 420 study participants of East Asian descent, along with RNA-seq (n=300) and small RNA seq data (n=400) generated from their colorectal tissue samples. We used the transcriptome data and genotype data from these individuals to build a prediction model for each coding gene and long non-coding RNA, and perform a Transcriptome-Wide Association Study (TWAS) of colorectal cancer in East Asian populations.

  Study phs002813

• Precision Interception of Gastric Cancer Precursors Through Molecular and Cellular Risk Stratification

  The GAstric Precancerous conditions Study (GAPS, NCT04191551) is a cross-sectional study of patients undergoing endoscopy who are at increased risk of gastric cancer. Enrolled patients are administered a standardized questionnaire, undergo clinical biopsy collection using the Sydney system, and consent for the collection of saliva, blood, and additional gastric tissue. All patients are scored for intestinal metaplasia using the operative link on gastric intestinal metaplasia (OLGIM) scoring system.

  Study phs003648

• Understanding Determinants of Racial Disparities in Lung Cancer Incidence

  This is a nested case-control study designed to evaluate the association between common genetic variants and the risk of lung cancer. The study included 1258 cases and 1252 controls selected from the Southern Community Cohort Study (SCCS), a large, prospective observational cohort. Cases were identified from cancer registries across the catchment area of the SCCS. Cases and controls were frequency matched on age, sex, race, and enrollment site (community health center vs general population).

  Study phs003789

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  99 FFPE derived tumor tissue DNA, 9 circulating tumor DNA samples and 38 paired germline DNA were used. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) at the National Genomic Analysis Center (CNAG, Barcelona, Spain) was performed.

  Study EGAS50000000371

• Circulating cell-free and extracellular vesicles-derived microRNA as prognostic biomarkers in patients with early-stage NSCLC: results from RESTING study

  Lung cancer, especially non-small cell lung cancer (NSCLC), has high mortality rates. Early-stage NSCLC shows a 50% relapse rate post-surgery, with most recurrences occurring within two years and a 5-year survival of only 30%. This study focuses on the prognostic value of circulating miRNAs in surgically treated ES-NSCLC patients, aiming to assess their predictive accuracy and compare them to standard prognostic factors.

  Study EGAS50000001032

• Intratumoral Heterogeneity and Clonal Evolution Induced by HPV Integration

  The human papillomavirus (HPV) genome is integrated into host DNA in most HPV-positive cancers, but the consequences for chromosomal integrity are unknown. We used continuous long-read sequencing of oropharyngeal cancers and cervical cancer cell lines to resolve structural variation induced by HPV. We discovered a previously undescribed form of structural variation, "heterocateny," characterized by diverse, interrelated, and repetitive patterns of concatemerized virus and host DNA segments within a cancer.

  Study phs003396

• Whole genome sequencing data of pediatric TCF3::PBX1 acute lymphoblastic leukemia

  TCF3::PBX1 leukemia is a rare subtype of B-cell acute lymphoblastic leukemia (B-ALL), occurring in approximately 3–5% of pediatric cases. It results from a chromosomal translocation t(1;19)(q23;p13), generating the TCF3::PBX1 fusion gene, which disrupts normal transcriptional regulation and contributes to leukemogenesis. Although historically associated with poor prognosis, contemporary risk stratification and intensified therapy have significantly improved outcomes, and both 5-years DFS and OS are nowadays ≥ 0.96.

  Study EGAS50000001257

• Multi-omics analysis reveals immune programs delineating disease severity in extrapulmonary tuberculosis

  This study investigates the immune response in extrapulmonary tuberculosis (EPTB) using a combination of bulk and single-cell RNA sequencing. Hierarchical clustering of patient transcriptomes identified three distinct levels of disease severity, uncovering immunological pathways involved in disease progression, including interferon and IL-1β-mediated signaling. The findings also led to the development of a diagnostic gene expression signature for both EPTB and pulmonary TB, offering potential improvements in TB diagnosis and treatment.

  Study EGAS50000000668

• Cell-free DNA methylome and fragmentome analysis for disease relapse monitoring in patients with Ewing Sarcoma

  We conducted whole-genome and methylome sequencing of cfDNA from 87 serial samples of 23 patients with EwS and 3 patients with CIC-rearranged sarcoma (CIC). With EwingSign, a new machine learning model, we identified EwS or CIC in a test set for 11 out of 16 patients at diagnosis and 15 out of 18 clinically confirmed relapse events. 0 out of 24 non-cancer controls were detected positive with EwingSign.

  Study EGAS50000001415

• RNAseq of medulloblastoma data (MB_COMICS cohort)

  Medulloblastoma (MB) is the most common malignant brain tumor in children. It is a neuroectodermal tumor located in the cerebellum. International consensus recognizes four distinct subgroups of MBs including Wingless (WNT), Sonic Hedgehog (SHH), Group 3 (G3), and Group 4 (G4) with distinct molecular characteristics, prognoses, and mortality rates in patients. Here, we have compiled and evaluated a large international MB cohort for which we generated transcriptomic data (RNAseq) for 208 primary MB patient samples.

  Study EGAS50000000410

• Whole-exome sequencing of Helicobacter pylori-uninfected normal gastric gland

  Recent studies showed that somatic mutations accumulate in normal tissues with age; however, mutation accumulation in the Helicobacter pylori-uninfected normal gastric mucosa has not been reported. A total of 18 biopsied gastric mucosa were obtained from nine subjects without Helicobacter pylori-infection or gastric cancer. Gastric epithelia were manually dissociated from the lamina propria. Subsequently, single glands were picked up under a stereomicroscope. Genomic DNA isolated from each gland was subjected to whole-exome sequencing.

  Study JGAS000313

• Development of blood-based biomarkers for precision medicine in castration-resistant prostate cancer

  Cell-free DNA (cfDNA) testing is emerging as a tool for cancer precision medicine. However, little is known about the clinical significance of low-frequency variants detected in circulating cell-free tumor DNA (ctDNA) from castration-resistant prostate cancer (CRPC) patients. We conducted targeted sequencing of cfDNA and paired leukocyte DNA from CRPC patients using molecular barcodes, and ctDNA variants with a variant allele frequency ??? 0.1% were detected using an in-house pipeline.

  Study JGAS000330

• Deciphering the aggressive nature of morphoeic basal cell carcinoma

  Morphoeic basal cell carcinoma (mBCC) has a high risk of local recurrence compared to the more indolent nodular subtype reflected by a different set of driver mutations including FLNB and HECTD4. Surrounding mBCC stroma is abnormal, containing mutations such as EPHA3. Hedgehog pathway over-expression is seen in both the tumour and stroma of morphoeic tissue with the latter potentially being partly responsible for its aggressive nature and risk of recurrence.

  Study EGAS00001001915

• Sarcopenia related to Head and Neck squamous cell carcinomas: transcriptome modifications of muscle cells induced by distant malignant cells

  The biological mechanisms of sarcopenia are still very poorly understood, particularly in the case of Head and Neck Squamous Cell Carcinomas (HNSCC). However, there is good reason to believe that diffusible factors originating from tumor cells exert a distant deleterious effect on muscle cells. To test this hypothesis we implemented a dual approach based both on experiments carried out in vitro and on the study of muscle fragments from patients.

  Study EGAS50000000669

• High Altitude Pulmonary Hypertension

  The Central Asian Kyrgyz highland population provides a unique opportunity to address genetic diversity and understand the genetic mechanisms underlying hypoxia-induced high altitude pulmonary hypertension (HAPH). While a significant fraction of the population is unaffected, there are susceptible individuals who display HAPH in the absence of any lung, cardiac or hematologic disease. We report herein the analysis of the whole genome sequencing of healthy individuals compared with HAPH patients and other controls.

  Study EGAS00001003171

• IgCaller

  IgCaller is a python program designed to fully characterize the immunoglobulin (IG) gene rearrangements and oncogenic translocations in lymphoid neoplasms from whole-genome sequencing (WGS) data. Using a cohort of 331 patients comprising different subtypes of B-cell neoplasms, we demonstrate that IgCaller identifies both heavy and light chain rearrangements providing additional information on their functionality, somatic mutational status, class switch recombination, and oncogenic IG translocations. We provided here IG reads of the previously unpublished WGS.

  Study EGAS00001004298

• Sequencing of an organoid biobank for childhood soft tissue sarcoma.

  Rhabdomyosarcomas are diverse tumors of mesenchymal origin and the most common childhood soft tissue sarcoma. Patients receive intense treatment with a nevertheless poor prognosis for high-risk patients. New therapy would benefit from additional preclinical models and their rapid establishment. Tumor organoid models (tumoroids) have so far only been established from epithelial cancers. Here, we describe generation and characterization of a collection of pediatric RMS tumoroids comprising all major subtypes.

  Study EGAS00001005912

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• Egypt_Genome_Project___low_coverage_whole_genome_sequencing

  All humans outside Africa are descendants of the same single exit, usually dated at 50-70 thousand years ago. However, the route taken out of Africa is still debated. The two main candidates are a northern route via Egypt and the Levant, or a southern route via Ethiopia and the Arabian Peninsula. We are generating genetic data to evaluate these two possibilities. In this study we propose to generate low-coverage sequencing data for 100 Egyptian samples.

  Study EGAS00001000480

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• Whole_genome_sequencing_of_a_Grem1_mutant_human_tumour

  The BMP antagonist Grem1 has been shown to be associated with a rare human polyposissyndrome (HMPS). We have shown that there is a 40KB duplication on chrom 15 found insome patients with HMPS. Traditional serrated adenomas (rare sporadic polyps) share somemorphological features with HMPS polyps and it has long been hypothesised that they are thesporadic version of HMPS polyps. We have obtained of one of theselesions and in this project we aim to characterise this tumour.

  Study EGAS00001000562

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• Much ado about nothing? - Off-target amplification can lead to false positive bacterial brain microbiome detection in healthy and Parkinson's disease individuals

  Recent studies suggested the existence of (poly-)microbial infections in human brains. Using 16S rRNA gene amplicon sequencing, we tested the hypothesis that there is a bacterial brain microbiome. We evaluated brain samples from healthy human subjects and individuals suffering from PD (olfactory bulb and pre-frontal cortex). We identified off-target amplification as a major confounding factor in low-bacterial/high-host-DNA scenarios.

  Study EGAS00001004757

• Distinct genomic profile and specific targeted drug responses in adult cerebellar glioblastoma

  Only a few studies have reported the molecular characteristics of adult cerebellar glioblastoma (C-GBM), a subtype comprising 1% of glioblastoma cases located within the infratentorial brain region due to the rarity. By identifying genomic profiles from 19 adult C-GBM samples, we revealed the genetic intertumoral heterogeneity in C-GBM as well as distinct genomic characteristics from those of supratentorial glioblastomas (S-GBMs), emphasizing the need of individualized therapies for C-GBM patients.

  Study EGAS00001002517

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Whole-exome sequencing of ovarian clear cell carcinoma in clinical outliers

  Whole-exome sequencing dataset for the Australian Ovarian Cancer Study (AOCS) and The Jikei University School of Medicine (JIKEI) ovarian clear cell carcinoma (OCCC) clinical outliers project, representing 10 donors. Although OCCC are commonly resistant to platinum based chemotherapy, good clinical outcomes are observed in a subset of patients. Exome sequencing was performed in 10 patients who had either unusually long survival (N=5) or had a very short time to progression (N=5).

  Study EGAS00001004248

• Targeted sequencing of paired tumour/blood of 34 T1 stage bladder cancer patients

  Stage T1 bladder cancer presents a high risk of progression and requires improved understanding. In continuation of our whole-exome sequencing study on this subtype of the disease, we carried out this targeted paired tumour/blood sequencing study including 34 T1 stage bladder cancer patients. Agilent’s SureDesign tool was used to design a 1.133 Mb SureSelect custom capture for all coding exons of the 140 selected candidate genes.

  Study EGAS00001005767

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Nasal epithelial cells of PCD and non-PCD patients grown at air-liquid interface for RNAseq analysis

  Raw RNAseq data files of genetically unsolved PCD patients used for transcriptomic analysis aming to uplift the diagnostic rate. The non-PCD patients were used as a clinical comparator to the PCD patients. Majority of the nasal epithelial cells used for RNAseq were cultured at an air-liquid interface for 21 days, unless the data file name indicates a different air-liquid-culture time-point.

  Study EGAS00001006632

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• Genetic scoring guide for personalized risk assessment in pediatric B-cell precursor Acute Lymphoblastic Leukemia

  In this study a next-generation sequencing based method was applied to comprehensively screen for recurrent, disease-relevant copy number aberrations in a cohort of Hungarian patients. Diagnostic bone marrow samples from 260 children with B-cell acute lymphoblastic leukemia and were investigated by digital multiplex ligation-dependent probe amplification using the disease-specific D007 probemix. Whole chromosome gains and losses, as well as subchromosomal copy number aberrations were simultaneously profiled.

  Study EGAS00001007239

• Clonal_selection_after_gene_therapy_in_SCD___Duplex_sequencing

  This study includes the targeted duplex sequencing data relating to this study. A custom targeted panel was used including 29 AML-associated genes, and a set of mutations from driver-containing clones that were sequenced during the WGS tree-building phase of the study. Targeted sequencing is performed on each of 6 individuals included at the study at at least 3 time points per individual: one prior to gene therapy, and two post-therapy time points.

  Study EGAS00001007253

• RNA sequencing in primary human macrophages overexpressing ETS2

  We investigated an intergenic haplotype on chr21q22, linked to five different inflammatory diseases, and discovered a mechanism that orchestrates macrophage responses during chronic inflammation. We delineated how the risk haplotype increases expression of the causal gene, ETS2, and demonstrated that ETS2 is necessary for inflammatory macrophage effector functions. To establish whether ETS2 is sufficient to drive inflammatory responses, we overexpressed ETS2 in a dose-dependent manner and performed RNA-sequencing to characterise the transcriptional effects.

  Study EGAS00001007554

• Somatic mutation and clonal evolution in premalignant lung disease - WGS (2020-01-15)

  Cancer is a genetic disease caused by an accumulations of mutations, however many of these mutations have been identified in pathologically normal tissue. We aim to use laser-capture microscopy (LCM) to sample individual clones from the lung tissue of individuals with a variety of lung diseases (COPD, UIP, IPF, Emphysema, pulmonary hypertension). This will allow us to identify whether cancer-associated mutations appear in this normal tissue, assess the mutational burden present, and identify the mutational processes causing these mutations. Smoking is a large risk factor for developing many of these lung diseases so we are particularly keen to determining whether there is evidence of a smoking signature in these patients. . This dataset contains all the data available for this study on 2020-01-15.

  Dataset EGAD00001005786

• Clonal origin of lineage switch leukemia following CAR-T cell and blinatumomab therapy

  Children with ALL treated with anti-CD19 therapy occasionally develop a phenotypically distinct AML. However, the precise clonal origin of such class switch leukemias remains unresolved. Here, we reconstructed the evolution of leukemia in a child with primary ALL, two ALL relapses and AML after treatment with anti-CD19 CAR-T and blinatumomab through whole-genome sequencing. The phylogeny revealed that the AML was a monoclonal outgrowth descending from the initial ALL and harbored biallelic loss of CDKN2A, PAX5 and TP53. However, none of the ALL or AML relapses directly descended from one another, suggesting the presence of a reservoir of persistent clones. Our findings suggest anti-CD19 treatment selects pre-existing clones, with many key genetic alterations underpinning the lineage switch detectable prior to treatment.

  Dataset EGAD00001009161

• Evaluating gene expression in aggressive B-cell lymphoma using a quantitative nuclease protection assay

  Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma (NHL), comprising 25-30% of all NHL in developed countries with an annual incidence in the USA of 7 cases/100000 persons/year. Collectively, DLBCL is classified based on a common morphological appearance of diffuse growth of large transformed B-cells, immunophenotype, high proliferation rate and aggressive behaviour. Despite these similarities, DLBCLs are a heterogeneous collection of malignancies with distinct clinical and molecular characteristics that do not always correlate with immunohistological features. This gene expression dataset includes transcriptomes of ABC-DLBCLs and of GCB-DLBCLs where cell of origin is determined by the HTG-EdgeSeq quantitative nuclease protection assay. Also included are clonality results from BCR profiling from high-grade B-cell lymphomas sequenced using a NOVA sequencer

  Dataset EGAD00001011309

• Organ maturation in preparation for birth (Peds RFA) to develop a tissue resource and a single-cell atlas of organ development and maturation for dissemination among the scientific and clinical community: RNA (2025-10-14)

  Knowledge about abnormal organ development is important to understand pathology and to develop novel treatment approaches for individuals with congenital and acquired disease. Most of our current understanding is based on examination of tissues from the embryo and early foetus, collected from women undergoing termination of pregnancy in the first trimester (third) of pregnancy. There is very little known about normal and abnormal organ development from a developmental perspective during the crucial last two-thirds of pregnancy when much remodelling of foetal tissues occurs. This study will generate a single-cell atlas of late-foetal lungs, blood, heart, bone and immune organs. . This dataset contains all the data available for this study on 2025-10-14.

  Dataset EGAD00001015737

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria (2018-03-14)

  Identification of genes involved in congenital disorders of glycosylation and 3-methylglutaconic aciduria. There are more than 100 genes known for congenital disorders of glycosylation and new disorders are discovered each year. WE included patients with a so far unsolved glycosylation disease. The diagnostic group 3-methyglutaconic aciduria is a heterogenous group of disorders mostly caused by abnormal phospholipid synthesis or in association with mitochondrial dysfunction. We included patients with a so far unsolved disease and 3-methylglutaconic aciduria. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ . This dataset contains all the data available for this study on 2018-03-14.

  Dataset EGAD00001004038

• Acquisition of additional mutations drives accelerated progression of NPM1 positive CMML to AML

  This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/ We performed exome sequencing on serial samples from a patient with CMML who progressed to AML. The exome sequencing suggests that NPM1, TET2 and DNMT3a mutations were present in the dominant clone in the CMML sample and that NRAS is a new subclonal mutation in the AML sample. Diagnostic data shows the presence of a FLT3-ITD mutation in the AML sample, which is likely to have driven progression. Here we are performing re-sequencing of the putative driver and some passenger mutations which appear to be in the same clone to validate these mutations and to verify the relative quantification of these abnormalities .

  Dataset EGAD00001002194

• Correlative Genomic Analysis of Durvalumab plus Pazopanib Combination in Patients with Advanced Soft Tissue Sarcomas

  We conducted an open-label, phase 2 study to determine the activity of the anti-VEGF receptor tyrosine-kinase inhibitor, pazopanib, combined with the anti-PD-L1 immune checkpoint inhibitor, durvalumab, in unselected advanced sarcomas. In addition, we conducted whole exome and transcriptomic sequencing with pre-treatment tissue biopsy to correlate clinical outcomes with molecular and genomic biomarkers to identify patients who would most likely benefit from the combination treatment.

  Study EGAS50000000082

• scRNAseq of acute myeloid leukemia

  This study analyzes T-cell transcriptional state in acute myeloid leukemia (AML) and healthy donors. The goal of the study is to correlate T-cell transcriptional states abundances with response to chemotherapy. 12 samples (5 baseline and post-treatment, 2 baseline-only) from AML patients and 3 samples from healthy donors were collected and sequenced on Illumina platforms. The files were created using the GRCh38 reference through CellRanger count (10xGenomics).

  Study EGAS50000000357

• RNA Sequencing of Control and Myotonic Dystrophy Type 1 Cells During Myogenic Differentiation

  Immortalized control, patient-derived and CRISPR/Cas9-edited patient-derived myoblasts (known in the literature as C25, DM11, and DM11_1E6 cells, respectively) were grown confluent and were fused to myotubes in differentiation medium. Samples were collected at day -2 before initiation of differentiation (i.e. proliferation stage), at day 1 and at day 5 of differentiation in lysis buffer and stored at -70 degrees until all samples were collected.

  Study EGAS50000001152

• Identification of mutations and structural rearrangements in plasma DNA form metastatic prostate cancer patients

  In this study we analysed patients with metastatic prostate cancer to scan their tumor genomes noninvasively in plasma DNA. We enriched 1.3 Mbp of seven plasma DNAs (4 CRPC cases: CRPC1-3 and CRPC5; 3 CSPC cases: CSPC1-2 and CSPC4) including exonic sequences of 55 cancer genes and 38 introns of 18 genes, where fusion breakpoints have been described using Sure Select Custom DNA Kit.

  Study EGAS00001000453

• Exome_sequence_of_probands_in_Barrett_s_oesophagus_families

  Barrett?s oesophagus is common in the UK affecting 2 % of the population. Family history has beenrecorded among the 4000 Barrett's cases collected so far and have 241 families. Among them wehave assessed 6 multiplex families with proven Barrett?s and defined as having 1 pro band and atleast 3 affected first degree members. We propose to exome sequence the probands of these sixfamilies to assess the presence of pathogenic rare coding variants.

  Study EGAS00001000531

• Shot-gun stool metagenomics and colorectal cancer risk.

  This study aims to identify metagenomics biomarkers in colorectal cancer (CRC). The study includes 156 samples of shot-gun stool metagenomics, corresponding to 51 patients with CRC, 54 patients with high-risk adenoma, and 51 healthy controls. The sequencing libraries were prepared with 2 µg of total DNA using the Nextera XT DN Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing was performed at 150 nucleotides, paired-end, using an Illumina HiSeq 4000 platform.

  Study EGAS00001007025

• cis-eQTL mapping of human pancreatic islets

  The intersection of genome-wide association analyses with physiological and functional data indicates that variants regulating islet gene transcription influence type 2 diabetes predisposition and glucose homeostasis. However, the specific genes through which these regulatory variants act remain poorly characterized. In this study, we generated eQTL data from human islet samples to establish the extent to which this allowed us to identify candidate effector transcripts at GWAS loci for T2D and glycemic traits.

  Study EGAS00001001265

• Follicular lymphoma at diagnosis, treated in first line with immunochemotherapy

  We performed targeted NGS in Follicular lymphoma samples at diagnosis. Explored clinico-genetic correlations and assessed four clinical or clinicogenetic risk models (FLIPI, FLIPI-2, PRIMA-IP or m7-FLIPI-molecular score) in patients with symptomatic FL who received frontline immunochemotherapy. Out of 191 patients with FL grade 1-3a, 109 were successfully genotyped. Treatment consisted on rituximab (R) plus CVP/CHOP (72.5%) or R-bendamustine (R-B) (27.5%).

  Study EGAS00001006674

• NEC

  This multi-centre, non-randomized, open-label, phase II trial (NCT03016338), assessed niraparib monotherapy (cohort 1, C1), or niraparib and dostarlimab (cohort 2, C2) in patients with recurrent serous or endometrioid endometrial carcinoma. The primary endpoint was clinical benefit rate (CBR). Secondary outcomes were safety and objective response rate (ORR). Translational research was an exploratory outcome. Potential biomarkers were evaluated in archival tissue by immunohistochemistry and next generation sequencing panel. Feasibility of liquid biopsy by ctDNA was assessed.

  Study EGAS00001007013

• Anthropological dataset 2 for The admixture histories of Cabo Verde

  Datasets used in the article "The genetic and linguistic admixture histories of the islands of Cabo Verde" by Laurent R et al. eLife 2023 (DOI: https://doi.org/10.7554/eLife.79827 - URL: https://elifesciences.org/articles/79827) File name "eGAdeposit_233CaboVerde_GEOcoordFULL_FINAL_01062022.txt" Column 1 corresponds to individual alphanumeric codes as in the "eGAdeposit_233CaboVerde_GenotypeFile_FINAL_01062022.vcf" genotype file Column 2-3 corresponds to X-Y GPS coordinates of individual's interview location in Cabo Verde Column 4-5 corresponds to X-Y GPS coordinates of individual's self-reported residence location at the time of the interview Column 6-7 corresponds to X-Y GPS coordinates of individual's self-reported birth-place location Column 8-9 corresponds to X-Y GPS coordinates of individual's self-reported paternal birth-place location Column 10-11 corresponds to X-Y GPS coordinates of individual's self-reported maternal birth-place location

  Dataset EGAD00001008977

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Massive genomic rearrangement acquired in a single catastrophic event during cancer development

  Dataset EGAD00001000002

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-RW9277

  WGS and RNA-Seq data from a GBM patient PT-RW9277

  Dataset EGAD00001004259

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genome and transcriptome sequence data from a diffuse aarge B-cell lymphoma (relapse) tumor patient

  Genome and transcriptome sequence data from a diffuse large B-cell lymphoma (relapse) patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015308

• Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm tumor patient

  Genome and transcriptome sequence data from a relapsed blastic plasmacytoid dendritic cell neoplasm patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015312

• Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor tumor patient

  Genome and transcriptome sequence data from a metastatic malignant peripheral nerve sheath tumor patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015322

• Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour tumor patient

  Genome and transcriptome sequence data from a CNS non-germinoma germ cell tumour patient, generated as part of the BC Cancer Agency's Pediatric Personalized Onco-Genomics study

  Dataset EGAD00001015327

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Germ Cell and Associated Heme Malignancies Evolve from a Common Shared Precursor

  Germ cell tumors (GCTs) are the most common cancer in men between the ages of 15-40. While most patients are cured, those with disease arising in the mediastinum have distinctly poor outcomes. One in every 17 patients with primary mediastinal non-seminomatous GCTs develop an incurable hematologic malignancy and prior data intriguingly suggests a clonal relationship exists between hematologic malignancies and GCTs in these cases. To date however, the precise clonal relationship between GCTs and the diverse additional somatic malignancies arising in such individuals has not been determined. Here, we traced the clonal evolution and characterized the genetic features of each neoplasm from a cohort of fifteen patients with GCTs and associated hematologic malignancies. We discovered that GCTs and hematologic malignancies developing in such individuals evolved from a common shared precursor, nearly all of which harbored allelically imbalanced TP53 and/or RAS pathway mutations. Hematologic malignancies arising in this setting genetically resembled mediastinal GCTs rather than de novo myeloid neoplasms. Our findings argue that this scenario represents a unique clinical syndrome, distinct from de novo GCTs or hematologic malignancies, initiated by an ancestral precursor which gives rise to the parallel evolution of GCTs and blood cancers in these patients. Reprinted from PMID: 32897884, with permission from JCI.

  Study phs002231

• A Large Data Resource of Genomic Copy Number Variation across Neurodevelopmental Disorders

  This study presents the first genome-wide copy number variation (CNV) analysis across autism spectrum disorder (ASD), attention deficit hyperactivity disorder (ADHD), schizophrenia (SCZ), and obsessive-compulsive disorder (OCD). A total of 2,691 subjects diagnosed with a neurodevelopmental disorder (NDD), and a total of 1,769 unaffected family members from Ontario, Canada were assayed using the Affymetrix CytoScan HD array. We identified rare CNVs, (< 0.1% frequency in 10,851 population control samples), and found clinically relevant CNVs in 10.5% of total subjects. Among all NDD subjects, we identified 17 (0.63%) with aneuploidies and 115 (4.3%) with known genomic disorder variants. We searched further for genes impacted by different CNVs in multiple disorders. Examples of NDD-associated genes linked across more than one disorder (listed in order of occurrence) are NRXN1, SEH1L, LDLRAD4, GNAL, GNG13, MKRN1, DCTN2, KNDC1, PCMTD2, KIF5A, SYNM, and long non-coding RNAs: AK127244, NRON, and PTCHD1-AS. We demonstrated that identical CNVs or genes could potentially contribute to the etiology of multiple NDDs. The CNVs identified will serve as a useful resource for both research and diagnostic laboratories for prioritization of variants and clinical interpretations.CNV data from this study are available through dbVar at https://www.ncbi.nlm.nih.gov/dbvar/studies/nstd173/.

  Study phs001881

• Assessing gene expression profiling from FFPE Patient Samples: A Comparison of Two Library Preparation Approaches and Recommendations

  Next-Generation Sequencing (NGS) has transformed cancer research and clinical practice, with Whole Exome Sequencing (WES) driving advances in mutational profiling and personalized oncology. Yet, transcriptomic signatures remain essential for understanding disease mechanisms, including therapy resistance pathways. RNA sequencing (RNA-seq), however, faces unique challenges when dealing with low-input or degraded RNA, as often found in archival formalin-fixed paraffin-embedded (FFPE) tissues. Although previous studies have compared library preparation protocols, rapidly evolving technologies call for updated evaluations. Here, we present a direct comparison of two FFPE-compatible stranded RNA-seq library preparation kits: TaKaRa™ SMARTer® Stranded Total RNA-Seq Kit v2 (Kit A) and Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Kit B). Both kits generated high-quality RNA-seq data, yet important differences emerged. Notably, Kit A achieved comparable gene expression quantification to Kit B while requiring 20-fold less RNA input, a crucial advantage for limited samples, albeit with increased sequencing depth. We critically discuss these results in relation to RNA availability, technical performance, cost-effectiveness, processing time, and automation potential, offering practical guidance for selecting optimal RNA-seq strategies in clinical and translational research settings

  Study EGAS50000001066

• Hermansky-Pudlak syndrome type 1 causes impaired anti-microbial immunity through a pathogenic lipid metabolism-mTOR circuit

  Mendelian diseases that present with immune-mediated disorders can provide insights into the molecular mechanisms that drive inflammation. Hermansky-Pudlak syndrome (HPS) types 1 and 4 are caused by defective vesicle trafficking involving the BLOC-3 complex. The presence of inflammatory complications such as Crohn’s disease-like inflammation and lung fibrosis in these patients remains enigmatic. Using mass cytometry we observe an augmented inflammatory monocyte compartment in HPS1 patient peripheral blood that may be associated with a TNF - and IL-1α-dominated cytokine dysregulation. HPS1 patient monocyte-derived macrophages express an inflammatory TNF-OSM mRNA gene signature and changes in lipid metabolism. Using stimulation experiments and lysosomal proteomics we show that defective lipid metabolism drives RAB32-dependent mTOR signaling, facilitated by the accumulation of mTOR on lysosomes. This pathogenic circuit translates into aberrant bacterial clearance, which can be rescued with mTORC1 inhibition. We reveal that a pathogenic lipid-mTOR signaling circuit acts as a metabolic checkpoint for defective anti-microbial activity. This mechanism may be relevant to the complex pathology of HPS1 patients featuring macrophage lipid accumulation, granuloma formation, defective anti-microbial activity and tissue inflammation. Lastly, this circuit may be present in a wider group of disorders with defective lipid metabolism and cholesterol accumulation.

  Study EGAS00001005053

• Hermansky-Pudlak syndrome type 1 causes impaired anti-microbial immunity through a pathogenic lipid metabolism-mTOR circuit - 10x Genomics scRNAseq

  Mendelian diseases that present with immune-mediated disorders can provide insights into the molecular mechanisms that drive inflammation. Hermansky-Pudlak syndrome (HPS) types 1 and 4 are caused by defective vesicle trafficking involving the BLOC-3 complex. The presence of inflammatory complications such as Crohn’s disease-like inflammation and lung fibrosis in these patients remains enigmatic. Using mass cytometry we observe an augmented inflammatory monocyte compartment in HPS1 patient peripheral blood that may be associated with a TNF - and IL-1α-dominated cytokine dysregulation. HPS1 patient monocyte-derived macrophages express an inflammatory TNF-OSM mRNA gene signature and changes in lipid metabolism. Using stimulation experiments and lysosomal proteomics we show that defective lipid metabolism drives RAB32-dependent mTOR signaling, facilitated by the accumulation of mTOR on lysosomes. This pathogenic circuit translates into aberrant bacterial clearance, which can be rescued with mTORC1 inhibition. We reveal that a pathogenic lipid-mTOR signaling circuit acts as a metabolic checkpoint for defective anti-microbial activity. This mechanism may be relevant to the complex pathology of HPS1 patients featuring macrophage lipid accumulation, granuloma formation, defective anti-microbial activity and tissue inflammation. Lastly, this circuit may be present in a wider group of disorders with defective lipid metabolism and cholesterol accumulation.

  Study EGAS00001005098

• Comprehensive Genomic Characterization of Refractory Multiple Myeloma Reveals a Complex Mutational and Structural Landscape Associated with Drug Resistance (H067)

  Outcome of patients with multiple myeloma (MM) refractory to immunomodulatory agents (IMiDs) and proteasome inhibitors (PIs) is still very poor. To elucidate the genetic landscape of relapsed/refractory MM (RRMM) we performed whole genome and transcriptome sequencing of 39 heavily pretreated RRMM patients with at least double refractoriness revealing complex structural changes and a high mutational load (H067/K08K). We found a median of 67 structural variants and 116 nonsynonymous exonic mutations per patient. Assessment of oncogenic drivers showed NRAS, BRAF, TP53, KRAS, SLC4A7, FAM46C, DIS3, RB1, KMT2C, MLLT4, EWSR1, HCFC2, and COPS3 as significantly mutated. We found multiple genomic regions with bi-allelic events affecting known tumor suppressor genes, most frequently TP53, RB1, and TRAF3. Supervised analysis of mutational signatures showed a major contribution of Cosmic signature 6 associated with deficiency in DNA mismatch repair and the ‘BRCAness’ signature which coincided with mutations in genes known to confer PARP inhibitor sensitivity. Recurrently mutated gene networks included genes with relevance for PI and IMiD activity, the latter including in particular members of the Cereblon and the COP9 signalosome complex. In conclusion, this comprehensive genomic characterization revealed a complex mutational and structural landscape in RRMM and highlights potential implications for therapeutic strategies.

  Study EGAS00001004363

• tFL with a PMBL GE signature

  We investigated the clinicopathologic features of 5 follicular lymphomas (FL) that transformed to morphologic diffuse large B-cell lymphomas (DLBCL) and had a primary mediastinal large B-cell lymphoma (PMBL)-like gene expression profile. None of the transformed FL (tFL) arose in the mediastinum, all cases tested had a germinal center B-cell immunophenotype, 20% were CD30+, 60% CD23+, 80% MAL+, 20% CD200+, and 0% CD273/PDL2+. Whole exome sequencing detected alterations in genes associated with both FL/DLBCL (CREBBP, KMT2C, KMT2D, ARID1A, HIST1 members, and TNFRSF14) and PMBL (JAK-STAT pathway genes, B2M, and CD58). Copy number (CN) analysis detected gains/amplification of REL in 60% and STAT6 in 40%, gains of chromosome 16, including IL4R, in 40%, and both deletions and gains of 11q in 20%. This cohort, although limited in size, supports a subset of tFL that has blended features between FL/DLBCL and PMBL. Despite having some features that are less common in DLBCL (MAL and CD23 expression, JAK-STAT activation), these cases lack the most characteristic CN alteration seen in PMBL (9p24.1 gain/amplification). This cohort expands the biologic heterogeneity of tFL, illustrating a subset with blended FL/DLBCL and PMBL features, with potential treatment implications that include the use of novel PMBL-targeted therapies.

  Study EGAS00001005870

• arcOGEN_HumanCoreExome-24v1-0_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-24v1-0 with consent for osteoarthritis studies only.

  Dataset EGAD00010000927

• arcOGEN_HumanCoreExome-12v1-1_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-12v1-1 with consent for osteoarthritis studies only.

  Dataset EGAD00010000924

• arcOGEN_HumanCoreExome-12v1-0_subset_2

  Subset 2 of osteoarthritis cases from the arcOGEN Consortium (http://www.arcogen.org.uk/) genotyped on HumanCoreExome-12v1-0 with consent for osteoarthritis studies only.

  Dataset EGAD00010000923

• Sequencing data for oesophageal and related samples - Normals release 2 (RNA)

  Dataset EGAD00001003838

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• WGS dataset for two NUP98-Rearranged Acute Myeloid Leukemia PDX samples

  This dataset includes whole genome sequencing of two patient-derived xenograft (PDX) samples with NUP98-Rearranged Acute Myeloid Leukemia. Bam files are provided for each sample.

  Dataset EGAD50000001563

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• PacBio HiFi whole-genome sequencing of two microsatellite instability (MSI) gastric cancer

  We generated long-read whole-genome sequencing (WGS) data using PacBio HiFi from two human gastric cancer cell lines exhibiting microsatellite instability (MSI). The dataset contains aligned bam (hg38) files.

  Dataset EGAD50000002300

• Indonesian Genome Diversity Project 2, genotyping data

  This study reports Illumina Omni 2.5M genotyping chip data for 48 individuals from Aru, Mentawai, New Guinea and Sumba islands.

  Study EGAS00001003670

• analysis of T cell receptor repertoirs

  Full information about the T cell receptor (CR) variable regions found in the sequences of the vdj region. Columns: barcode is_cell contig_id high_confidence length chain v_gene d_gene j_gene c_gene full_length productive cdr3 cdr3_nt reads umis raw_clonotype_id raw_consensus_id

  Dataset EGAD00001008109

• Whole transcriptome sequencing datasets for Low-grade Serous Ovarian Carcinoma

  This dataset includes whole transcriptome sequencing reads from 8 cell lines based on TruSeq stranded mRNA kit (Illumina). They are all 2*75bp reads sequenced using Illumina NextSeq500.

  Dataset EGAD00001006441

• Paired WGS samples (tumor and control) of one Sarcoma case

  Paired WGS samples (tumor and control) of one Sarcoma case. The paired sequencing was done on Hiseq X Ten with Illlumina TruSeq Nano DNA.

  Dataset EGAD00001010277

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Dataset contains Exome-seq and RNA-seq from 2 GBM patients, as well as RNA-seq from the derived cultured cells (GNS).

  Dataset EGAD00001001359

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Genomic Analysis of Hurthel Cell (Oncocytic) Thyroid Carcinoma

  This dataset includes 2 pairs of tumour/normal whole genome sequence data as well as MEN1 gene targeted sequencing of an additional 87 specimens.

  Dataset EGAD00001001085

• ICGC Benchmark 1 (CLL)

  Raw fastq files from WGS sequencing of CLL and matching blood normal for the ICGC Techval Benchmark1 study. Sequence data was provided to multiple centers for independent analysis and comparison.

  Dataset EGAD00001001858