17507 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..Y2KA"

in 50.57 milliseconds.

• Kidney tumour_DNA (2018-09-19)

  This is a bulk DNA and RNA sequencing study of human renal tumours . This dataset contains all the data available for this study on 2018-09-19.

  Dataset EGAD00001004346

• Integrative genomic study of CML patients

  This dataset contains WES and RNA-Seq fastq files for 65 CML patient samples at various stages of disease progression.

  Dataset EGAD00001004179

• CRISPR screen M14, NCI-H3122

  Genome wide CRISPR screen was performed to find resistance to targeted drugs for melanoma and lung

  Dataset EGAD00001001389

• Epigentic sequence data of monocytes and macrophages

  Data for paper: Epigenetic dynamics of monocyte to macrophage differentiation with Chip Seq, NOMe, mRNA, total RNA, noncoding RNA, whole genome bisulfite seq,

  Dataset EGAD00001002201

• BLUEPRINT DNA methylation profiles of human hematopoietic progenitors

  DNA methylation was analyzed for stem/progenitor cell types and terminally differentiated cell types of the human blood lineage (HSC, MPP, CMP, MEP, GMP, CLP, MLP0, MLP1, MLP2, MLP3, MK, CD4+ Tcell, CD8+ Tcell, Bcell, NK, Neut, Mono).

  Dataset EGAD00001002732

• Bisulphite MPN colonies (2019-09-05)

  Swift kit whole genome bisulphite of MPN colonies . This dataset contains all the data available for this study on 2019-09-05.

  Dataset EGAD00001005313

• SF11949 snATAC Seq IDH1 mutant oligodendroglioma Male

  IDH1 mutant oligodendroglioma male, 40. Single Nuclei ATAC seq data from low grade human glioma sample. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005398

• SF12017 snATAC Seq IDH1 Mutant GBM 55, Male

  IDH1 mutant GBM 55, Male. Single Nuclei ATAC seq data from high grade human glioma samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005405

• SF11215 snATAC Seq GBM

  High grade glioma sample, Gender Male Age 46. Single Nuclei ATAC seq data from high grade human glioma samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005407

• SF11331 snATAC Seq Primary GBM Male

  SF11331 Primary GBM Male,55 Single Nuclei ATAC seq data from high grade human glioma sample. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005408

• SF11612 scRNA-Seq Recurrent oligodendroglioma

  Single Cell RNA seq from Recurrent oligodendroglioma sample. Gender Male Age 67. NovaSeq6000 was used for RNA seq. The files uploaded are bam files created with grch38 reference through Cellranger count (10xGenomics.)

  Dataset EGAD00001005411

• SF11612 snATAC Seq Recurrent oligodendroglioma

  SF11612 Recurrent oligodendroglioma. Gender Male Age 67. Single Nuclei ATAC seq data from low grade human glioma samples. NovaSeq6000 was used for ATAC seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005413

• SF9259S snRNA-Seq Primary GBM

  Single Nuceli Primary GBM 73 Male. Single Nuclei RNA seq from high grade primary glioma sample. NovaSeq6000 was used for RNA seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005428

• Multi-region sequencing of a RET fusion positive cancer patient

  Deep WGS sequencing (160x) of 2 different sites of disease of a patient with a RET fusion positive cancer. Amplicon sequencing of 19 other sites of the same patients for the RET fusion.

  Dataset EGAD00001005776

• combined ChIPseq (H3, modifications and TF)

  ChIPseq data for 31 CLL samples (12 controls, 19 tumor) of the CancerEpiSys-PRECiSe project; containing histone H3, histone modifications and transcription factor binding sites (CTCF, EBF1).

  Dataset EGAD00001005969

• Blood plasma and paired genomic DNA from neuroblastoma patients

  The dataset is comprised of 3 blood plasma samples (Patient 1-3_plasma_cfDNA) paired with genomic DNA (Patient 1-3_tumor gDNA) from the corresponding primary neuroblastoma from three patients. For all these samples whole-exome sequencing (WES) data have been generated.

  Dataset EGAD00001006012

• Leiomyosarcoma RNA-Seq

  RNA was extracted from fresh frozen LMS material for 29 untreated tumors (24 primary tumors, 5 metastatic12 relapses) and 13 tumors treated with radiation(7 primaries, 6 metastatic relapses). RNA-Seq sequencing was performed using established protocols on Illumina HiSeq 2500

  Dataset EGAD00001006628

• Fecal 16S rRNA gene sequencing

  Human fecal 16S rRNA gene sequencing data from patients treated with combined anti-CTLA-4 and anti-PD-1 immunotherapy for advanced melanoma.

  Dataset EGAD00001006735

• CASCADE Metastatic Melanoma Rapid Autopsy sequencing data

  Sequence data (paired-end FASTQ format) for 209 samples from 73 sample sites, from 7 individuals. Samples include primary melanomas, metastatic tumours and ctDNA

  Dataset EGAD00001006867

• PacBio HiFi sequencing of telobait-captured DNA from 48 patients

  PacBio HiFi sequencing was performed on 48 barcoded patients' genomic DNA after a telobait-capture protocol to enrich for telomeric regions. The sequencing reads of each patient were de-multiplexed and presented as patient-specific PacBio CCS BAM files.

  Dataset EGAD00001008626

• WGS data subfolder for normal tissue from multifocal ileal NETs study

  This dataset includes linked-read whole-genome sequencing data from the normal ileal of the patient. The normal sample was sequenced using the 10x Genomics linked-read whole-genome sequencing (WGS) approach.

  Dataset EGAD00001008491

• OAK biomarker data

  Additional relevant biomarker data for OAK including PD-L1 tumor cell IHC by the 22C3 assay, tumor mutational burden status, and STK11, KEAP1, and EGFR mutation status.

  Dataset EGAD00001008550

• Ampliseq library database

  This database contains 46 samples for early stage ovarian high grade serous carcinoma project. Amplicon sequencing on 37 tumour samples from early stage ovarian high grade serous carcinoma as well as 5 adjacent normal tissue samples and 4 whole blood samples.

  Dataset EGAD00001008587

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Transcriptome Analysis of CLL patient samples

  This dataset includes Illumina RNA Sequencing Data for 59 chronic lymphocytic leukemia patient samples. 57 samples are single end, 2 samples are paired end sequencing.

  Dataset EGAD00001008320

• CBD-RAW-RNASEQ: Bulk RNAseq data

  Bulk RNAseq data from whole blood. For further information regarding this dataset, please contact Katie Burnham and Andew Kwok at contact@combat.ox.ac.uk.

  Dataset EGAD00001007957

• CBD-RAW-SC-ATAC: 10X Single-Cell ATAC

  Raw Illumina sequencing data from single-cell ATACSeq experiments. For further information regarding this dataset, please contact Julian Knight and Tatjana Sauka-Spengler at contact@combat.ox.ac.uk.

  Dataset EGAD00001007963

• CBD-RAW-SC-VDJ-B: 10X Single-Cell VDJ BCR

  Raw Illumina sequencing data. For further information regarding this dataset, please contact Rachael Bashford-Rogers at contact@combat.ox.ac.uk.

  Dataset EGAD00001007964

• Dataset for LCPlus_WGS

  WES/WGS sequencing data of 56 chromothriptic tumor and control runs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001009275

• CITE-Seq (Cellular Indexing of Transcriptomes and Epitopes by Sequencing) of CLL_24

  To explore intratumor-heterogeneity of CLL_24 using single-cell multi-omics approach, we generated single-cell CITE-seq data for CLL_24, coupling scRNA-seq and protein surface marker measurements with oligo-tagged antibodies.

  Dataset EGAD00001009174

• Raw count matrix for 418 baseline samples

  Count matrix from 418 pre-treatment (Ven-Obi or Clb-Obi) CD19+ B cells

  Dataset EGAD00001009501

• sWGS of cfDNA from metastatic CRC patients

  Paired end shallow whole genome sequencing (sWGS) data (FASTQ) for the identification of genomewide somatic copy number alterations (SCNA) and the estimation of tumor fractions.

  Dataset EGAD00001010293

• Bulk RNA from sorted CD8+ T cells after 48h co-culture with human Mito-DsRed MSCs.

  For human samples, total cellular RNA was isolated from post-sorted Mito+ and Mito CD8+ cells using the RNeasy Mini Kit (Qiagen). Stranded RNA libraries were created using SMARTSeq Stranded.

  Dataset EGAD00001011082

• Data for noninvasive lung cancer subtyping study

  This dataset included cfMethyl-Seq data of 15 plasma cfDNA samples from 15 lung cancer patients and RRBS data of 58 lung tumor tissue samples from 58 lung cancer patients. The data were generated following the standard protocols.

  Dataset EGAD00001015344

• Dataset for RNA and Exome sequencing of Glioblastoma samples

  This dataset contains RNA Seq, 10x scRNA Seq and Exome sequencing of glioblastoma samples. Sequencing was performed on a Illumina NovaSeq 6000 and Illumina HiSeq 4000. The sequencing was always paired.

  Dataset EGAD00001012235

• WXS dataset of Ewing and Ewing-like-sarcoma tumoroid biobank reveals distinct drug sensitivities: translocation makes the difference

  Creation of living organoid biobank for ewing and ewing-like sarcomas

  Dataset EGAD00001015417

• Exome sequencing data for 40 cases of alopecia areata and vitiligo

  Sequencing of independent unrelated cases of alopecia areata (total/ universal) and vitiligo (>10%, affected family member). DNA obtained from blood

  Study EGAS00001003831

• Pathways Study

  The Pathways Study (NCI R01 CA105274, PI: Kushi), is a prospective cohort study of a diverse population of recently diagnosed breast cancer survivors in KPNC. The aims are to examine the effect on recurrence and survival of 1) lifestyle factors such as diet, physical activity, and use of complementary and alternative therapies and 2) molecular factors such as biomarkers of inflammation and tumor DNA methylation profiles. Recruitment into the cohort was from January 2006 to May 2013. Baseline data collection was by in-person interview (on average two months post-diagnosis), with follow-up via mailed or phone questionnaires at 6, 24, and 72 months and outcomes and comorbidities at 12, 24, 48, 72, and 96 months post-enrollment. The Pathways Study is now funded through May 2021 as a cancer cohort infrastructure grant (U01 CA195565, MPI: Kushi/Ambrosone). The Pathways baseline interview consists of interviewer- and self-administered questionnaires. Interviewer-administered questionnaires collected information including demographics, family health history, pregnancy health history, menstrual history, history of breast care screening procedures, smoking history, hormone use, medication history, and vitamin and mineral use. Self-administered questionnaires collected information on diet, physical activity, CAM use, lymphedema, and psychosocial and quality of life measures.

  Study phs001534

• Longitudinal Study of Urea Cycle Disorders

  Individuals with Urea Cycle Disorders (UCD) cannot remove ammonia, a waste product, from the blood. The purpose of this study is to conduct a longitudinal investigation of the natural history, morbidity, and mortality in people with UCD. This study will look at how people with a UCD grow and develop over time and how often they get sick. The research questions are: What is the prevalence of specific morbid indicators of disease severity, including hyperammonemia, developmental disabilities, and various long-term kidney and liver effects? What is the fatality rate associated with the various forms of UCD? What are the correlations between various biomarkers and disease severity and progression? What is the safety and efficacy of currently used and new UCD therapies? This is a longitudinal study of individuals with urea cycle disorders. Those participating in this study will be evaluated every three to twelve months, depending age and time of diagnosis. Participants two years of age and younger that were diagnosed with UCD within the first four weeks of life will be evaluated every three months. Those who are over two years of age or were diagnosed after four weeks of age will be evaluated every six months. Participants older than 18 years of age will be evaluated once every year.

  Study phs000577

• NHLBI TOPMed - NHGRI CCDG: Pakistan Risk of Myocardial Infarction Study (PROMIS)

  The Pakistan Risk of Myocardial Infarction (PROMIS) study is a retrospective multicenter case-control cohort study of individuals with and without coronary heart disease from Pakistan. Multiple biological samples have been collected from the participants including DNA, plasma, serum, and whole blood. The goal of the study is to recruit 20,000 cases and 20,000 controls of Pakistani descent. Eligible cases were individuals aged 30-80 who presented to the emergency department of a participating recruitment center in Pakistan with clinical symptoms consistent with a myocardial infarction (MI), ECG changes consistent with MI, elevated troponin levels consistent with MI, and no prior history of cardiovascular disease. Controls were individuals of Pakistani descent who did not have a self-reported history of cardiovascular disease. This site hosts data generated via NHLBI's TOPMed program and NHGRI's Common Disease Genomics (CCDG) program. Both whole exome and whole genome data are presented here, namely 4,211 whole genomes from TOPMed, 3,859 whole genomes from NHLBI supplemental funds, 1,136 whole genomes and 16,855 whole exomes from CCDG. Please note that there is additional legacy whole exome data (7,298 subjects) also generated via NHGRI funds as part of the MIGen Exome Sequencing project that can be found in dbGaP at phs000917.

  Study phs001569

• Single cell transcriptomic landscape of pediatric B-cell acute lymphoblastic leukemia: dissection of transcriptional heterogeneity and B-cell developmental state

  Introduction: Genomic analyses of bulk ALL samples have improved our understanding of the genetic basis and risk stratification of B-ALL, but do not directly examine intratumor heterogeneity or enable inference of leukemia developmental state and cell of origin. Methods: We profiled 89 B-ALL samples by single-cell RNA-seq (scRNA-seq) (10X Genomics 5’v2) and compared them to a scRNA-seq reference map of normal human B-cell development. Results: Analysis of heterogeneity of inferred DNA copy number alterations at single cell level showed that aneuploid ALL with near haploidy and hyperdiploid harbor chromosomal losses or gains in all blasts, consistent with early, synchronous origin rather than sequential accumulation. Intra-sample heterogeneity was driven by five gene expression signatures: cell cycle, metabolism, differentiation, inflammation, refining leukemic subtyping. An atlas of B cell development was established to map B-ALL samples to specific developmental states. Hyperdiploid samples resembled pro-B cells, while MEF2D-r and TCF3::PBX1 showed high pre-B abundance. Patients with high early lymphoid abundance had poorer outcomes. Conclusions: Understanding variation in transcriptional programs and developmental states of B-ALL blasts by sc transcriptome refines existing clinical and genomic classifications and provides novel prognostic markers.

  Study EGAS00001007512

• DAC Calprotectin in vitro effects on human early hematopoiesis

  Principal Investigator Eric Solary (eric.solary@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Bioinformatics Valentine Marchand (Valentine.MARCHAND@gustaveroussy.fr) Lucie Laplane (lucie.laplane@gustaveroussy.fr) Marine Aglave (Marine.AGLAVE@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000310

• DAC CXCL8 secreted by immature granulocytes inhibits wildtype hematopoiesis in chronic myelomonocytic leukemia

  Principal Investigator Dorothee Selimoglu-Buet (Dorothee.SELIMOGLUBUET@gustaveroussy.fr) Eric Solary (eric.solary@gustaveroussy.fr) Francoise Porteu (francoise.porteu@gustaveroussy.fr) Head of Genomics platform Nathalie Droin (nathalie.droin@gustaveroussy.fr) Head of Bioinformatics platform Marc Deloger (Marc.DELOGER@gustaveroussy.fr) Data Manager Melis Cardon (melis.cardon@gustaveroussy.fr) Data Protection Officer Clara BECHET (Clara.BECHET@gustaveroussy.fr)

  Dac EGAC50000000322

• Whole-genome-sequencing and Whole-exome-sequencing in Spastic paraplegia

  To identify the genetic cause and modifiers of Spastic paraplegia, we performed Whole-genome-sequencing and Whole-exome-sequencing of Spastic paraplegia patients.

  Study JGAS000494

• DAC Magna Græcia University of Catanzaro - WGS of Healthy and PSP Donors

  This DAC manages access to whole-genome sequencing (WGS) data from patients with Progressive Supranuclear Palsy (PSP) and healthy controls (HC), generated at the Magna Græcia University of Catanzaro. Data access will be granted in compliance with participant consent and applicable ethical regulations.

  Dac EGAC50000000709

• CFTR Gene Variant Detection in Moroccan Individuals via Nanopore Long-Read Sequencing

  This study consists of sequencing the whole CFTR gene (coding and non-coding regions) using Oxford Nanopore on Moroccan CF patients

  Study EGAS50000001423

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Reconstitution of Human Brain Cell Diversity in Organoids via Four Protocols

  This dataset contains single-cell RNA sequencing and time-course bulk RNA sequencing data of brain organoids grown from multiple cell lines using four different protocols recapitulating dorsal and ventral forebrain, midbrain, and striatum.

  Dataset EGAD50000000938

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• A neoadjuvant, phase II trial demonstrates efficacy and tolerability of Talimogene laherparepvec in cutaneous basal cell carcinoma (NeoBCC trial)

  This dataset is related to the NeoBCC trial and includes 12 human tissue samples

  Dataset EGAD50000000371

• APCIM_Nanostring_FAP

  Expression of immune related genes in 12 familial adenomatous polyposis patients. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002553

• APCIM_Nanostring_HD

  Expression of immune related genes in 12 healthy donors. Expression assessed by analyzing whole blood-derived RNA samples using a Nanostring nCounter Immunology V2 panel (579 genes)

  Dataset EGAD00010002554

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• Genomic profiling of patient-derived xenografts and organoids in prostate cancer

  Dataset contains genomic sequencing of 87 samples (blood germline, normal prostate tissues, human tumors, PDOs and PDXs). Sequencing was performed by whole-exome sequencing or targeted sequencing of prostate cancer genes.

  Dataset EGAD00001006403

• Ovarian cancer/normal cell lines

  We performed whole genome sequencing of nine OC patient-derived cell lines and one normal cell line (HOSEpiC) to analyze if the cell lines harbor OC-typical genomic aberrations absent in normal cells and to relate genomic features to drug sensitivities.

  Dataset EGAD00001003146

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• HERBY trial RNASeq

  RNA sequencing of non-brainstem paediatric high grade glioma from the HERBY phase II randomised trial. RNA from fresh frozen surgical tissue in 20 cases was subjected to Illumina whole transcriptome paired end sequencing. Data is provided as paired-end FASTQ files

  Dataset EGAD00001004070

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003957

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003975

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• RNA bam files of Renal Cell Carcinoma patients

  the dataset contains RNA bam files of Renal Cell Carcinoma patients, which belongs to "An Empirical Approach Leveraging Tumorgrafts to Dissect the Tumor Microenvironment in Renal Cell Carcinoma Identifies Missing Link to Prognostic Inflammatory Factors"

  Dataset EGAD00001003895

• ICGC PRAD-CA WGS fastq

  Raw lane level fastq files from Whole genome sequencing in support of ICGC PRAD-CA Variant calls

  Dataset EGAD00001003909

• Sequencing-based counting and size profiling of plasma Epstein-Barr virus DNA enhance population screening of nasopharyngeal carcinoma.

  We used targeted sequencing to capture and measure the abundance as well as the size profiles of EBV DNA in plasma of subjects with and without NPC

  Dataset EGAD00001004204

• Primary plasma cell leukemia genomic abnormalities

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 20 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001004323

• Somatic mutations of 256 whole-genome sequenced colorectal cancer tumors.

  Somatic mutations of 256 whole-genome sequenced colorectal tumors. 234 MSS, 19 MSI and 3 POLE mutants. See Katainen R. et al. CTCF/cohesin-binding sites are frequently mutated in cancer, Nature Genetics 2015. doi:10.1038/ng.3335

  Dataset EGAD00001004329

• Whole Genome Sequencing of 18 sequential samples from 3 CLL patients

  Whole Genome Sequencing to track subclonal heterogeneity in 18 samples from 3 Chronic Lymphocytic Leukemia patients subjected to repeated cycles of therapy. NOTE: There are only 12 BAM files available to download. The other 6 files are missing.

  Dataset EGAD00001000972

• IBDCA_Edinburgh

  In this experiment we have sequenced tumour normal pairs from patients presenting with CRC who have a prior history of inflammatory bowel disease. The idea is to identify driver mutations, new genes and novel pathways associated with the development of these malignancies.

  Dataset EGAD00001001330

• BLUEPRINT Epigenetic characterization of megakaryocytes and erythroblasts

  Megakaryocytes and erythroblasts derive from the same progenitor cell type but carry out very different functions. In order to understand how the different functional phenotypes arise we have characterised the epigenetic landscape of these cells.

  Dataset EGAD00001001871

• Neoadjuvant Breast Cancer Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Dataset EGAD00001000663

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Genetic factors underlying premature MI in Greek families without vessel disease

  The study will analyse by exome sequencing 8 Greek family members with an excess of potentially damaging mutations relating to premature MI and no vessel disease, to identify genetic factors underlying this condition. This is a follow on from project GPMI-NVD

  Dataset EGAD00001002178

• Bulk mRNA sequencing of GBM cell lines

  We expressed PDGFRAmut, wild-type PDGFRA and a GFP control from lentivirus, in two primary GBM patient-derived cell lines that we had cultured as monolayers.

  Dataset EGAD00001002269

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  Whole-exome sequencing (WES) of 216 breast cancer metastasis-normal pairs from patients who underwent a biopsy in the context of the SAFIR01, SAFIR02, SHIVA or MOSCATO prospective trials (France).

  Dataset EGAD00001002747

• Whole exome sequencing of 3 primary Plasma Cell Leukemia samples

  Primary plasma cell leukemia (pPCL) samples were sequenced using the Nimblegen MedExome Plus hybridization capture to detect translocations, copy number changes, and mutations in 3 pPCL samples and patient matched controls. Sequencing was performed on a NextSeq500 using 75 bp paired end reads.

  Dataset EGAD00001005306

• Exome sequencing of 7-member healthy family (father, mother, their three biological daughters and monozygotic twin sons)

  The dataset contains exome sequencing data of seven healthy family members, all in FASTQ format. The samples were taken from peripheral blood mononuclear cells. Furthermore, corresponding proteomics data are available as well.

  Dataset EGAD00001004949

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Skin Fibroblast Transcriptome of Type 2 Diabetic Patients

  Comparative analysis of transcriptomes of skin fibroblasts in 17 Type 2 Diabetic individuals by RNA sequencing.

  Dataset EGAD00001004980

• Sporadic and endemic Burkitt lymphoma have frequent FOXO1 mutations but distinct hotspots in the AKT recognition motif

  Sample set of 74 whole-exome sequencing samples from sporadic Burkitt lymphoma patients from the UK. 33 of these samples have matched constitutional data, giving a total number of 107 samples

  Dataset EGAD00001005105

• EGAS00001003405 combined RNA, WES, WGS data of 16 gastrointestinal tumor patients

  50 samples of 16 individuals with Gastrointestinal Tumor. Patients were sequenced in various combinations of WGS, Exome and RNA sequencing.

  Dataset EGAD00001005113

• Familial adult myoclonic epilepsy type 1 in Sri Lankan and Indian families

  Whole genome sequencing data from four affected and one unaffected individuals from two families with familial adult myoclonic epilepsy, one of Sri Lankan origin and one of Indian origin. BAM files aligned to hg19 reference genome.

  Dataset EGAD00001005777

• Phenotypic characterisation of LRRN4CL over-expression

  This study aims to use RNAseq to identify differentially expressed transcripts in human melanoma cells that over-express the cell surface protein, LRRN4CL, relative to empty-vector control cells, to provide mechanistic insight into how LRRN4CL over-expression confers enhanced pulmonary metastatic colonisation abilities.

  Dataset EGAD00001006249

• Primary tumor/metastatic/germline DNA trios equences files

  Exome sequences of primary tumor/metastatic/germline DNA trios. Tumoral and germline samples were sequenced to an expected depth of respectively 150M and 50M reads in order to obtain differential depth (>100X versus >30X). Submitted data are paired-end fastq files.

  Dataset EGAD00001006324

• Pre and Post BCG treated bulk RNAseq dataset.

  We have in total 16 files, technical duplicates of 8 unique samples from Pre and Post BCG samples collected from four non muscle invasive bladder cancer patients. These are bulk RNAseq samples generated by high-throughput sequencing platform.

  Dataset EGAD00001006634

• MDS primary and xenografted samples

  This dataset contains bam files mapped to hg19 that either were primary bone marrow cells or sorted human cells after long term engraftment in NSG mice.

  Dataset EGAD00001007760

• 3_eCLIP_TDP-43

  eCLIP of TDP-43 from iPSC-derived motor neurons in 2 control lines. Per line input and IP samples and analysis including bigWig files and peak files.

  Dataset EGAD00001008426

• Gene expression profile of mesothelial cells from peritoneal adhesion biopsies

  RNA-sequencing analysis was carried out on mesothelial cells isolated from peritoneal adhesion biopsies and compared to control human peritoneal mesothelial cells to identify a mesothelial-to-mesenchymal transition (MMT)-related gene signature in patients.

  Dataset EGAD00001008324

• Dataset of BAM files of three trio members

  This dataset contains whole genome sequencing data, based in BAM files of three trio members. These BAM files contain information of chromsomes 21, X, Y and mitochondrial.

  Dataset EGAD00001008095

• Whole-genome-seqeuncing IMFT

  Whole-genome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007804

• Non-small cell lung cancer targeted sequencing

  Targeted sequencing of non-small cell lung cancer samples. BAM files of paired end reads aligned to hg19 using BWA MEM v0.7.1573. This targeted panel covers 370 genes of clinical relevance in non-small cell lung cancer.

  Dataset EGAD00001007918

• Variants from germline WES data of pediatric cancer patients

  This dataset contains germline variants (in .vcf format) from six pediatric cancer patients (sample IDs D1 - D6). WES data of the children and their parents was mapped to hg38. A consensus of four variant callers was used to obtain germline variants of the children.

  Dataset EGAD00001009678

• scATAC-seq of first and second trimester human gonads - HUGODECA dataset

  Comprehensive map of first- and second-trimester gonadal development in humans using a combination of single-cell and spatial transcriptomics, chromatin accessibility assays, and imaging. ArrayExpress Accession: E-MTAB-10570

  Dataset EGAD00001009387

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997