11068 results for "monedas ultimate team FC 26 Visité Buyfc26coins.com. Servicio premium a un precio estándar. Increíble..XLis"

in 50.62 milliseconds.

• RNA sequencing and Illumina 2.5M SNP array data collected from 675 commonly used human cancer cell lines.

  Tumor-derived cell lines have served as vital models to advance our understanding of oncogene function and therapeutic response1. Although substantial effort has been directed to defining the genomic constitution of cancer cell line panels2–4, the transcriptome – which represents the active program of a cell – remains understudied. Here, we describe RNA sequencing and SNP array analysis of 675 commonly used human cancer cell lines. We explore numerous transcriptome features including coding and non-coding gene expression, transcribed mutations, gene fusion and expression of non-human sequences. Aside from many known aberrations we find new surprising characteristics, including more than 2200 unique fusion gene pairs representing a vast, testable repertoire of oncogenic fusions, many of which have analogs found in primary human tumors. We show that a combination of multiple genome and transcriptome features in a novel pathway-based approach enhances prediction of response to various targeted therapeutics. Our results provide valuable new insights into these critical pre-clinical models and provide added context for interpreting the numerous studies that employ these widely used cell lines.

  Study EGAS00001000610

• H3Africa - Identification and characterization of novel hereditary neurological disease genes in Mali.

  Despite the vast diversity of its populations, genetic studies in Africa have been limited. African populations, Malians in particular, have a high rate of intra-ethnic and consanguineous marriage, resulting in increased prevalence of autosomal recessive diseases. Family-based genetic studies can be limited in developed countries due to small sibships. The average fertility rate in Mali is over 6 births per woman, offering a unique opportunity to find new disease genes or mutations that can then be studied in other populations. Hereditary neurological diseases are very debilitating diseases, and developing countries, particularly in Africa, pay a high price in terms of disability-adjusted life years. Although most are currently untreatable, increasing awareness about hereditary neurological disorders can reduce this burden. This study will help to identify and characterize novel hereditary neurological disease genes in Mali. These genes are likely to be important in the normal function of the nervous system and to have important pathophysiological implications for African and other populations. This study will also train physicians and students in the characterization of neurodegenerative diseases as well as in genetic technology and molecular biology, and build a suitable research environment that will retain them.

  Study EGAS00001003016

• Whole genome and transcriptome analysis of medullary thyroid cancer

  Medullary thyroid cancer is the neoplasm of the calcitonin-producing parafollicular cells of the thyroid gland. The hormone calcitonin acts to lower the blood calcium level, counteracting the effects of the parathyroid hormone; it can also serve as a biomarker for the presence or recurrence of medullary thyroid cancer. Surgery is the only curative treatment for this cancer. Targeted therapeutics vandetanib and cabozantinib are approved for the treatment of aggressive and metastatic tumors that are not amenable to surgery. The use of these multikinase inhibitors are supported by the observed overactivation of the RET oncoprotein in a large sub-population of medullary thyroid cancers; however, not all patients carry oncogenic alterations of this kinase. Hence, there is a need for molecular characterization of medullary tumors on the genomic scale with the aim of identifying targetable mutations. Here, we describe the genomic profiles of two medullary thyroid cancers and report the presence of a putative oncogenic BRAF fusion in one. Such alterations previously observed in other malignancies and known targets of available drugs, can benefit patients who currently have no therapy options.

  Study EGAS00001001473

• Novel regional age-associated DNA methylation changes within human common disease-associated loci

  Background: Advancing age progressively impacts on risk and severity of chronic disease. It also modifies the epigenome, with changes in DNA methylation, due to both random drift and variation within specific functional loci. Results: In a discovery set of 2,238 peripheral-blood genome-wide DNA methylomes (MeDIP-seq) aged 19-82 years, we identified 71 age-associated Differentially Methylated Regions (a-DMRs, p < 1.85 x 10-8) within the Linkage Disequilibrium (LD) blocks of the NIH Catalogue of published GWAS SNPs. This included 52 novel regions, 29 within loci not covered by 450k or 27k Illumina array, and with marked enrichment for Poised Promoters and Enhancers across multiple cell types. In a replication set of 2,084 DNA methylomes, 95.7% of the a-DMRs showed the same direction of ageing effect, with 80.3% and 53.3% replicated to p < 0.05 and p < 1.85 x 10-8, respectively. Conclusion: By analysing the functionally enriched disease and trait-associated regions of the human genome, we identified novel epigenetic ageing changes, which could be useful biomarkers or provide mechanistic insights into age-related common diseases.

  Study EGAS00001001910

• Low and variable tumor reactivity of the intratumoral TCR repertoire in human cancers

  Infiltration of human cancers by T cells is generally interpreted as a sign of immune recognition, and there is a growing effort to reactivate dysfunctional T cells at such tumor sites. However, these efforts only have value if the intratumoral T cell receptor (TCR) repertoire of such cells is intrinsically tumor-reactive, and this has not been established in an unbiased manner for most human cancers. To address this issue, we analyzed the intrinsic tumor-reactivity of the intratumoral TCR repertoire of CD8+ T cells in ovarian and colorectal cancer – two tumor types for which T cell infiltrates form a positive prognostic marker. Data obtained demonstrate that a capacity to recognize autologous tumor is limited to approximately 10% of intratumoral CD8+ T cells. Furthermore, in two out of four patient samples tested, no tumor-reactive TCRs were identified, despite infiltration of their tumors by T cells. These data indicate that the intrinsic capacity of intratumoral T cells to recognize adjacent tumor tissue can be rare and variable, and suggest that clinical efforts to reactivate intratumoral T cells will benefit from approaches that simultaneously increase the quality of the intratumoral TCR repertoire.

  Study EGAS00001003119

• Germline mutations in the transcription factor IKZF5 cause thrombocytopenia.

  To identify novel causes of hereditary thrombocytopenia, we performed a genetic association analysis of whole-genome sequencing data from 13,037 individuals enrolled in the NIHR BioResource, including 233 cases with isolated thrombocytopenia. We found an association between rare variants in the transcription factor encoding gene IKZF5 and thrombocytopenia. We report five causal missense variants in or near IKZF5 zinc fingers (Znfs), of which two occurred de novo and three co-segregated in three pedigrees. A canonical DNA-Znf binding model predicts that three of the variants alter DNA recognition. Expression studies showed that chromatin binding was disrupted in mutant compared to wild-type (WT) IKZF5 and electron microscopy revealed a reduced quantity of alpha granules in normally sized platelets. Proplatelet formation (PPF) was reduced in megakaryocytes (MKs) from seven cases relative to six controls. Comparison of RNA-seq data from platelets, monocytes, neutrophils and CD4 T-cells from three cases and 14 healthy controls showed 1,194 differentially expressed genes in platelets but only four DEGs in each of the other blood cell types. In conclusion, IKZF5 is a novel transcriptional regulator of megakaryopoiesis and the eighth transcription factor associated with dominant thrombocytopenia in humans.

  Study EGAS00001003736

• UAMS Smoldering Myeloma Myeloma Sequencing

  Identifying high risk smoldering myeloma patients and progression mechanism is a prerequisite to implement effective inception strategies and curve myeloma related morbidity and mortality. We hypothesize that genomics may help identify determinants of progression that may help predict outcome and offer effective chemo preventive targets. Eighty-two patients underwent a custom targeted panel sequencing with an additional capture for the translocation loci. These results were compared to 223 newly diagnosed patients (EGAS00001003223 and EGAD00001004117) and 17 MGUS and 10 early myeloma patients. DNA was obtained from either CD138+ cells from the bone marrow of multiple myeloma patients (tumor) or from stem cell harvests or peripheral blood cells from the same patient (control). 100 ng of DNA was fragmented, end-repaired, and adapters ligated using the HyperPlus kit (KAPA Biosystems). After PCR amplification the libraries were hybridized with probes against either a targeted panel consisting of 140 genes and chromosomal regions (Nimblegen) using SeqCap reagents (Nimblegen). Hybridized libraries underwent further amplification before being sequenced on a NextSeq500 (Illumina) using 75 bp paired end reads. Overall, these data highlight the importance of dysregulation of the MAPK pathway in the progression to MM.

  Study EGAS00001003629

• The proliferative history shapes the DNA methylome of B-cell tumor and predicts clinical outcome

  Here, we provide access to CLL and DLBCL DNA methylation and gene expression data in the context of a systematic analysis of the DNA methylation variability in 1,595 samples of normal cell subpopulations and 14 tumor subtypes spanning the entire human B-cell lineage. This approach showed that differential methylation among tumor entities relates to differences in cellular origin and to de novo epigenetic alterations, which allowed us to build an accurate machine learning-based diagnostic algorithm. We identify extensive patient-specific methylation variability in silenced chromatin associated with the proliferative history of normal and neoplastic B cells. Mitotic activity generally leaves both hyper- and hypomethylation imprints, but some B-cell neoplasms preferentially gain or lose DNA methylation. Subsequently, we construct a DNA methylation-based mitotic clock called epiCMIT, whose lapse magnitude represents a strong independent prognostic variable in B-cell tumors and is associated with particular driver genetic alterations. Our findings reveal DNA methylation as a holistic tracer of B-cell tumor developmental history, with implications in the differential diagnosis and prediction of clinical outcome.

  Study EGAS00001004640

• Monitoring of leukemia clones in B-cell acute lymphoblastic leukemia at diagnosis and during treatment by single-cell DNA amplicon sequencing

  Acute lymphoblastic leukemia (ALL) is characterized by the presence of chromosomal changes, including numerical changes, translocations and deletions, which are often associated with additional single nucleotide mutations. In this study we used single-cell targeted DNA sequencing to determine the clonal heterogeneity of B-cell ALL at diagnosis and during chemotherapy treatment. With a customly designed DNA amplicon library targeting the most common mutations (in 110 genes) present in ALL, we analyzed bone marrow samples and/or blood samples from 12 B-ALL cases at diagnosis. For 4 cases where we detected multiple mutational clones at diagnosis, we also studied blood samples during the first weeks of chemotherapy treatment. This study shows that B-ALL cases with either a ETV6-RUNX1 or a BCR-ABL1 fusion have a low mutational burden, while cases with PAX5 alterations or hyperdyploidy have multiple clones at diagnosis, often with mutations in the JAK-STAT signaling pathway and the RAS signaling pathway. As expected, it can be observed that these clones disappear during treatment of the leukemia with almost no mutated cells left after two weeks of treatment.

  Study EGAS00001005029

• Kidney_transplant_nephrectomy_scRNAseq

  Single cell transcriptomics study of tissue from human kidney transplant nephrectomies Tissue is acquired from kidney transplant nephrectomies, homogenised and disaggregated to a single cell suspension prior to droplet encapsulation single cell RNAseq (10X protocol) or plate based single cell RNAseq (SS2 protocol). Human tissues, including the kidney are seeded with a tissue resident immune cell network throughout life. These cells may self renew in situ or be replaced by circulating precursors which enter the tissue in response to tissue specific niche and inflammatory signals. We are using single cell RNA sequencing of kidney transplant nephrectomy tissue to 1) understand the immune cell populations which are resident within the human kidney 2) identify which of these populations is donor or recipient derived. 3) Uncover the temporal dynamics of donor/recipient chimerism in the the human kidney following transplantation. 4) Understand transcriptional differences between organs removed for a variety of reasons (infection, chronic rejection, vascular emergencies) This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Study EGAS00001003935

• Molecular_risk_stratification_in_patients_with_T1_colorectal_cancer_WES

  The introduction of bowel cancer screening has led to a significant increase in the proportion of patients being diagnosed with asymptomatic, early-stage colorectal cancer (CRC). Although the majority of these patients are successfully treated with surgery alone, a small proportion of patients have ‘born-to-be-bad’ aggressive lesions with early dissemination leading to distant metastases. Current standard of care histological assessment is unable to distinguish between these aggressive versus non-aggressive early lesions which is essential to provide appropriate clinical management decisions. This study aims to carry out molecular and histological profiling of approximately 300 T1 CRCs in order to develop a molecular stratifier based on the risk of relapse in early-invasive CRC. This novel T1 cohort will represent the world’s largest molecularly characterised T1 cohort of samples, with digital pathology assessment alongside whole exome sequencing, copy number variation analysis and 3’ RNA-seq. This data will be used to generate a robust panel of molecular and/or histological markers applicable to formalin-fixed paraffin embedded (FFPE) archival tissue which discriminates between T1 lesions based on risk of relapse, which will ultimately be used to inform clinical management of CRC at the earliest stages of the disease.

  Study EGAS00001005734

• Clonal relationships of ductal carcinoma in situ and recurrent invasive breast cancers defined by genomic analysis

  Ductal Carcinoma In Situ (DCIS) is the most common form of pre-invasive breast cancer and despite treatment a small fraction (5-10%) of DCIS patients present with invasive disease many years later. A fundamental biologic question is whether the invasive disease recurring in the same breast is established by tumor cells in the initial DCIS or represents new unrelated disease. To address this question, we performed genomic analyses on the initial pure DCIS lesion and paired invasive recurrent tumors in 95 patients together with single cell DNA sequencing in a subset of cases. Our data shows that in 75% the invasive recurrence was clonally related to the initial DCIS, suggesting that the tumor cells were not eliminated during the initial treatment with surgery +/- radiotherapy. Surprisingly however, 18% were clonally unrelated to the DCIS, representing new independent lineages, and 7% of cases were ambiguous. Our findings show that although DCIS is often the precursor of invasive recurrence, a significant fraction of invasive recurrences are unrelated to the initial DCIS. This knowledge is essential for accurate risk evaluation of DCIS treatment de-escalation strategies and the identification of predictive biomarkers.

  Study EGAS00001005784

• B cell receptor repertoire kinetics after SARS-CoV-2 infection and vaccination

  B cells play a central role in the immune response to both SARS-CoV-2 infection and vaccination, but the development of the B cell receptor (BCR) repertoire in both contexts has not been defined nor compared. We analysed serial samples from 171 SARS-CoV-2-infected individuals with a range of disease severities together with 63 vaccine recipients, and found marked differences in the global BCR repertoire after natural infection compared to vaccination. Following infection, the proportion of BCRs bearing IgG1/3 and IgA1 isotypes increased, somatic hypermutation (SHM) was markedly decreased and, in patients with severe disease, expansion of IgM and IgA clones was observed. In contrast, after vaccination the proportion of BCRs bearing IgD/M isotypes increased, SHM was unchanged and expansion of IgG clones was prominent. Infection generated a broad distribution of SARS-CoV-2-specific clones predicted to target the spike protein whilst vaccination produced a more focused response mainly targeting the spike’s receptor-binding domain. These findings offer insights into how different immune exposure to SARS-CoV-2 impacts upon BCR repertoire development, potentially informing vaccine strategies.

  Study EGAS00001005816

• Clonal relationships of ductal carcinoma in situ and recurrent invasive breast cancers defined by genomic analysis

  Ductal Carcinoma In Situ (DCIS) is the most common form of pre-invasive breast cancer and despite treatment a small fraction (5-10%) of DCIS patients present with invasive disease many years later. A fundamental biologic question is whether the invasive disease recurring in the same breast is established by tumor cells in the initial DCIS or represents new unrelated disease. To address this question, we performed genomic analyses on the initial pure DCIS lesion and paired invasive recurrent tumors in 95 patients together with single cell DNA sequencing in a subset of cases. Our data shows that in 75% the invasive recurrence was clonally related to the initial DCIS, suggesting that the tumor cells were not eliminated during the initial treatment with surgery +/- radiotherapy. Surprisingly however, 18% were clonally unrelated to the DCIS, representing new independent lineages, and 7% of cases were ambiguous. Our findings show that although DCIS is often the precursor of invasive recurrence, a significant fraction of invasive recurrences are unrelated to the initial DCIS. This knowledge is essential for accurate risk evaluation of DCIS treatment de-escalation strategies and the identification of predictive biomarkers.

  Study EGAS00001006306

• PDAC organoid genomic heterogeneity

  The establishment of patient-derived pancreatic cancer organoid culture in recent years creates an exciting opportunity for researchers to perform a wide range of in vitro studies on a model that closely recapitulates the tumor. Among the outstanding questions in pancreatic cancer biology are the causes and consequences of genomic heterogeneity observed in the disease. However, to use pancreatic cancer organoids as a model to study genomic variations, we need to first understand the degree of genomic heterogeneity and its stability within organoids. Here, we used single-cell whole-genome sequencing to investigate the genomic heterogeneity of two independent pancreatic cancer organoids, as well as their genomic stability with extended culture. Clonal populations with similar copy number profiles were observed within the organoids, and the proportion of these clones was shifted with extended culture, suggesting the growth advantage of some clones. However, sub-clonal genomic heterogeneity was also observed within each clonal population, indicating the genomic instability of the pancreatic cancer cells themselves. Furthermore, our transcriptomic analysis also revealed a positive correlation between copy number alterations and gene expression regulation, suggesting the “gene dosage” effect of these copy number alterations that translates to gene expression regulation.

  Study EGAS00001006782

• DNA methylation landscape of prostate cancer

  Metastases from primary prostate cancers to rare locations, such as the brain, are becoming more common due to longer life expectancy thanks to improved treatments. Epigenetic dysregulation is a feature of primary prostate cancer, and distinct DNA methylation profiles are associated with the mutually exclusive SPOP mutant or TMPRSS2-ERG fusion genetic backgrounds. Using a cohort of 42 patients with prostate cancer brain metastases (PCBM), with matched primary samples available for 17 patients, we carried out DNA methylation analysis using Illumina EPIC array. We examined the epigenetic distinction between primary PCa and PCBM, the association between epigenetic alterations and mutational background, and particular epigenetic alterations that may be associated with PCBM in particular. Multiregion sampling of PCBM revealed epigenetic heterogeneity in metastases. We found aberrant methylation in PCBM is associated with mutational background, PRC2 complex activity and upregulation of EZH2, an effect that is particularly pronounced in SPOP mutant PCBM. While we detected a hypermethylator phenotype in PCBM, we also observed hypomethylation occurring at the promoters of genes involved in neuroactive ligand-receptor interactions or the calcium signalling pathway, such as GABRB3 and GRM5, a change not observed in non-brain prostate cancer metastases.

  Study EGAS00001006670

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  Children have reduced SARS-CoV-2 infection rates and a substantially lower risk for developing severe COVID-19 than adults. However, the molecular mechanisms underlying protection in younger age groups remain unknown. Here, we characterize the single-cell transcriptional landscape in the upper airways of SARS-CoV-2-negative (n=18) and age-matched SARS-CoV-2–positive children (n=24) and corresponding samples from adults (n=44), covering an age range of four weeks to 77 years. Children displayed higher basal expression of the relevant pattern recognition receptors (PRR) such as MDA5 (IFIH1) and RIG-I (DDX58) in upper airway epithelial cells, macrophages, and dendritic cells, resulting in stronger innate antiviral responses upon SARS-CoV-2 infection than adults. We further detected distinct immune cell subpopulations including KLRC1 (NKG2A)+ cytotoxic T cells and a CD8+ T cell population with a memory phenotype occurring predominantly in children. Our study provides evidence that the airway immune cells of children are primed for virus sensing, resulting in a stronger early innate antiviral responses to SARS-CoV-2 infection than adults.

  Study EGAS00001005461

• Transgenerational transmission of reproductive and metabolic dysfunction in the male progeny of polycystic ovary syndrome

  The transgenerational maternal effects of PCOS in female progeny have been revealed. As there are evidence that a male equivalent of PCOS may exist, we asked whether sons born to mother with PCOS (PCOS-sons) transmit reproductive and metabolic phenotypes to their male progeny. Here, in a Swedish nationwide register-based cohort and a clinical case-control study from Chile we found that PCOS-sons are more often obese and dyslipidemic. Their serum miRNAs are found to potentially regulate PCOS-risk genes. Our prenatal androgenized PCOS-like mouse model with or without diet-induced obesity confirmed that reproductive and metabolic dysfunctions in F1 male offspring are passed down to F3. Small non-coding RNAs (sncRNAs) sequencing of F1-F3 sperm revealed distinct differentially expressed (DE) sncRNAs across generations in the androgenized, obese, and obese and androgenized lineages, respectively. Notably, common targets between transgenerational DEsncRNAs in mouse sperm and in PCOS-sons serum indicate similar effects of maternal hyperandrogenism. These findings strengthen the translational relevance highlighting a previously underappreciated risk of reproductive and metabolic dysfunction via the male germline transmission and potential molecular markers to study in future generations.

  Study EGAS00001007079

• Discovery of immunotherapy targets for pediatric solid and brain tumors by exon-level expression

  Immunotherapy with chimeric antigen receptor T cells for pediatric solid and brain tumors is constrained by available targetable antigens. Cancer-specific exons present a promising reservoir of targets; however, these have not been explored and validated systematically in a pan-cancer fashion. To identify cancer specific exon targets, we analyze 1,532 RNA-seq datasets from 16 types of pediatric solid and brain tumors for comparison with normal tissues using a newly developed workflow. We find 2,933 exons in 157 genes encoding proteins of the surfaceome or matrisome with high cancer specificity either at the gene (n=148) or the alternatively spliced isoform (n=9) level. Expression of selected alternatively spliced targets, including the EDB domain of fibronectin 1, and gene targets, such as COL11A1, are validated in pediatric patient derived xenograft tumors. We generate T cells expressing chimeric antigen receptors specific for the EDB domain or COL11A1 and demonstrate that these have antitumor activity. The full target list, explorable via an interactive web portal (https://cseminer.stjude.org/), provides a rich resource for developing immunotherapy of pediatric solid and brain tumors using gene or AS targets with high expression specificity in cancer.

  Study EGAS00001007766

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• Action to Control Cardiovascular Risk in Diabetes (ACCORD - Imaging)

  Available DataAction to Control Cardiovascular Risk in Diabetes (ACCORD-Imaging), provides access to ECG signals data from the ACCORD clinical trial. The clinical phenotyping and outcomes data from the trial are associated with ACCORD-BioLINCC, phs003551.ObjectivesThe purpose of this study was to determine if intensive glycemic control, multiple lipid management and intensive blood pressure control could prevent major cardiovascular events (myocardial infarction, stroke or cardiovascular death) in adults with type 2 diabetes mellitus. Secondary hypotheses included treatment differences in other cardiovascular outcomes, total mortality, microvascular outcomes, health-related quality of life and cost-effectiveness.BackgroundGlycemia Trial:Patients with type 2 diabetes mellitus die of cardiovascular disease (CVD) at rates two to four times higher than non-diabetic populations of similar demographic characteristics. They also experience increased rates of nonfatal myocardial infarction and stroke. With the growing prevalence of obesity in the United States, CVD associated with type 2 diabetes is expected to become an even greater public health challenge in the coming decades than it is now. Expected increases in event rates will be associated with a concomitant rise in suffering and resource utilization.The ACCORD study investigated whether intensive therapy to target normal glycated hemoglobin (HbA1c) levels would reduce cardiovascular events in patients with type 2 diabetes who had either established cardiovascular disease or additional cardiovascular risk factors when compared to standard therapy (HbA1c between 7.0% and 7.9%). A separate analysis investigated whether reduction of blood glucose concentration decreases the rate of microvascular complications in these patients.Lipid Therapy Trial:Patients with type 2 diabetes mellitus have an increased incidence of atherosclerotic cardiovascular disease attributable, in part, to associated risk factors such as dyslipidemia. This is characterized by elevated plasma triglyceride levels, low levels of high-density lipoprotein (HDL) cholesterol and small, dense low-density lipoprotein (LDL) particles. The ACCORD Lipid Therapy trial was designed to test the effect of a therapeutic strategy that uses a fibrate to raise HDL-C and lower triglyceride levels and uses a statin for treatment of LDL-C reduce the rate of CVD events compared to a strategy that only uses a statin for treatment of LDL-C on cardiovascular outcomes in patients with type 2 diabetes that were at high risk for cardiovascular disease.Blood Pressure Trial:Diabetes mellitus increases the risk of cardiovascular disease at every level of systolic blood pressure. Because cardiovascular risk in patients with diabetes is graded and continuous across the entire range of levels of systolic blood pressure, even at prehypertensive levels, the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC 7) recommended beginning drug treatment in patients with diabetes who have systolic blood pressures of 130 mm Hg or higher, with a treatment goal of reducing systolic blood pressure to below 130 mm Hg. There is, however, a paucity of evidence from randomized clinical trials to support these recommendations. The ACCORD Blood Pressure trial tested the effect of a target systolic blood pressure below 120 mm Hg on major cardiovascular events among high-risk persons with type 2 diabetes compared to a strategy that targeted a SBP of EYE Substudy:Diabetic retinopathy, an important microvascular complication of diabetes, is a leading cause of blindness in the United States. Randomized, controlled clinical trials in cohorts of patients with type 1 diabetes and those with type 2 diabetes have shown the beneficial effects of intensive glycemic control and intensive treatment of elevated blood pressure on the progression of diabetic retinopathy. Elevated serum cholesterol and triglyceride levels have been implicated, in observational studies and small trials, as additional risk factors for the development of diabetic retinopathy and visual loss. The ACCORD EYE Substudy evaluated the effects of the ACCORD medical strategies on the progression of diabetic retinopathy in a subgroup of trial patients.MIND Substudy:Studies suggest that older persons with type 2 diabetes have at least twice the likelihood of developing late-life cognitive impairment or dementia compared to those without. The mechanisms underlying these cognitive disorders are increasingly thought to reflect a mixed pathology pattern with contributions from vascular, neurodegenerative and neurovascular processes. Pathophysiological mechanisms that have been described include inflammation, oxidative stress, energy imbalance, protein misfolding, glucocorticoid-mediated effects and differences in genetic susceptibilities. The ACCORD MIND substudy took as a premise that early intervention with the ACCORD therapeutic strategies to improve glycemic control could mitigate the adverse effects of type 2 diabetes on the brain.Subjects10,251 patients with type 2 diabetes and HbA1c concentrations of 7.5% or more participated in the trial. Of these patients, 5518 were assigned to the lipid therapy arm and 4733 to the blood pressure arm. EYE Substudy:A subgroup of 2856 patients was evaluated for the effects of the ACCORD interventions at 4 years on the progression of diabetic retinopathy. Patients who, at baseline, had a history of proliferative diabetic retinopathy that had been treated with laser photocoagulation or vitrectomy were excluded.MIND Substudy:A subgroup of 2977 patients was evaluated for cognitive function and brain volume. The ACCORD MIND substudy excluded patients aged DesignPatients were randomly assigned to undergo either intensive glycemic control (targeting a glycated hemoglobin level EYE Substudy:EYE Substudy patients were evaluated at two standardized and comprehensive eye examinations for the effects of the ACCORD interventions at 4 years on the progression of diabetic retinopathy by 3 or more steps on the Early Treatment Diabetic Retinopathy Study Severity Scale (as assessed from seven-field stereoscopic fundus photographs, with 17 possible steps and a higher number of steps indicating greater severity) or the development of diabetic retinopathy necessitating laser photocoagulation or vitrectomy.MIND Substudy:The cognitive primary outcome, the Digit Symbol Substitution Test (DSST) score, was assessed at baseline, 20 and 40 months. Total brain volume (TBV), the primary brain structure outcome, was assessed with MRI at baseline and 40 months in a sub-set of 632 patients. All patients with follow-up data were included in the primary analyses.ConclusionsGlycemia Trial:As compared with standard therapy, the use of intensive therapy to target normal glycated hemoglobin levels for 3.5 years increased mortality and did not significantly reduce major cardiovascular events. (NEJM. 2008; 358(24): 2545-59).Microvascular Outcomes of the Glycemia Trial:Intensive therapy did not reduce the risk of advanced measures of microvascular outcomes, but delayed the onset of albuminuria and some measures of eye complications and neuropathy. Microvascular benefits of intensive therapy should be weighed against the risk of increased total and cardiovascular disease-related mortality, increased weight gain, and higher risk for severe hypoglycemia. (Lancet. 2010; 376(9739): 419-30)Lipid Therapy Trial:The combination of fenofibrate and simvastatin did not reduce the rate of fatal cardiovascular events, nonfatal myocardial infarction or nonfatal stroke, as compared with simvastatin alone. These results do not support the routine use of combination therapy with fenofibrate and simvastatin to reduce cardiovascular risk in the majority of high-risk patients with type 2 diabetes (NEJM. 2010; 362(17): 1563–1574).Blood Pressure Trial:In patients with type 2 diabetes at high risk for cardiovascular events, targeting a systolic blood pressure of less than 120 mm Hg, as compared with less than 140 mm Hg, did not reduce the rate of a composite outcome of fatal and nonfatal major cardiovascular events (NEJM. 2010; 362: 1575-1585).EYE Substudy:Intensive glycemic control and intensive combination treatment of dyslipidemia, but not intensive blood-pressure control, reduced the rate of progression of diabetic retinopathy (NEJM. 2010; 363: 233-244).MIND Substudy:Although significant differences in TBV favored the intensive therapy, cognitive outcomes were not different. Combined with the unfavorable effects on other ACCORD outcomes, MIND findings do not support using intensive therapy to reduce the adverse effects of diabetes on the brain in patients similar to MIND patients (Lancet Neurol. 2011; 10(11): 969–977).

  Study phs003562

• Genomewide Association Study of Alcohol Use and Alcohol Use Disorder in Australian Twin-Families (OZ-ALC GWAS)

  The Australian twin-family study of alcohol use disorder (OZALC study) derives from telephone diagnostic interview studies of two general population volunteer cohorts of Australian twins (cohort 1, mostly born 1940-1964; cohort 2, born 1964-71) and the spouses of the former cohort - a total of over 11,000 families. Three coordinated studies, using a shared assessment protocol and with a shared goal of gene-discovery, were conducted - one funded by the National Institute on Drug Abuse, the others by the National Institute on Alcoholism and Alcohol Abuse - by investigators associated with the Midwest Alcoholism Research Center at Washington University in St. Louis, and investigators at Queensland Institute of Medical Research, Brisbane, Australia (led by Professor Nicholas Martin), using informative families identified from these cohorts. The first of these (NIDA Nicotine Addiction Genetics [NAG] project, PI Pamela Madden) identified index cases from the 3 cohorts with a history of heavy smoking (smoked 20 or more cigarettes daily, or 40 or more cigarettes on 1 or more occasions) and with additional available full siblings who were smokers, and interviewed and obtained blood samples from twins, and cooperative full siblings and parents, in order to identify families that would be informative for linkage analysis of a quantitative heaviness of smoking trait. The second identified additional families with an index case who either reported a history of alcohol dependence (DSM-IV), or scored above the 85th percentile on a quantitative measure of heaviness of alcohol use (alcohol factor score), derived from measures of frequency of heavy drinking, frequency of drinking to intoxication, and typical weekly consumption in standard drinks (all referenced to the respondent's heaviest drinking period) and of lifetime maximum 1-day alcohol consumption and maximum tolerance to alcohol (drinks before getting drunk or before feeling effects of alcohol). Interview and DNA were obtained from index cases and siblings, and DNA only from available parents. The goal of this second study (NIAAA OZ-ALCOHOL EDAC study, PI Andrew Heath) was to identify sibships including pairs who were either extreme concordant for the quantitative consumption measure (both scoring above the 85th percentile) or extreme discordant (one scoring above the 85th percentile and one scoring below the 30th percentile) that would be informative for linkage analysis. The third identified additional sibships solely on the basis of large sibship size, regardless of alcohol or tobacco use phenotypes (NIAAA OZ-BIGSIB study, PIs the late Richard Todd, Andrew Heath). From these coordinated studies a case-control series of alcohol dependent individuals and unaffected controls were constructed for a family-based Genomewide Association Study (OZALC-GWAS) of heaviness of alcohol use and alcohol dependence, funded by the National Institute of Alcoholism and Alcohol Abuse. These data are made available here for all investigators studying outcomes related to alcohol or tobacco use (including major depressive disorder).

  Study phs000181

• INCLUDE Data Hub: NDA GUIDs for Down Syndrome Research

  The INCLUDE (INvestigation of Co-occurring conditions across the Lifespan to Understand Down syndromE) Project is an NIH-wide collaboration that seeks to improve health and quality of life for people with Down syndrome. The INCLUDE Project Data Coordinating Center (DCC) and partners created the INCLUDE Data Hub, a centralized data resource that allows access to large-scale clinical and multi-omics datasets specific to Down syndrome and supports collaborative, cloud-based analysis to accelerate scientific discoveries related to Down syndrome and its co-occurring conditions. The INCLUDE Data Hub includes an innovative researcher data repository, a portal, and a cloud-based platform for data analysis. The portal provides access to de-identified demographics and clinical metadata, as well as multi-omics datasets, including whole genome sequences, transcriptomes, proteomes, and metabolomes. The INCLUDE Data Hub uses a 'registered access' model, whereby users can access the portal and associated data after agreeing to terms of use. From the Data Hub, users can also reach 'controlled access' data (e.g., whole genome sequences) only for those studies for which they have obtained approval by an NIH Data Access Committee through the corresponding dbGaP study. A thoughtful linkage strategy to identify duplicate participants across studies enables researchers to merge multiple datasets and data types to create richer datasets and reduce costly redundancies in large-scale data generation (e.g., -omics) while mitigating potential risks introduced by linkage.Based on recommendations from the NICHD Office of Data Science and Sharing, which completed a comprehensive assessment of existing Privacy Protecting Record Linkage (PPRL) and associated data governance solutions, the INCLUDE DCC and the associated NIH Steering Committee have implemented NIMH Data Archive Global Unique Identifiers (NDA GUIDs) in the INCLUDE Data Hub. The NDA GUID Tool is a government-owned and operated PPRL technology that enables researchers to link data from multiple sources to the same individual without revealing personally identifiable information (PII). With the NDA GUID Tool, the same participant information will return the same GUID whenever or wherever it is entered. The GUID itself is not personally identifiable information or protected health information. Sharing data with NDA GUIDs allows approved researchers to link together data on a single participant, even if the data were collected at different locations or through different studies or are distributed from different data repositories. This dbGaP study enables researchers to access an INCLUDE GUID Mapping File that includes all available NDA GUIDs and their associations to study-specific Participant IDs across studies in the INCLUDE Data Hub. This dbGaP study only distributes NDA GUIDs associated with the INCLUDE Data Hub datasets. To access the associated controlled-access datasets, add the corresponding dbGaP studies to your Data Access Request. A list of these studies is available on the INCLUDE Data Hub Portal: https://portal.includedcc.org/studies.

  Study phs003678

• A Phase I/IB Study of Ipilimumab or Nivolumab in Patients With Relapsed Hematologic Malignancies After Allogeneic Hematopoietic Cell Transplantation

  Relapse after allogeneic hematopoietic stem cell transplantation (HSCT) is characterized by poor outcomes and novel therapeutic options are urgently needed. Immune checkpoint blockade using CTLA-4 and PD-1 blocking antibodies are a potential concept for reinstating a dormant graft-versus-leukemia (GvL) effect.This study investigated transcriptomic changes in biopsies obtained from patients who received immune checkpoint blockade for relapsed hematologic malignancy post-HSCT and elucidated transcriptional programs associated with successful reinvigoration of GvL. Differential gene expression analysis showed evidence of increased T cell infiltration in biopsies of responders to ipilimumab treatment and demonstrated shared gene programs between GvL and GvHD.

  Study phs002377

• Circulating cell-free DNA methylation profiles as noninvasive multiple sclerosis biomarkers: A proof-of-concept study

  In chronic neurodegenerative diseases such as multiple sclerosis (MS), there is a critical unmet need for cost-effective non-invasive blood biomarkers to concurrently classify disease subtypes, monitor disability severity, and predict long-term progression. In this proof-of-concept study, we performed low-coverage whole-genome bisulfite sequencing (WGBS) on 75 plasma cell-free DNA (cfDNA) samples collected from a well-characterized real-world prospective clinic cohort with longitudinal disability outcome measurements. We assessed the clinical utility of cfDNA methylation profile for differentiating MS patients from non-MS controls, classifying MS subtypes, estimating disability severity, and predicting disease trajectories.

  Study EGAS50000001277

• GCAT | Genomes for life

  The GCAT project is a prospective cohort study that was designed to recruit the general population of Catalonia, the north-east region of Spain. This study is a long-term genomic, environmental and lifestyle cohort project that aims to evaluate and track multiple pathologies as well as biologically related traits. By the end of 2017, the GCAT Study had recruited a total of 20 000 participants aged 40–65 years. Participants who agreed to take part in the study completed a self-administered computer-driven questionnaire, and underwent blood pressure, cardiac frequency and anthropometry measurements. For each participant, blood plasma, blood serum and white blood cells are collected at baseline. The GCAT Study has access to the electronic health records of the Catalan Public Healthcare System. Participants are followed biannually for/during, at least, 20 years after recruitment. Therefore, the GCAT Study offers a unique opportunity to integrate diverse data to allow the identification of novel relations among different biomarkers and conditions. Results may lead to the development of new genetic, genomic, epigenomic and proteomic diagnoses and screening tests, as well as new public health recommendations. The only currently available population-based prospective cohort study in Spain to the date, including more than 4899 genotyped participants and 800 whole genome sequences is now stored in the EGA archive under accession id EGAS00001003018.

  Blog gcat-genomes-for-life

• MorphoITH: A Framework for Deconvolving Intra-Tumor Heterogeneity Using Tissue Morphology

  This study introduces MorphoITH, a framework for deconvolving intra-tumor heterogeneity (ITH) in clear cell renal cell carcinoma (ccRCC) based on tissue morphology from histopathological slides. The study tested MorphoITH's ability to capture different aspects of morphology and to reflect genetic ITH. The data deposited here is derived from a morphology guided multi-regional sequencing dataset used to study the relationship between morphology and genetic evolution. This dataset consists of whole exome sequencing of tumor from multiple sites and adjacent normal samples which were collected from two patients treated in affiliated hospitals of the University of Texas Southwestern Medical Center (UTSW), including Parkland Hospital.

  Study EGAS50000001064

• Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study

  The Carcinoma of Unknown Primary (CUP): A comparison across tissue and liquid biomarkers (CUP-COMP) study (NCT: NCT04750109) was sponsored by The Christie NHS Foundation Trust and funded by Innovate UK. Data generated include: A) Whole genome sequencing* of paired germline blood and tumour tissue B) Whole genome sequencing *of germline blood only C) Next-generation sequencing of circulating tumour DNA (FoundationOne Liquid CDX) D) Next-generation sequencing of tumour tissue (FoudationOne CDX) *Whole genome sequencing - germline sample at 30x coverage and somatic sample at 75x coverage performed by Illumina NovaSeq 6000 instrument in the 150bp PE read mode.

  Study EGAS00001008239

• RNA sequencing of a glioblastoma PDX cohort

  Patient-derived xenograft (PDX) models represent an essential tool for the preclinical evaluation of novel targeted therapies and their combinations. In this project, we molecularly characterized a comprehensive panel of glioma PDX models with well conserved molecular and pathological features over multiple passages. PDX samples were subjected to next generation sequencing (NGS). Characterization of cancer-relevant features including driver mutations or cellular processes was performed using mutational and gene expression data in order to identify potential biomarker or treatment targets in glioblastoma. In summary, we reported a newly established and molecularly characterized panel of glioma PDX models with high relevance for translational preclinical research.

  Study EGAS00001007119

• Sequential single-cell transcriptional and protein marker profiling reveals TIGIT as a marker of CD19 CAR-T cell dysfunction in patients with non-Hodgkin’s lymphoma

  Employed single cell RNA sequencing and protein surface marker profiling of serialCAR-T cell samples from patients with non-Hodgkin’s lymphoma (NHL) to reveal CAR-T cell evolution, identify biomarkers of response, and test for evidence of exhaustion inCAR-T cells of poor responders. At the transcriptional and protein levels, we note the evolution of CAR-T cells toward a non-proliferative, highly-differentiated, andexhausted state that is enriched in CAR-T cells of patients with poor response.Furthermore, we identified the checkpoint receptor TIGIT as a novel prognosticbiomarker and potential driver of CAR-T cell exhaustion.

  Study EGAS00001005356

• RNA sequencing data of 257 samples from the CORALLEEN trial

  Early-stage Luminal B breast cancer is frequent and is a major cause of breast cancer death due to its poor prognosis. Our proposal aims to study the biology behind the sensitivity and resistance of Luminal B breast cancer to chemotherapy (CHT) or a non-CHT regimen composed of hormone therapy in combination with ribociclib, a CDK4/6 inhibitor. To accomplish this, we first completed the SOLTI-1402 CORALLEEN phase II trial, a study where 106 patients with early-stage Luminal B breast cancer were randomized to standard neoadjuvant CHT for 6 months, or neoadjuvant letrozole and ribociclib for 6 months. After treatment, patients underwent surgery. The primary results of the study, which showed that the response rate to letrozole+ribociclib was similar to CHT, was reported (Prat et al; Lancet Oncol). Tumor biopsies were available at baseline, week 3 and surgery. A total of 257 samples were analyzed using the Illumina TruSeq Stranded Total RNA w/Ribo Zero Gold with MiSeq in TGL (Sequencer NovaSeq S4/PE/100x)

  Dataset EGAD00001010121

• A Genome-Wide Association Comparative Analysis of Response of AF Patients to Rate Control Therapy; A Collaboration between the NIH Pharmacogenomics Research Network and the RIKEN Yokohama Institute Center for Genomic Medicine

  The goal of this study was to identify genetic predictors of response to rate control therapy in patients with AF. We conducted a genome-wide association study (GWAS) focusing on subjects with a history of atrial fibrillation. Rate control therapy for AF uses a range of drugs (beta-adrenergic receptor blockers, calcium channel blockers, and digitalis) to depress conduction through the AV node, thereby preventing rapid rates and minimizing symptoms. In large groups of patients, such as the Vanderbilt AF Registry (a clinical and genetic repository with over 1200 patients with ECG-confirmed AF) from which these study subjects were drawn, approximately 5% display failure of aggressive AV nodal-blocking therapy to control ventricular rate. In these patients, interruption of the AV node by ablation and pacemaker implantation are necessary for adequate rate control. Study cases were individuals who underwent AV node ablation and pacemaker implantation after combined therapy with 3 AV nodal-blocking agents was ineffective in rate control. Controls for this study were individuals who met standardized rate-control efficacy criteria (as described in AFFIRM study, Wyse et al, NEJM 2002; PMID: 12466506) for optimal rate control with 2 or fewer AV nodal-blocking agents. Two additional groups were genotyped by RIKEN: An additional group of patients with AF as well as subjects undergoing cardiac surgery in whom AF did not occur post-operatively. All study participants were recruited and treated/evaluated at Vanderbilt University Medical Center. This study was conducted by the Pharmacogenomics of Arrhythmia Therapy subgroup of the Pharmacogenetics Research Network, a nationwide collaboration of scientists studying the genetic contributions to drug response variability. Genotyping was performed by the RIKEN research institute in Japan using the Illumina 610 Quad Beadchip platform.

  Study phs000439

• Genetic Analysis of the Chiari I Malformation

  This study used whole exome sequencing (WES) on families affected with Chiari I Malformation (CM1). Individuals were recruited from the Republic of Tartarstan in the Russian Federation, where CM1 has a high prevalence (approximately 413 out of 100,000). At least one-third of these affected individuals have an affected relative. In collaboration with Dr. Enver Bogdanov of Kazan State Medical University, seven extended families affected with CM1 were identified. Eligible participants for this study were required to 1) have CM1 and a family member with syringomyelia or CM1, or 2) be a family member of a patient with CM1 and have at least two immediate family members diagnosed with CM1. Adults and minors were eligible for this study and recruitment was through self and physician referral. Patients were excluded if they had a contraindication to MRI scanning, were unable to understand the risks of testing, were under one year of age, or could not undergo MRI scanning without sedation. Study participants underwent SPGR (Spoiled Gradient Recalled) and T1-weighted MR-imaging of the brain and cervical spinal cord to assess the volume of the posterior fossa, as well as the presence of CM1. Individuals were defined as having CM1 if the inferior aspect of the cerebellar tonsils were lying ≥=2 mm caudal to the foramen magnum. Individuals were defined as having a small posterior fossa volume if the ratio of the posterior fossa volume to the supratentorial volume was < 0.15. Sixty-two patients (both cases and controls) from the seven extended families had DNA extracted from blood lymphocytes contained in 10 milliliters of stored blood. Whole exome sequencing (WES) was performed by the National Intramural Sequencing Center (NISC). These genotype data, as well as the case-control phenotype data on CM1 diagnosis and small posterior fossa diagnosis, were made available to dbGaP.

  Study phs001795

• Shanghai Breast Cancer Genetics Study (SBCGS)

  The Shanghai Breast Cancer Genetics Study (SBCGS) includes data from four population-based studies conducted among Chinese women in urban Shanghai: the Shanghai Breast Cancer Study (SBCS), the Shanghai Breast Cancer Survival Study (SBCSS), the Shanghai Women's Health Study (SWHS), and the Shanghai Endometrial Cancer Study (SECS, contributing controls only). Shanghai Breast Cancer Study (SBCS): The SBCS is a population-based, case-control study conducted in urban Shanghai. Subject recruitment in the initial phase of the SBCS (SBCS-I) was conducted between August 1996 and March 1998. The second phase (SBCS-II) of recruitment occurred between April 2002 and February 2005. Breast cancer cases were identified through the population-based Shanghai Cancer Registry and supplemented by a rapid case-ascertainment system. Controls were randomly selected using the Shanghai Resident Registry. Approximately 3500 cases and 3500 controls were recruited in the study. Shanghai Breast Cancer Survival Study (SBCSS) and Shanghai Endometrial Cancer Study (SECS): The SBCSS also used the population-based Shanghai Cancer Registry to identify newly diagnosed breast cancer cases. A total of 5,046 breast cancer patients were recruited. In-person interviews were conducted to collect information on known breast cancer risk factors and anthropometrics by using protocols and questionnaires similar to those used in the SBCS. For genetic studies, controls for the SBCSS cases came from the SECS, which recruited healthy women between January 1997 and December 2003. With the exception of a few questions related specifically to breast or endometrial cancer risk, the questionnaires used in the SECS and the SBCS were very similar. Shanghai Women's Health Study (SWHS): The SWHS is a population-based prospective cohort study of approximately 75,000 adult women who were recruited between 1997 and 2000. The cohort has been followed by a combination of record linkage and active follow-ups. Breast cancer patients identified in the SWHS and non-cases were included in the current study.

  Study phs001088

• Multicenter International Lymphangioleiomyomatosis Efficacy of Sirolimus Trial (The MILES Trial)

  Lymphangioleiomyomatosis (LAM) is an uncommon, progressive, cystic lung disease that predominantly affects young women. It is believed to be caused by defects within cellular pathways that regulate nutrient uptake, cell size, cell migration, and cell proliferation. The disease is caused by mutations in tuberous sclerosis complex (TSC) genes. Individuals with Lymphangioleiomyomatosis (LAM) often experience pneumothorax and chylothorax, as well progressive loss of lung function. Lymphangioleiomyomatosis (LAM) is frequently fatal and existing therapies for the disease have not proven effective. Lung transplantation can be considered as a last option, but alternative treatments are needed. Sirolimus is an immunosuppressive drug that is often used in people who have had kidney transplants. It directly affects the genetic pathway that causes Lymphangioleiomyomatosis (LAM). This study will evaluate the safety and effectiveness of sirolimus in stabilizing or improving lung function in people with Lymphangioleiomyomatosis (LAM). Individuals interested in participating in this 2-year, double-blind study will first report to the study sites for pulmonary function testing to determine their eligibility for participation. Participants deemed eligible will be randomly assigned to receive either sirolimus or placebo for 1 year. Sirolimus or placebo will be administered in 2 tablet doses (2 mg for sirolimus) for the duration of the study. Study visits will occur at baseline, Week 3, every 3 months for 12 months, and Months 18 and 24. Study visits will include a physical exam, questionnaires, a pregnancy test, blood and urine collection, and functional lung tests. A 6-minute walk test will occur at most study visits; a chest x-ray will be taken at baseline and Month 24; and a volumetric computed tomography scan will occur at baseline Month 12, and Month 24. Adverse events, medication side effects, and lung function will be assessed at each visit.

  Study phs000605

• The Sea Islands Genetic Network (SIGNET): Identifying genetic contributors to diabetes and dyslipidemia in African Americans

  Recent genome-wide association studies (GWAS) have successfully identified genetic variants that influence diabetes risk in European populations, however most do not have a major impact on diabetes risk in populations of African descent. The African American (AA) population from the Sea Islands of coastal South Carolina and Georgia has high rates of type 2 diabetes, low levels of admixture, and in general, consume a diet rich in saturated fats. We postulate that this unique combination of ancestral and environmental factors results in a more consistent penetrance of diabetes risk alleles, as well as enrichment of risk alleles of African origin. The existing DNA samples and rich phenotypic data from the Sea Island Families Project comprise a unique resource for genetic studies of type 2 diabetes and related metabolic traits such as dyslipidemia. Our central hypothesis is that the increased risk for T2DM in AA compared with European American (EA) is due, in part, to susceptibility alleles of African origin, and that these alleles can be identified using a GWAS. The Specific Aims are to: 1) Identify genetic risk factors for type 2 diabetes utilizing DNA samples and data from the Sea Island Families Project, Reasons for Geographic and Racial Differences in Stroke (REGARDS) Study recruited from SC, GA, NC, and AL; and a GWAS approach; 2) Identify genetic contributors to lipoprotein subclasses in African Americans using the lipoprotein subclass profile (particle size and concentration for multiple subclasses of VLDL, LDL, and HDL) assessed by NMR at LipoScience, Inc., and the GWAS data from Aim 1. The rationale for this project is that identification and validation of novel pathophysiological pathways and informed selection of candidate genes for diabetes risk will inform development of new, targeted prevention and treatment strategies in this underserved, high risk population.

  Study phs000433

• National Institute on Aging - Late Onset Alzheimer's Disease Family Study: Genome-Wide Association Study for Susceptibility Loci

  Alzheimer disease is the most common neurodegenerative disorder of the elderly affecting an estimated five million Americans. Genetic factors contribute to the risk for disease with heritability estimates ranging from 57% to 79%. More than a decade ago, the ε4 variant of APOE was identified and remains the most consistently replicated genetic variant influencing the risk of late onset Alzheimer disease. A segregation analysis suggests there may be four additional genes influencing the age-at-onset of Alzheimer disease. In 2007 there were 968 association studies in 398 candidate genes reported, but none replicated consistently. There are many reasons for the lack of consistency, but one important reason for the lack of progress is the paucity of a sufficient number of well characterized families and patients available to the entire scientific community. The extensive effort and expense required to ascertain such a population has been addressed by the NIA-LOAD Family Study. Its goal is to identify and recruit families with two or more siblings with the late-onset form of Alzheimer's disease and a cohort of unrelated, non-demented controls similar in age and ethnic background, and to make the samples, the clinical and genotyping data and preliminary analyses available to qualified investigators world-wide. Genotyping by the Center for Inherited Disease Research (CIDR) was performed using the Illumina Infinium II assay protocol with hybridization to Illumina Human 610Quadv1_B Beadchips. This genotyping represents the largest collection of families ever assembled with Alzheimer's disease combining the NIA-LOAD Genetics Initiative Multiplex Family Study, the National Cell Repository for Alzheimer's Disease (NCRAD) with additional controls from the University of Kentucky. These genotyping results will serve as a focal point for future research that will identify all of the remaining genetic variants in Alzheimer's disease.

  Study phs000168

• Childhood Cancer Data Initiative (CCDI): Enhancement of Data Sharing in Pediatric, Adolescent and Young Adult Cancers

  NCI's Childhood Cancer Data Initiative (CCDI) is building a community centered around childhood cancer care and research data. Through enhanced data sharing, we can improve our understanding of cancer biology to improve preventive measures, treatment, quality of life, and survivorship, as well as ensure that researchers learn from every child with cancer. While childhood cancers represent the leading cause of death in children over the age of 1, they are collectively rare, comprising approximately 1%‒3% of cancers diagnosed annually in the United States. Information on diagnosis, treatment, and outcomes is often stored at the hospital or institution where a child is treated, making it difficult to answer scientific questions about childhood cancer. Sharing clinical care and research data generated by children's hospitals, clinics, or networks broadly with the community can help us learn faster and, on a scale much larger than any single institution caring for children can learn on its own. To exploit the rapid advances in high-throughput DNA sequencing technologies and realize the goals of precision cancer medicine, the UMICH Cancer Center established the Michigan Oncology Sequencing Center (MI-ONCOSEQ). This UMICH Cancer Center provisions genomic data derived from the Michigan Oncology Sequencing Center (MI-ONCOSEQ) clinical sequencing assay for patients that fall within the inclusion criteria of the CCDI data sharing initiative. An "integrative sequencing approach" carried out in a CLIA-certified laboratory is utilized to provide a comprehensive landscape of the genetic alterations in individual tumor specimens for the purpose of identifying informative and/or actionable mutations. Using a number of computational pipelines that we have developed in-house or have adapted from the public domain, candidate molecular aberrations are nominated and then analyzed by scientists for clinical significance and/or relevance. This approach enables the detection of point mutations, insertions/deletions, gene fusions and rearrangements, amplifications/deletions, and outlier expressed genes. Furthermore, we can identify certain germline alterations that may also be relevant.

  Study phs002431

• Structure and Diversity of Urinary Cell-Free DNA Informative of Host-Pathogen Interactions in Human Urinary Tract Infection

  The risk of acquiring urinary tract infection (UTI) is very high for patients who have received kidney transplants; nearly half will develop bacteriuria and an eighth viruria via BK polyomavirus in the first three years following transplantation. Current methodology for diagnosing viral and bacterial infections, while well practiced, is often limited in scope. The advent of next generation sequencing of cell-free DNA has shown promise in its ability to capture multiple perspectives of human health from discovering the origin of cell-free DNA in plasma; such a diagnostic has not been readily applied to urinary cell-free DNA. In this study, we selected 141 urine samples from a cohort of kidney transplant patients, which were collected and stored at Weill Cornell Medical College - New York Presbyterian Hospital. Of these samples, 43 samples were determined to be culture positive (> 10,000 CFU) for one or more bacterial species, including E. coli, Enterococcus, Klebsiella, Haemophilus, and Raoultella. A separate 23 samples were confirmed for BK virus nephropathy, with presence of BK polyomavirus confirmed via qPCR. We also included 29 samples from 14 patients who did not develop UTIs in the first three months following transplantation, and 11 samples that were negative for BK virus nephropathy. For a full description of samples, please see the Supplementary Data 1 in https://pubmed.ncbi.nlm.nih.gov/29925834/. From these urine samples, we aimed to capture and sequence urinary cell-free DNA using a single-stranded library preparation. In addition, we performed whole-genome bisulfite sequencing to 170 plasma samples collected from 27 hematopoietic cell transplant patients who developed graft-versus host disease and BK polyomavirus infection. We also performed Sample-Intrinsic microbial DNA Found by Tagging and sequencing (SIFT-seq) on 196 cell-free DNA (cfDNA) samples (154 plasma and 42 urine) collected from five groups of subjects. For a full description of samples, please see publications in PMID: 35864089 and PMID: 35058359.

  Study phs001564

• Genomic features of Helicobacter pylori-na��ve diffuse-type gastric cancer.

  Helicobacter pylori (HP) is a major etiologic driver of diffuse-type gastric cancer (DGC). However, improvements in hygiene have led to an increase in the prevalence of HP-na��ve DGC; that is, DGC that occurs independent of HP. Although multiple genomic cohort studies for gastric cancer have been conducted, including studies for DGC, distinctive genomic differences between HP-exposed and HP-na��ve DGC remain largely unknown. Here, we employed exome and RNA sequencing with immunohistochemical analyses to perform binary comparisons between 36 HP-exposed and 27 HP-na��ve DGCs from sporadic, early-stage, and intramucosal or submucosal tumor samples. Among the samples, 33 HP-exposed and 17 HP-na��ve samples had been preserved as fresh-frozen samples. HP infection status was determined using stringent criteria. HP-exposed DGCs exhibited an increased single nucleotide variant burden (HP- exposed DGCs; 1.97 [0.48���7.19] and HP-na��ve DGCs; 1.09 [0.38���3.68] per megabase; p=0.0003) and a higher prevalence of chromosome arm-level aneuploidies (p<0.0001). CDH1 was mutated at similar frequencies in both groups, whereas RHOA���ARHGAP pathway misregulation was exclusive to HP-exposed DGCs (p=0.0167). HP-exposed DGCs showed gains in chromosome arms 8p/8q (p<0.0001), 7p (p=0.0035) and 7q (p=0.0354), and losses in 16q (p=0.0167). Immunohistochemical analyses revealed a higher expression of intestinal markers such as CD10 (p<0.0001) and CDX2 (p=0.0002) and a lower expression of the gastric marker, MUC5AC (p=0.0305) among HP-exposed DGCs. HP-na��ve DGCs, on the other hand, had a purely gastric marker phenotype. This work reveals that HP-na��ve and HP-exposed DGCs develop along different molecular pathways, which provide a basis for early detection strategies in high incidence settings.

  Study JGAS000575

• CDK4/6 inhibition in advanced chordoma: final results of the NCT PMO-1601

  Background. Chordoma is a rare bone tumor with no approved systemic therapy. Inactivation of the tumor suppressor p16 (encoded by CDKN2A) leads to aberrant cyclin D-CDK4/6-RB pathway activity, which can be inhibited by palbociclib in chordoma cell lines. Patients and Methods. We conducted a phase II single-arm, open-labeled trial on palbociclib in adult patients with advanced chordomas with p16 loss (by immunohistochemistry) or CDKN2A loss (by genomic analysis) and CDK4/6 and RB1 presence (by immunohistochemistry or RNA-Sequencing). Patients received 125mg palbociclib once daily for 21 days in a 28-day cycle. The study used a Simon optimal 2-stage design. The primary endpoint was disease control rate after six cycles. Response was evaluated according to Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1. Secondary endpoints included progression-free survival, overall survival, and biomarker analysis. The study was considered positive if 25% of patients reached the primary endpoint. Results. Between December 2017 and April 2023, 28 patients (median age 60 years, range 31-84) were enrolled. After a median follow-up of 28 months, the disease control rate was 39%, with 11 out of 28 patients achieving stable disease. No objective responses were observed. The median progression-free survival was 5.6 months, and the median overall survival was 24.6 months. Treatment was well tolerated without new safety signals. CDKN2A deletions were the most common genomic alterations underlying p16 loss and were accompanied by MTAP co-deletion. There was no correlation between responder phenotypes by immunohistochemistry and outcome. RNA-based analysis showed heterogeneous pathways deregulation at study entry suggesting underlying primary resistance mechanisms Conclusion. This trial met its primary endpoint with a 39% disease control rate, though antitumor activity was modest. Molecularly tailored combination therapies should be considered to improve efficacy. (ClinicalTrials.gov number, NCT03110744).

  Study EGAS00001007985

• Local In Time Statistics for processual research

  Background: Functional genomics in a processual analysis cover the time-dependent changes in transcriptomics and epigenetics before diagnosis of a disease, reflecting the changes in both life style and disease processes. The aim of this paper is to explore the dynamic, time-dependent mechanisms of the metastatic processes, using blood transcriptomics and including time in a continuous manner. For achieving this goal we develop new statistical methods based on statistics that are local in time. Methods: The new statistical method, Local In Time Statistics (LITS), is based on calculating statistics in moving windows and randomization. The method has been tested for the analysis of a dataset that collectively provides information on the blood transcriptome up to eight years before breast cancer diagnosis. The dataset from the NOWAC Post-genome Cohort consists of 467 case-control pairs matched on birth year and time of blood sampling. The data for a pair is the difference in log2 gene expression between the case and control. The stratified analyses are based on important biological differences like metastatic versus non-metastatic cancer, and the mode of cancer detection, i.e. screening detected versus clinically detected cancers. The dataset was used for examining whether the gene expression profile varies between cases and controls, with time, or between cases with and without metastases. Results: The null hypotheses of no differences between cases and controls, no time-dependent changes, and no differences between different strata were all rejected. For screening detected cancers the probability of correct prediction of metastasis status was best in year 1 before diagnosis compared to year 3 and 4 before diagnosis for clinically detected cancers. The predictor was not very sensitive to the number of genes included.Conclusions: Using a new statistical method, LITS, we have demonstrated time-dependent changes of the blood transcriptome up to eight years before breast cancer diagnosis.

  Study EGAS00001002520

• A Platform Study of Combination Immunotherapy for the Neoadjuvant and Adjuvant Treatment of Patients with Surgically Resectable Adenocarcinoma of the Pancreas

  This is a single-institutional, randomized, open label platform clinical trial testing various immunotherapy combinations. Patients with newly diagnosed and surgically resectable pancreatic ductal adenocarcinoma (PDA) and scheduled to undergo the Whipple procedure at Johns Hopkins Hospital were eligible to participate in this study. Criteria for determining resectability strictly followed National Comprehensive Cancer Network (NCCN) guidelines. The study consisted of 6 parts: parts 1-5 constituted the Prime Phase (see below), and part 6 was the Extended Treatment Phase. Part 1: Participants received one cycle of immunotherapy two weeks prior to undergoing the Whipple procedure. Part 2: Subjects underwent the Whipple procedure. Part 3: Subjects received a second cycle of immunotherapy 4-10 weeks following the Whipple procedure (2-4 weeks prior to adjuvant chemoradiation). Part 4: Subjects underwent chemoradiation. Part 5: Subjects received 4 additional 28-day cycles of immunotherapy beginning 1-2 months after completing chemoradiation for a total of six cycles (two before chemoradiation and 4 following chemoradiation). Eligible subjects were randomized to Arms A and B in a 1:1 ratio, stratified up-front by age (≤65, >65). Arm A participants received Cy/GVAX. Arm B participants received the combination of Cy/GVAX and nivolumab. GVAX Vaccine consists of equal numbers (2.5 x 108 each) of Panc 6.03 pcDNA1GM-CSF and Panc 10.05 pcDNA1GM-CSF combined into a single vaccination. Each vaccination consisted of six total intradermal injections. A single intravenous (IV) dose of 200 mg/m2 Cy (CytoxanR) was given one day prior to GVAX. Anti-PD-1 Therapeutic Antibody Nivolumab 480 mg every 4 weeks was administered as an intravenous infusion. The primary objective for Arms A and B was to compare IL17 expression (Th17) in vaccine-induced lymphoid aggregates between resected PDAs from patients treated with the combination of Cy/GVAX and anti-PD-1 blockade antibody vs. the treatment of Cy/GVAX alone. Secondary objectives were to assess the safety, overall survival (OS), and disease free survival (DFS) of patients treated with each of the study drug combinations, and to assess the effects of each of the immunotherapy study drug combinations on PD-L1/PD-1 associated pathways, vaccine-induced immune regulatory signatures, and peripheral and intratumoral antigen specific T cell responses. The exploratory objective was to explore the effects of therapy on tumor and peripheral blood and tumor infiltrating immune cells, and to explore potential molecular determinants of response, progression and disease stability. To these ends, tumor infiltrating immune cells (TIICs) were obtained from surgically resected tumors following the neoadjuvant treatment of the study immunotherapy. TIICs were sorted into CD3+CD4+ T cells, CD3+CD8+ T cells, CD3-CD19+ B cells, and CD3-CD19-CD11b+ myeloid cells by flow cytometry. The sorted immune cell subtype pellets were sent to the commercial vendor (Eurofins) for RNA extraction and sequencing. SMART-seq v4 Ultra Low Input mRNA Sample Prep Kit was used for library preparation with 100bp paired end reads. FASTQ files, that were returned from the vendor, are deposited here.

  Study phs003002

• Development and Use of Network Infrastructure for High-Throughput GWA Studies

  The "Development and Use of Network Infrastructure for High-Throughput GWA Studies" project is collaboration between Group Health Cooperative (GH), the University of Washington (UW), and the Fred Hutchinson Cancer Research Center (FHCRC). It is one of 5 sites participating in The Electronic Medical Records and Genomics (eMERGE) Network funded by the National Human Genome Research Institute (NHGRI) with additional funding from the National Institute of General Medical Sciences (NIGMS). The overall eMERGE project is designed to assess whether linking biorepositories of patients in healthcare delivery systems with electronic medical records (EMRs) is an efficient strategy for high-throughput genome wide association (GWA) studies and whether information can be pooled across sites. The primary phenotype in the Group Health/UW Aging and Dementia eMERGE study project is dementia. Phenotyped participants originated from four population-based sources. Seattle-area members of GH (a large integrated health care system in Washington State) consented and enrolled in 1) the University of Washington Alzheimer's Disease Patient Registry (ADPR) and 2) the Adult Changes in Thought (ACT) study, 3) Marshfield Clinic Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults, 4) Vanderbilt's BioVU, a de-identified DNA biobank. The ADPR (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is a population-based registry of incident dementia cases designed to identify all new dementia cases within GH from 1987 to 1996. Potential dementia cases were identified through referrals from primary care physicians, mental health services, and neurologists, as well as review of CT scans, neurology, emergency room, geriatrician, and mental health clinic logs, and hospital discharge diagnoses. Medical history, physical, laboratory testing, and neuropsychological testing were performed on all consenting potential cases. These data were reviewed by a consensus conference including a neuropsychologist, study physicians, and an epidemiologist. After discussion of the case, dementia status is assigned using DSM-III-R criteria. Alzheimer's disease status was assigned using the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria. The study base of the ADPR population was stable with an attrition rate of less than 1%/year. The ACT study (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is an ongoing community-based cohort study designed to determine the incidence of Alzheimer's Disease (AD), other types of dementia, and cognitive impairment and to determine risk factors for these conditions. The original cohort of 2,581 was enrolled in 1994-1996. An expansion cohort of 811 was enrolled in 2000-2002. Continuous enrollment to keep 2,000 persons enrolled and at-risk for dementia outcomes was begun in 2005. To date the study has accrued more than 4,000 participants. Dementia-free participants are enrolled in this cohort and evaluated every two years by study personnel with many evaluations including an assessment of cognitive functioning using the Cognitive Abilities Screening Instrument (CASI), which is an extended version of the Mini-Mental State Examination that has been widely used in epidemiological studies of the elderly. Persons with CASI scores lower than 86 or in whom interviewers suspect unusual cognitive decline are followed up with dementia diagnostic evaluations which include physical and neurological examinations and neuropsychological tests. Medical records are reviewed, and laboratory tests and neuroimaging are obtained if not available. The dementia diagnoses and dementia subtypes are determined during a consensus conference attended by the examining clinicians and other study physicians, a neuropsychologist, and research nurse. After discussion of the case, dementia status is assigned using DSM-IV criteria. Alzheimer's disease status was assigned using NINCDS-ADRDA criteria. Individuals diagnosed with dementia are seen again one year following diagnosis using the same procedures. Individuals not diagnosed with dementia are returned to the pool of at-risk individuals and are seen at their next routinely scheduled biennial visit. The ACT sub-sample is stable; for the original cohort, median enrollment in GH was 19 years prior to joining the ACT study, and 85% of the cohort has ≥ 10 years of GH enrollment. DNA for the ADPR participants were obtained through a companion study, Genetic Differences in Cases and Controls (PI: Walter Kukull; NIH/NIA R01 AG007584). DNA obtained through both studies were extracted from blood using Gentra Systems Puregene methods. DNA concentration is determined by UV optical density. All samples are checked for quality by OD 260/280 ratio. For long-term storage, samples are aliquoted and stored at -70°C. The Marshfield study, Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults. PMRP was started in 2002 as a 3 Phase project. Completed in April 2004, the objectives of Phase I were to build and develop a large population-based biobank with DNA, plasma and serum samples to facilitate genomics research. Phase 1 was also to educate, inform and consult with the Marshfield Epidemiologic Study Area population and communities concerning potential studies, create the DNA foundation of the personalized medicine database and build the bioinformatics tools to store securely and analyze genotypic and phenotypic data. Phase I tasks included operation of the ethics and security advisory board, scientific advisory board and community advisory group. More than 18,000 residents aged 18 and above from 19 different zip codes surrounding Marshfield, WI were invited to participate in Phase I. After providing written informed consent, participants completed brief questionnaires that included questions about demographics, some environmental exposures, family history of disease, and adverse drug reactions, as well as family members living in the area. Participants provided 50ml of blood from which DNA was extracted and plasma and serum samples were stored. The informed consent process allowed access to electronic medical records and included language about non-disclosure of personal research results. A tick-off box was included so that participants could either allow or decline subsequent recontact for future research studied. The objectives of Phase II are to create the phenotypic database, establish the scientific and administrative infrastructure to support genetic mapping of the DNA and the initial discovery projects and genotype a sufficient portion of the genetic material to support these discovery projects. The objectives of Phase III are to expand the discovery projects, complete the genotyping of the genetic database and expand physician/health care provider education and community consultation. The Vanderbilt BioVU model uses discarded blood leftover from clinical care and de-identified clinical information, both of which are tracked with a Research Unique Identifier that is permanently disconnected from the medical record number used to generate it. The Vanderbilt IRB determined that the project does not qualify as "human subject" research under §46.102(f)(1)(2). The program has been reviewed by OHRP twice (the latest immediately prior to launch), and the determination of the Vanderbilt IRB that the project is consistent with the 8/10/2004 guidance has been validated. The model includes a simple opt out mechanism developed for patients who do not wish to have their samples included. Planning (including community involvement, ethics and IRB discussions, focus groups, development of operating procedures and pilot studies to assess them) began in May 2004, and the resource commenced sample collection in February 2007 and as of May 2009 contains approximately 56,000 samples. The current resource will be available to all Vanderbilt investigators who sign a Data Use Agreement. The resource represents Vanderbilt's broad patient population and thus provides a potential resource for research in a range of common and rare diseases as well as drug response or medication safety. BioVU patient protection model: There has been extensive involvement by the ethics community and the IRB to put in place procedures to provide privacy protection. The overall protection plan is multifaceted and includes a combination of technology and policy: (1) creation of the SD described above; (2) return of only the specific clinical data items requested by investigators (rather than the complete de-identified chart); (3) submission of any specific proposed project to the IRB and to a separate protocol review committee, both of which must approve; (4) implementing a Data Use Agreement that permits only approved queries and data analyses, specifically prohibits attempts at re-identification (at the risk of institutional sanctions), and mandates redeposit of all genetic information generated in a research study back into a genomic database; and (5) tracking and auditing all use.

  Study phs000234

• Genetic analysis in an inherited cardiac arrhythmia

  To identify a causative gene for an inherited cardiac arrhythmia, exome sequence analysis was conducted in 6 patients and 5 controls.

  Study JGAS000041

• Next Generation Sequencing in an IBD Pedigree Exome Data

  We perform whole exome sequencing on samples from a large IBD pedigree. The selected samples are from more distantly related family members (healthy and with IBD) and a set of matched population (Ashkenazy Jewish ancestry) samples.

  Dataset EGAD00001000422

• Cancer_Cell_Line_Exome_Sequencing_

  Genomic characterisation of a large series of cancer cell lines.

  Study EGAS00001000978

• Breast_cancer_topographs

  Breast cancer topography will be explored using a combination of multi-region whole geome sequencing and in-situ RNA sequencing of fixed tissue specimens.

  Study EGAS00001003698

• Whole exome sequencing of a sinonasal glomangiopericytoma case

  The is dataset includes the whole exome sequencing of the tumor from a sinonasal glomangiopericytoma case together with the matching blood. The whole exome sequencing revealed somatic PIK3CA and CTNNB1 mutations.

  Dataset EGAD00001008291

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line WXS

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009758

• RNA-seq

  Stranded RNA-seq libraries were performed for 150 ng of mRNA using the TruSeq library kit (Illumina, San Diego, CA, USA). Libraries were sequenced on a NextSeq 2000 (Illumina) in a 2x50bp length.

  Dataset EGAD00001010841

• Evaluation of somatic mutations in cervicovaginal samples as a non-invasive method for the detection and molecular classification of endometrial cancer

  Evaluation of somatic mutations in cervicovaginal samples as a non-invasive method for the detection and molecular classification of endometrial cancer

  Dataset EGAD00001011123

• Utility of ctDNA to support patient selection for early phase clinical trials: The TARGET Study

  The TARGET Study consists of 200 BAM files, for the 100 patients discussed in the publication. Each patient has a normal control BAM file and a ctDNA BAM file.

  Dataset EGAD00001004796

• Genomic Landscape of Human Skin at a Single-Cell Resolution

  Every cell in the human body has a unique set of somatic mutations, yet it remains difficult to comprehensively genotype an individual cell. Here, we developed solutions to overcome this obstacle in the context of normal human skin, thus offering the first glimpse into the genomic landscapes of melanocytes at single-cell resolution. We comprehensively genotyped 133 melanocytes from 19 sites across 6 donors. As expected, sun-shielded melanocytes had fewer mutations than sun-exposed melanocytes. However, within sun-exposed sites, melanocytes on chronically sun-exposed skin (e.g. the face) displayed a lower mutation burden than melanocytes on intermittently sun-exposed skin (e.g. the back). Melanocytes from donors with a history of skin cancer had higher mutation burdens than melanocytes from donors without skin cancer, implying that the mutation burden of normal skin can be harnessed to measure cumulative sun damage and skin cancer risk. Moreover, melanocytes from healthy skin commonly harbor pathogenic mutations, likely explaining the origins of the melanomas that arise in the absence of a pre-existing nevus. Phylogenetic analyses identified groups of related melanocytes, suggesting that melanocytes spread throughout skin as fields of clonally related cells, invisible to the naked eye. Overall, our study offers an unprecedented view into the genomic landscapes of individual melanocytes, revealing key insights into the causes and origins of melanoma.

  Study phs001979

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells

  KIR+NKG2A- Natural Killer (NK) cells have the unique ability to detect downregulation of single HLA-I allotypes, frequently occurring in malignantly-transformed and virus-infected cells in order to escape T cell recognition. We have recently shown that circulating Innate Lymphoid Cells 1 (cILC1) have the potential to generate such KIR+NKG2A- NK cells but their developmental origin was unknown. Here we demonstrate that the development of cILC1 is thymus-dependent and identify a putative progenitor of cILC1s in the thymus, called thyILC1. Single-cell RNAseq analysis revealed a close relationship of thyILC1s to CD34+ double-negative (DN) thymocytes, but in contrast to DNs, thyILC1s had lost T cell differentiation potential. However, like cILC1s they could be efficiently differentiated into KIR+NKG2A- NK cells. thyILC1s strongly expressed RAG1/2, PTCRA (preTCR, and NOTCH1/3, but lacked expression of TCR chains, suggesting that they failed to pass the -selection checkpoint of thymocyte development. Finally, analyses of patients with FOXN1het deficiency, showing thymic hypoplasia due to lack of mature thymic epithelial cells, exhibited a profound deficiency of cILC1s but not cILC2s and cILC3s, demonstrating thymus dependency of cILC1s. Together, the data suggest that thyILC1s are the source of a novel thymus-dependent NK cell differentiation pathway that promotes generation of KIR+NKG2A- NK cells.

  Study EGAS50000000760

• DUX4 activates novel intergenic transcripts and isoforms in a tissue-specific context

  DUX4, a transcription factor driving zygotic genome activation during the embryonic cleavage stage in mammals, regulates the expression of genic and non-genic elements and modulates chromatin accessibility. Its misexpression in skeletal muscle causes Facioscapulohumeral muscular dystrophy (FSHD). The sporadic expression of DUX4 in FSHD muscle and the limitations of short-read RNA sequencing challenge, however, a comprehensive grasp of its consequences on the muscle transcriptome. Here, leveraging full-length isoform RNA sequencing with short-read RNA sequencing on DUX4-inducible myoblasts, we elucidated DUX4-induced transcriptomic changes within a myogenic context. DUX4 yields a complex transcriptome featuring numerous unannotated isoforms from known and novel loci. Moreover, we observed distinct isoform usage of DUX4 target genes between myogenic and embryonic cleavage states highlighting the distinct differences between DUX4 transcription factor activity in skeletal muscle and during the cleavage stage. We also identified ~1,400 unannotated intergenic isoforms predominantly originating from repetitive elements such as LTRs, LINEs, and SINEs. Integration with available datasets delineates the transcriptional and epigenetic landscape of these loci across myogenic and embryonic backgrounds. Like the cell type-specific isoform production, the usage of DUX4 binding sites at these intergenic loci is in part cell type-specific. Collectively, these findings demonstrate substantial and context-specific transcriptomic alterations induced by DUX4 further enriching our understanding of DUX4-induced muscle pathology.

  Study EGAS50000000503

• Personalized peptide vaccination among 173 patients with IDH wildtype glioblastoma: a retrospective analysis

  Tumors from 173 GBM patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Exome libraries for 173 glioblastoma tumors and matched normal DNA were sequenced on Illumina platform, alongside whole transcriptomes from the tumor samples. Paper Abstract: Current treatment outcome of patients with glioblastoma (GBM) remains poor. Following standard therapy, recurrence is universal with limited survival. GBM tumors from 173 patients were analysed for somatic mutations to generate a personalized peptide vaccine targeting tumor-specific neoantigens. Among all patients, including 70 treated prior to progression (primary) and 103 treated after progression (recurrent), the median overall survival from first diagnosis was 31.9 months (95% CI: 25.0-36.5). Side effects were infrequent and were predominantly grade 1 or 2. A vaccine-induced immune response to at least one of the vaccinated peptides was detected in blood samples of 87 of 99 (88%) monitored patients. T-cell responses to vaccinated neoepitope peptides were durable in most patients. Significantly prolonged survival was observed for patients with multiple vaccine-induced immune responses (53 months) compared to those with no/low induced responses (27 months; P=0.03). Altogether, our results highlight that the application of personalized neoantigen-targeting peptide vaccine is feasible and represents a promising potential treatment option for GBM patients.

  Study EGAS50000000449

• Mid-pass Whole-genome Sequencing in a Malagasy Cohort Uncovers Body Composition Associations

  The majority of human genomic research studies have been conducted in European-ancestry cohorts, reducing the likelihood of detecting potentially novel and globally impactful findings. Here, we present mid-pass whole-genome sequencing data and a genome-wide association study in a cohort of 264 self-reported Malagasy individuals from three locations on the island of Madagascar. We describe genetic variation in this Malagasy cohort, providing insight into the shared and unique patterns of genetic variation across the island. We observe phenotypic variation by location, and find high rates of hypertension particularly in the Southern Highlands sampling site as well as elevated self-reported malaria prevalence in the West Coast site relative to other sites. After filtering to a subset of 214 minimally-related individuals, we find a number of genetic associations with body composition traits, including many variants that are only observed in African populations or populations with admixed African ancestry from the 1000 Genomes Project. This study highlights the importance of including diverse populations in genomic research for the potential to gain novel insights, even with small cohort sizes. This project was conducted in partnership and consultation with local stakeholders in Madagascar and serves as an example of genomic research that prioritizes community engagement and that has potential impacts on our understanding of human health and disease.

  Study EGAS50000000496

• A comprehensive DNA methylation landscape of human and mouse cell lines derived from hematological malignancies

  Human cancer cell lines constitute useful models to study the primary disease and many relevant findings in tumor biology have been originated from them since the first immortalized cell line (HeLa) was obtained. The easy experimental intervention, the purity of the transformed cells and their versatility to undergo high-throughput screenings represent advantageous features of the established cancer cell lines. In recent years, major efforts have characterized in detail the multiomics make-up of hundreds of cancer cell lines and studied their association with sensitivity to anticancer drugs. Most of these studies have been genetic-centric and have not characterized in detail the epigenetic profiles underlying the characteristics of these cells or their impact on the efficacy of antitumoral compounds. In this regard, a past version of a DNA methylation microarray or a less accessible and more time-consuming such as reduced representation bisulfite sequencing have been used in those attempts to interrogate the epigenetic setting. Herein, we have obtained the DNA methylation profiles of 210 cell lines derived from hematological malignancies utilizing comprehensive DNA methylation microarrays that interrogates more than 850,000 and 285,000 CpG sites from human and mouse genomes, respectively. Importantly, we also provide a pharmacoepigenetic example of the potential use of this resource by showing how DNA methylation can predict response to nucleoside analogues.

  Study EGAS50000000627

• A thymic ILC1-like progenitor with differentiation potential towards KIR+NKG2A- NK cells - sc

  KIR+NKG2A- Natural Killer (NK) cells have the unique ability to detect downregulation of single HLA-I allotypes, frequently occurring in malignantly-transformed and virus-infected cells in order to escape T cell recognition. We have recently shown that circulating Innate Lymphoid Cells 1 (cILC1) have the potential to generate such KIR+NKG2A- NK cells but their developmental origin was unknown. Here we demonstrate that the development of cILC1 is thymus-dependent and identify a putative progenitor of cILC1s in the thymus, called thyILC1. Single-cell RNAseq analysis revealed a close relationship of thyILC1s to CD34+ double-negative (DN) thymocytes, but in contrast to DNs, thyILC1s had lost T cell differentiation potential. However, like cILC1s they could be efficiently differentiated into KIR+NKG2A- NK cells. thyILC1s strongly expressed RAG1/2, PTCRA (preTCR, and NOTCH1/3, but lacked expression of TCR chains, suggesting that they failed to pass the -selection checkpoint of thymocyte development. Finally, analyses of patients with FOXN1het deficiency, showing thymic hypoplasia due to lack of mature thymic epithelial cells, exhibited a profound deficiency of cILC1s but not cILC2s and cILC3s, demonstrating thymus dependency of cILC1s. Together, the data suggest that thyILC1s are the source of a novel thymus-dependent NK cell differentiation pathway that promotes generation of KIR+NKG2A- NK cells.

  Study EGAS50000000790

• A Cancer Cell-Line Titration Series for Evaluating Somatic Classification

  Accurate detection of somatic single nucleotide variants and small insertions and deletions from DNA sequencing experiments of tumour-normal pairs is a challenging task. Tumour samples are often contaminated with normal cells confounding the available evidence for the somatic variants. Furthermore, tumours are heterogeneous so sub-clonal variants are observed at reduced allele frequencies. We present here a cell-line titration series dataset that can be used to evaluate somatic variant calling pipelines with the goal of reliably calling true somatic mutations at low allele frequencies. Cell-line DNA was mixed with matched normal DNA at 8 different ratios to generate samples with known tumour cellularities, and exome sequenced on Illumina HiSeq to depths of >300x. The data was processed with several different variant calling pipelines and verification experiments were performed to assay >1,500 somatic variant candidates using Ion Torrent PGM as an orthogonal technology. By examining the variants called at varying cellularities and depths of coverage, we show that the best performing pipelines are able to maintain a high level of precision at any cellularity. In addition, we estimate the number of true somatic variants undetected as cellularity and coverage decrease. Our cell-line titration series dataset, along with the associated verification results, is effective for this evaluation and will serve as a valuable dataset for future somatic calling algorithm development.

  Study EGAS00001001016

• What is metadata?

  What is metadata? Data represents units of information and metadata can be seen, simply put, as data about other data. For example, in a simple experiment in which a patient genome was sequenced, there are multiple and diverse fields of metadata: from the biological sex of the patient to the sequencing platform used. Another way to understand metadata, following our genomic experiment example, is going through the different layers of (meta)data: One of the basic units of information (data) would be the sequence of nucleotides (e.g. GCTGG and GCCGG). This DNA sequence can be contextualised within a chromosome by providing its locus (e.g. β-globin gene). This data, the locus, is about other data, the sequence of nucleotides, which would render it metadata. We can go one step further, and provide more context, by giving the associated phenotype of each of these sequences: GCTGG corresponds to a healthy individual, while GCCGG corresponds to a person with β-thalassaemia. Once again, this data is contextualising the data we have provided up to this point, which makes it metadata. With this simple example, what we are doing is adding layers of data that describe the ones below. Had we given the sequences alone, little would be possible from the researchers' point of view. But, now that the data has its accompanying metadata, a researcher could compare both sequences and their phenotypes to infer a possible cause of the disorder. Each layer of information broadens the possible applications of the data. Now that we know what metadata is, it is time to emphasise the importance of submitting good quality metadata. The quality of the metadata will determine whether the data is usable, discoverable, and interpretable by researchers and clinicians. One example that highlights the importance of good quality metadata is the description of biological sex of a patient: while the terms "female," "girl," or "woman" all represent the same concept, they are not harmonised. These different representations of a concept can create confusion and errors in data analysis. By applying standard definitions and terminologies to biological sex metadata, we can avoid misunderstandings and facilitate the integration of different datasets.  In order to comply with the FAIR principles and, more specifically, to allow for the (meta)data to be interoperable (i.e. used universally and unambiguously), we need to place some standards onto the (meta)data EGA  archives. These can be as simple as asserting that the given patient's biological sex is one of the correct terms (e.g. female or male); or as complex as multiple layers and combinations of validation steps with existing records. You can find further details on how EGA manages these standards on our metadata model page.

  Documentation submission/metadata/what-is-metadata

• Double mutant DNMT3A AML: a unique subtype

  Mutation of DNMT3A, encoding a de novo methyltransferase essential for cytosine methylation, is a common early event in clonal hematopoiesis (CH) and adult acute myeloid leukemia (AML). Spontaneous deamination of methylated cytosines damages DNA, which is repaired by the base excision repair (BER) enzymes MBD4 and TDG. Congenital MBD4-deficiency has been linked to early-onset CH and AML, and is marked by exceedingly high levels of DNA damage and mutation of DNMT3A. Strikingly, wildtype (WT) DNMT3A binds TDG, thereby potentiating its repair activity. Since TDG is the only remaining BER enzyme in MBD4-deficient AML patients capable of repairing methylation damage, we investigated whether mutant DNMT3A negatively affects the repair function of TDG. We found that, whereas WT DNMT3A stimulates TDG function, mutant DNMT3A impairs TDG-mediated repair of DNA damage in vitro. In light of this finding and to extrapolate our observations to the broader AML patient population, we investigate here the genetic profiles and survival outcomes of AML patients with single (SM) versus double mutant (DM) DNMT3A. DM DNMT3A AML patients show a characteristic driver mutation landscape and reduced overall survival when compared to SM DNMT3A AML patients. Importantly, whole-genome sequencing showed a trend for increased DNA damage in primary DM DNMT3A AML samples, especially when DNMT3A mutations are located at the DNMT3A-TDG interaction interface.

  Study EGAS00001007966

• GoT2D: Genetics of Type 2 Diabetes, a study of the the genetic architecture of type 2 diabetes using low pass whole genome sequencing and high density SNP genotyping in 2,657 individuals.

  The Genetics of Type 2 Diabetes Consortium (GoT2D) is a collaboration between the University of Michigan, the Broad Institute and the Wellcome Trust Centre for Human Genetics. The overall aim is to extend upon recent efforts, such as genome-wide association studies (GWAS) and large scale meta-analyses. While they have proved successful at mapping genomic loci that influence human diseases, like type 2 diabetes, much of the heritability remains unexplained. In this study, we use next generation sequencing and genotyping technologies to query for lower frequency variants in the human genome. Thereby, allowing a deeper characterization of the spectrum of alleles associated with type 2 diabetes risk, and a better assessment of the genes that play a role in the etiology of type 2 diabetes development. We studied 1,326 T2D cases and 1,331 normoglycemic controls from Northern and Central Europe (Sweden, Finland, UK, and Germany). To efficiently characterize the entire genome sequence of each individual, we performed low-coverage (~5x) whole-genome sequencing, augmented by deep coverage (~100x) sequencing of the exome, and dense (2.5M) single nucleotide polymorphism (SNP) genotyping using the HumanOmni2.5 array. The data deposited in EGA will include all the Swedish, Finnish, UK, and German samples.

  Study EGAS00001001459

• Glioblastoma epigenome profiling identifies SOX10 as a master regulator of molecular tumour subtype

  Glioblastoma in adult patients are classified into four subtypes, IDH, MES, RTK I, and RTK II, based on DNA methylation and RNA expression data. Tumour subtype transitions commonly occur during the treatment of glioblastoma patients, and transitions to the mesenchymal (MES) subtype have been associated with therapy resistance and adverse prognosis. Here, we generate DNA methylome and histone modification data of glioblastoma primary tumours and show that glioblastoma subtypes differ by their enhancer landscapes. Using Core Regulatory Circuitry analysis of H3K27ac data, and independent analysis of RNA-derived gene regulatory networks, we identified 38 subtype master regulators whose cell type-specific activities we mapped in single-cell RNA sequencing data. These analyses identified the chromatin modifier SRY-Box 10 (SOX10) as a master regulator in tumours of the RTK I subtype. In functional studies we demonstrate that SOX10 loss causes a transition of RTK I tumour cells to a mesenchymal cellular state by altering the accessibility of enhancer-rich chromatin regions and their occupancy by Bromodomain Containing 4 (BRD4), a dynamic constituent of super-enhancers. Treatment with the BRD4 inhibitor JQ1 blocked this transition. These data demonstrate the fundamental role of enhancer chromatin remodelling and master regulator activity in the establishment, maintenance and plasticity of glioblastoma cellular states. We also make our data publically browsable at https://dkfz-b060.github.io/gb_browse/

  Study EGAS00001003953

• Genome-Wide Association Study of Anorexia Nervosa (Price Foundation, Klarman Family Foundation, Center for Applied Genomics at the Children's Hospital of Philadelphia, Scripps Translational Sciences Institute Clinical Translational Science Award)

  Twin studies are consistent with substantial heritability in anorexia nervosa (AN), although detecting and confirming individual risk alleles has been difficult, due to small effects of single alleles and limited samples in prior studies. Methods: 1105 AN DNA samples obtained in a multisite study and 3733 pediatric patients of normal body weight were genotyped using the Illumina 610Q chip at The Center for Applied Genomics at The Children's Hospital of Philadelphia. Cases and controls were of European ancestry. Single nucleotide polymorphism (SNP) genotypes were subjected to quality control procedures, including elimination of SNPs with: call rates < 95%, minor allele frequency < 5%, and if Hardy-Weinberg equilibrium testing yielded p < 0.0001. Samples were removed if not of European ancestry or if showing cryptic relatedness. Eight AN DNA samples were deleted for low call rate, and 51 AN samples were deleted for cryptic relatedness. The statistical program, PLINK, was used to calculate a P value for each SNP passing quality control using the Cochran-Armitage trend test. The PennCNV program was used to define copy number variation (CNV). Results: We performed a genome-wide association study (GWAS) using with 1033 AN cases and 3733 controls (genomic inflation factor = 1.08). There were 11 SNPs with P<1X10-5 [(rsID, chromosome location, nearest gene, distance to nearest gene (base-pair), P value) rs6959888, 7q21.13, ZNF804B, 0, 1.63E-06; rs17725255, 20p11.23, CSRP2BP, 39396, 1.72E-06; rs10494067, 1p13.3, NTNG1, 0, 5.83E-06; rs2383378, 14q12, AKAP6, 0, 6.41E-06; rs410644, 5q14.1, SSBP2, 40462, 6.74E-06; rs4479806, 5p14.1, CDH9, 156926, 7.79E-06; rs957788, 13q33.3, FAM155A, 0, 8.11E-06; rs830998, 2q31.1, LRP2, 0, 8.68E-06; rs6782029, 3p25.3, VGLL4, 0, 9.04E-06; rs512089, 9p21.3, ELAVL2, 47984, 9.85E-06; rs3808986, 11q24.3, APLP2, 29217, 9.92E-6]. CNV analyses were performed on 1015 AN cases and 3532 controls. Overall frequencies of common or rare CNVs were similar between cases and controls. Specific rare and large (>500 kb, <1%) CNVs of interest included deletion of a large (~1.4Mbp) region of chr13q12 found in 2 AN samples and at a 10 fold lower frequency in a large sample (72,918) of subjects containing the genes SGCG, SACS, TNFRSF19, MIPEP, PCOTH, C1QTNF9B, SPATA13, MIR2276, and C1QTNF9, and an overlapping deletion and a duplication observed in 3 AN samples overlapping the CNTN6 and CNTN4 genes. Partially overlapping ~ 30 kb duplications were seen in 12 AN cases and in 1 control at the CDC5L gene on chromosome 6. Partially overlapping deletion of the 3' half of the PSTPIP1 gene was seen in 5 AN cases and no controls. Finally, a ~ 60 kb deletion of the PLEC1 gene was observed in 5 AN cases and in none of 3532 controls. Discussion: This is the first GWAS of AN. These preliminary results are consistent with absence of a major gene effect in AN. These results are consistent with genetic risk conveyed by multiple common alleles of small effect, as well as some uncommon CNVs of potentially larger effect. None of the implicated genes has a clear role in eating behavior. It must be emphasized that these results are preliminary and an additional ~ 400 AN cases will be analyzed as time and resources permit. These results require confirmation through study of independent populations of AN women.

  Study phs000679

• CIDR, NCI, NIDA Sequencing of Targeted Genomic Regions Associated with Smoking

  This study includes samples from two projects: Collaborative Genetic Study of Nicotine Dependence (COGEND; PI: Laura Bierut) and Genetic Study of Nicotine Dependence in African Americans (AAND; PI: Laura Bierut and Eric Johnson). The majority of the COGEND subjects included in the current study overlap with the two datasets already available on dbGaP. GWAS data are available for COGEND subjects through the Study of Addiction: Genetics and Environment (SAGE), dbGaP study accession phs000092. It should be noted that the case definition in the SAGE study is DSM-IV alcohol dependence. GWAS data are available for additional COGEND subjects through The Genetic Architecture of Smoking and Smoking Cessation, dbGaP study accession phs000404. The overall goal of this project is to apply deep sequencing to key genomic regions associated with nicotine dependence in order to accelerate the discovery of variation in molecular pathways that govern the development of nicotine dependence. The sample includes unrelated cases and controls of European American and African American descent. Cases are defined by a commonly used definition of nicotine dependence, a current score of 4 or more (maximum score of 10) on the Fagerstrom Test for Nicotine Dependence (FTND). Control status is defined as an individual who smoked at least 100 cigarettes during their lifetime, yet never became dependent (lifetime FTND<2). By selecting controls who smoked cigarettes, we focus on those genetic effects that are specific to the development of nicotine dependence. COGEND: COGEND was initiated in 2001 as a three-part program project grant funded through the National Cancer Institute (NCI; PI: Laura Bierut). The three projects included a study of the familial transmission of nicotine dependence, a genetic study of nicotine dependence, and a study of the relationship of nicotine dependence with nicotine metabolism. The primary goal was to detect, localize, and characterize genes that predispose or protect an individual with respect to heavy tobacco consumption, nicotine dependence, and related phenotypes and to integrate these findings with the family transmission and nicotine metabolism findings. The primary design was a community based case-control study. Nicotine dependent cases and non-dependent, smoking controls were identified and recruited from Detroit and St. Louis. More than 54,000 subjects aged 25-44 years were screened by telephone; more than 3,100 subjects were personally interviewed; and more than 2,900 subjects donated blood samples for genetic studies. AAND: AAND was initiated in 2009 to identify and characterize genetic determinants of nicotine dependence in a large African American population. Community-based recruitment of approximately 100,000 people was conducted to ascertain 1,000 African American nicotine dependent cases and 1,000 African American non-dependent, smoking controls. All subjects were between the ages of 25-44. Subjects were screened by telephone; if they qualified as a case or control, they completed the same interview that was used in COGEND and donated a blood sample. Both studies (COGEND and AAND) included measures of basic socio-demographic variables, including age, sex, race/ethnicity, family income, and educational attainment using the Semi-Structured Assessment for the Genetics of Nicotine Dependence. Information on nicotine dependence, as assessed by the Fagerstrom Test for Nicotine Dependence (FTND) is available for all subjects. In addition, participants also completed the Nicotine Dependence Syndrome Scale (NDSS; Shiffman et al., 2004) and the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68; Piper et al, 2004). All subjects were assessed in person by trained research assistants.

  Study phs000813

• National Cancer Institute (NCI) Adding Hispanics to Ongoing GWAS in Colorectal Cancer

  Genome-wide association studies (GWAS) of colorectal cancer (CRC) have been instrumental in identifying a number of common susceptibility loci in Non Hispanic (NH)-White populations, and a NCI priority is to extend GWAS findings to other populations to address racial/ethnic disparities in cancer susceptibility. Currently, GWA studies of CRC in NH-Whites, Japanese and African-Americans are ongoing. We propose a complementary study to address this critical research area in Hispanics. Hispanics represent the fastest growing ethnic population in the U.S. and have been largely understudied in terms of genetic susceptibility to cancer. There are noted differences in incidence, survival and mortality in CRC by ethnic/racial groups. Hispanics often present with CRC at a younger age and have a significantly greater incidence of stage IV tumors or metastatic disease compared to NH-Whites. We propose to conduct a large, cost-efficient, population-based GWAS in Hispanics by building upon existing NIH-funded resources, the Colon Cancer Family Registry (Colon CFR) and the Multiethnic Cohort Study (MEC). We plan to recruit 2,500 Hispanic men and women diagnosed with CRC between 01/2008 to present using cancer registries in California, physican referrals and familial referrals. Risk factor/diet questionnaires, pathology reports, Oragene saliva samples (for genotyping), optional blood samples (for genotyping and biometric analysis) and tumor blocks (for MSI testing) will be collected using methodologies developed in the Colon CFR/MEC. Cases of CRC in the MEC (currently 473; anticipated 600 at end) will also be included. Population-based Hispanic individuals without a diagnosis of CRC participating in other GWA studies in the MEC (n=3,900, U01HG004726, Haiman) will be used as controls. We will genotype all 3,100 cases using the Illumina 1M array and use available genotype and epidemiologic data collected on 3,900 controls. Our statistical analyses will include: single-SNP and haplotype effects, gene-environment interactions and heterogeneity by MSI, tumor subtype and family history of CRC. We will replicate findings in a second-stage using CRC cases and controls from Mexico (1,000 cases and 1,000 controls, EU FP7 funding, CHIBCHA, Carvajal-Carmona/Tomlinson). We will also examine heterogeneity of the risk estimates by ethnicity/race by leveraging GWA data on NH-Whites (2,142 cases, 1,909 controls, U01 CA122839, Casey), (4,000 cases, 6,000 NH-White controls, UK-CHIBCHA, Tomlinson), Colombians (2,000 cases and 2,000 controls, CHIBCHA), Japanese (1,000 cases and 1,000 controls) and African-Americans (1,500 cases and 1,500 controls, R01CA126895, Le Marchand). We will genotype replicated significant SNPs in our main and combined analysis in several Hispanic populations (note: studies funded by EU or NIH for data collection but not GWAS), including 800 Puerto Ricans, 2,000 Brazilians, 2,000 Argentineans and 3,000 Spanish/Portuguese, to assess generalizability of findings. We will examine the differences in inflammatory gene transcription dynamics in leukocytes (from blood sample collection) by fatigue level (as assessed from study questionnaire data). This study will have a high impact by addressing the key question of racial/ethnic disparities related to genetic susceptibility to CRC, will provide translational guidelines on biological mechanisms during the cancer survivorship period to increase quality of life among cancer survivors, and will enable further growth and investment into research among Hispanics by providing a resource of genetic data and biospecimens, which is lacking.

  Study phs001193

• Acute Respiratory Distress Network (ARDSNet) Studies 01 and 03 Lower Versus Higher Tidal Volume, Ketoconazole Treatment and Lisofylline Treatment (ARMA/KARMA/LARMA) (ARDSNet-ARMA/KARMA/LARMA-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Biospecimens Access to Biospecimens is through the NHLBI Biologic Specimen and Data Repository Information Coordinating Center (BioLINCC). Biospecimens from ARDSNet-ARMA/KARMA/LARMA include plasma, serum and urine. Please note that use of biospecimens in genetic research is subject to a tiered consent. Objectives The ARDS Network is a consortium of clinical centers and a coordinating center to design and test novel therapies for the treatment of Acute Lung Injury (ALI) and Acute Respiratory Distress Syndrome (ARDS). The primary objective of the KARMA trial was to investigate the efficacy and safety of Ketoconazole and Respiratory Management in the treatment of ALI and ARDS. The Ketoconazole arm of the study was later stopped due to an inability to show efficacy. Participants continued to be randomized to the respiratory management arms of the study (ARMA), which compared two ventilator strategies: a tidal volume of 6 mL/kg versus 12 mL/kg. The LARMA phase of the study investigated the efficacy of Lisofylline and Respiratory Management. Background Participants suffering from ARDS are extremely ill, require mechanical ventilation and, despite improvements in medical care and technology, had a mortality rate as high as 50 percent. An excessive inflammatory response is characteristic of ALI of which ARDS represents the most severe end of the pathophysiologic spectrum. The inflammatory response includes increased numbers of neutrophils activated to produce cytokines, proteases, and reactive oxygen intermediates. Pulmonary injury may also be enhanced by alveolar and tissue macrophages as a producer of vasoactive substances, neutrophil chemoattractants, and procoagulant substances. Ketoconazole, a synthetic antifungal imidazole, also has anti-inflammatory activities and may inhibit neutrophil recruitment via several different pathways known to be involved in the development of ALI and ARDS. Lisofylline causes a marked decrease in the circulating levels of the major oxidizable species of free fatty acids and also inhibits proinflammatory intracellular signaling. Mechanical ventilation in participants with ALI and ARDS have traditionally used tidal volumes of 10 to 15 ml per kilogram of body weight. These large tidal volumes are often necessary to achieve normal partial pressure of arterial carbon dioxide and pH, but may induce inflammatory responses through disruption of pulmonary epithelium and endothelium. Mechanical ventilation at lower tidal volumes may reduce injurious lung stretch and decrease the inflammatory response. Participants The Ketoconazole and Lisofylline trials were designed as 2 x 2 factorials and included 220 participants in each trial. A total of 860 participants were randomized into the ventilator management trial. Participants enrolled in the Lisofylline or Ketoconozole studies had to be concurrently enrolled in the ventilator management study and were first randomized into a ventilator strategy and then to drug or placebo. Conclusions Ketoconazole was found to be safe but did not reduce mortality, duration of mechanical ventilation, or improve lung function. Lisofylline was also found to be safe and to have no beneficial effect for participants with ALI or ARDS. Ventilation at lower tidal volumes resulted in reduced mortality and an increase in the number of days without ventilator support. (PMIDs: 10789668, 11902249, 10793162).

  Study phs003734

• Study on the Genetics of Alcoholism (COGA): African American Family GWAS

  COGA is a family study of alcoholism, in which the subjects have been drawn from the Collaborative Study on the Genetics of Alcoholism (COGA), a large, ongoing family-based study that includes subjects from seven sites around the US. COGA has gathered detailed, standardized data on study participants, including diagnostic and neurophysiological assessments. This project has already proved successful in identifying several genes that influence the risk for alcoholism and neurophysiological endophenotypes, which have been independently replicated. COGA data were included as part of two Genetic Analysis Workshops, and the phenotypes are familiar to the genetics community. Alcoholic probands were recruited from treatment facilities, assessed by personal interview, and after securing permission, other family members were also assessed. A set of comparison families was drawn from the same communities as the families recruited through an alcoholic proband. Assessment involved a detailed personal interview developed for this project, the Semi-Structured Assessment for the Genetics of Alcoholism (SSAGA), which gathers detailed information on alcoholism related symptoms along with other drugs and psychiatric symptoms. Many participants also came to the laboratories for electroencephalographic studies. Neurophysiological features that have been shown to be useful endophenotypes for which we have linkage and in some cases association results are included on a subset of the case-control sample: the beta power of the resting electroencephalogram (EEG), the P3(00) amplitude of the visual event-related potential (ERP), and the theta and delta event-related oscillations (EROs) underlying the P3. As part of COGA, a set of informative African American families were selected to have Genome-Wide Association data obtained within families. Genotyping was performed using the Illumina Omni2.5_080814_1 chip to genotype 3,438 subjects selected from densely affected families. Genotyping was performed at CIDR. This sample complements a set of densely affected European American families previously made available under dbGaP study accession phs000763. In addition, exome sequencing data on a subset of individuals with GWAS were added in version 2.For version 3, a subset had 30X Whole Genome Sequencing (WGS) as part of the NIDA Sequencing Initiative. The subset contained two distinct sets: Sibling pairs where one sibling had at least two dependence diagnoses in the set (alcohol, cannabis, cocaine, and opioid), and the other had none, and non-related Case-Control pairs matched for age and ethnicity where the cases had alcohol and at least 2 other dependence diagnoses and controls had none. After sequencing, some sibling pairs are re-classified as half siblings, Three VCF files (small variants, structural variants, and copy number variations) are provided. Additional substance abuse variables are made available in version 3. We note that the full sample data are deposited in four dbGaP submissions and the sequenced samples are split across all four: CIDR: Collaborative Study on the Genetics of Alcoholism Case Control Study (phs000125). GWAS data on cases (primarily probands) and controls drawn from the families. Families with highest density of alcohol dependence and/or extreme event-related oscillation data (phs000763). GWAS data on 119 extended families of European descent are available here, along with extensive documentation. Study on the Genetics of Alcoholism (COGA): African American Family GWAS (phs000976). GWAS data on all available COGA families of African descent are available. COGA: Smokescreen GWAS (phs001208). GWAS data on all remaining COGA DNA samples, primarily of other racial background, were genotyped on the Smoke Screen array. A listing of all sequenced pairs is provided in the documentation to facilitate the merging of these samples.

  Study phs000976

• Knoll et al.: The life-saving benefit of dexamethasone in severe COVID-19 is linked to a reversal of monocyte dysregulation

  Following the demonstration of its life-saving effect in clinical trials, dexamethasone quickly became standard-of-care in the treatment of severe COVID-19. Beneficial effects were reported for patients requiring supplemental oxygen or invasive mechanical ventilation. Yet, a substantial proportion of patients still progressed to a critical condition or succumbed to the disease, despite timely initiation of glucocorticoid treatment. No molecular or cellular correlate of this beneficial treatment response has been defined. Here, we identify distinct cellular and molecular changes in circulating immune cells in patients with COVID-19 elicited in response to dexamethasone treatment. The most profound transcriptional changes in response to dexamethasone treatment were noted in monocytes and in B cells. In monocytes, we observed a reversal of hallmark signatures previously associated with COVID-19 severity, and the induction of a specific monocyte substate enriched in glucocorticoid response gene expression which we here refer to as dexamethasone response cluster. Molecular responses to dexamethasone treatment were directly linked to clinical outcome, since the reversal of pathogenic signatures and induction of glucocorticoid response genes were enriched in patients who survived the disease in response to dexamethasone treatment. Cellular responsiveness of circulating monocytes was thus identified as a correlate of clinical response to dexamethasone treatment. Changes in monocyte transcriptomes could also be linked to epigenetic alterations highlighting early differences in monocytes of dexamethasone responders and non-responders. Further, monocyte single-cell transcriptome-derived signatures were enriched in whole blood transcriptomes from patients with fatal outcome in two independent cohorts, highlighting the potential clinical value for early identification of non-responders who are refractory to dexamethasone treatment. Overall, our findings indicate that the life-saving effects of dexamethasone in COVID-19 patients are linked to a specific immunomodulatory effect based on the reversion of monocyte dysregulation. Our study elucidates the potential mechanism of action of one of the most efficient and cost-effective drugs for the treatment of COVID-19. It further highlights the potential of single-cell omics for monitoring target engagement of immunomodulatory drugs and for the stratification of patients for precision medicine approaches.

  Study EGAS00001007461

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - RNAseq

  Ependymomas (EPN) are the third most common malignant brain cancer in children. Treatment strategies for pediatric EPN have remained unchanged over recent decades, with 10-year survival rates stagnating at just 67% for children aged 0-14 years. Moreover, patients who survive treatment for the most common subtype of pediatric EPN (posterior fossa A (PFA)), often suffer long-term neurological side effects as a result of therapy. It is evident that there is a need for safer, more effective treatments for pediatric EPN patients. There are ten distinct subgroups of EPN, each with their own molecular and prognostic features. To identify and facilitate the testing of new treatments for EPN, in vivo laboratory models representative of the diverse molecular subtypes are required. Here, we describe the establishment of a patient-derived orthotopic xenograft (PDOX) model of PFA EPN, derived from a metastatic cranial lesion. Patient and PDOX tumors were analyzed using immunohistochemistry, DNA methylation profiling, whole genome sequencing (WGS) and RNA sequencing. Both patient and PDOX tumors classified as PFA EPN by methylation profiling, and shared similar histological features consistent with this molecular subgroup. RNA sequencing revealed that gene expression patterns were maintained across the primary and metastatic tumors, as well as the PDOX. Copy number profiling revealed gains of chromosomes 7, 8 and 19, and loss of chromosomes 2q and 6q in the PDOX and matched patient tumor. No clinically significant single nucleotide variants were identified, consistent with the low mutation rates observed in PFA EPN. Overexpression of EZHIP RNA and protein, a common feature of PFA EPN, was also observed. Despite the aggressive nature of the tumor in the patient, this PDOX was unable to be maintained past two passages in vivo. Others who have successfully developed PDOX models report some of the lowest success rates for EPN compared to other pediatric brain cancer types attempted, with loss of tumorigenicity not uncommon, highlighting the challenge in propagating these tumors in the laboratory. Here, we discuss our collective experiences with PFA EPN PDOX model generation and propose potential approaches to improve future success in establishing preclinical EPN models

  Study EGAS00001006844

• Characterization_of_individual_foci_of_multicentric_multifocal_breast_cancer_using_targeted_next_generation_sequencing

  Multifocality or multicentricity in breast cancer may be defined as the presence of two or more tumor foci within a single quadrant of the breast or within different quadrants of the same breast, respectively. This original classification of the breast cancer as multicentric or multifocal was based on the assumption that cancers arising in the same quadrant were more likely to arise from the same ductal structures than those occurring in separate areas of the breast. The problem with these definitions is that the “quadrants” of the breast are arbitrary external designations, as no internal boundaries do exist. This project will therefore focus both on synchronous multifocal and multicentric tumors. The incidence of multifocal and multicentric breast cancers was reported to be between 13 and 75% depending on the definition used, the extent of the pathologic sampling of the breast and whether in situ disease is considered evidence of multicentricity (1). Although this incidence is variable, those figures show that it is a frequent phenomenon. Multiple (multifocal/multicentric) breast carcinomas, especially when occurring in the same breast, represent a real challenge for both pathologists and clinicians in terms of identifying the cellular origin and the best therapeutic management of the cancer. Multifocality or multicentricity has been associated with a number of more aggressive features including an increased rate of regional lymph node metastases and adverse patient outcome when compared with unifocal tumors (2-3), and a possible increased risk of local recurrence following breast conserving surgery (4). For the moment, the literature is divided on whether there is a corresponding impact on survival outcomes. Today, the current convention to stage and to treat multifocal and multicentric tumors is the classical tumor-node-metastasis (TNM) staging guidelines with which tumor size is assessed by the largest tumor focus without taking other foci of disease into consideration. If some papers, as the recent one from Lynch and colleagues, support the current staging convention (3), others, however, as Boyages et al. suggested that aggregate size and not the size of the largest lesion should be considered in order to refine the prognostic assessment of those tumors (5). On the top of that, the question whether multifocal/multicentric carcinomas are due to the spread of a single carcinoma throughout the breast or is due to multiple carcinomas arising simultaneously has been a matter of debate. Some studies suggested that multifocal breast cancer may result from either intramammary spread from a single primary tumor or multiple synchronous primary tumors; whereas others suggest that multiple breast carcinomas always arise from the same clone (6-8). Recently, Pietri and colleagues analyzed the biological characterization of a series of 113 multifocal/multicentric breast cancers (8) which were diagnosed over a 5-year period. The expression of estrogen (ER) and progesterone (PgR) receptors, Ki-67 proliferative index, expression of HER2 and tumor grading were prospectively determined in each tumor focus, and mismatches among foci were recorded. Mismatches in ER status were present in 5 (4.4%) cases and PgR in 18 (15.9%) cases. Mismatches in tumor grading were present in 21 cases (18.6%), proliferative index (Ki-67) in 17 (15%) cases and HER2 status in 11 (9.7%) cases. Interestingly, this heterogeneity among foci has led to 14 (12.4%) patients receiving different adjuvant treatments compared with what would have been indicated if we had only taken into account the biologic status of the primary tumor. This study therefore showed that differences in biological characteristics of multifocal/multicentric lesions play a crucial role in the adjuvant treatment decision making process. In this study, we will concentrate on a larger series of patients with multifocal invasive ductal breast cancer lesions. We aim at: 1. Evaluating the incidence of multifocality according to the different breast cancer molecular subtypes (ER-/HER2-, HER2+, ER+/HER2-). 2. Evaluating the incidence of multifocality in patients with hereditary breast cancer disease (presence of germline BRCA1 or BRCA2 mutations). Moreover, we would like to investigate if multifocal lesions with BRCA1 or BRCA2 mutations exhibit a characteristic combination of substitution mutation signatures and a distinctive profile of deletions as demonstrated recently by Nik-Zainal and colleagues (9). 3. Correlating multifocality with clinical information in order to define its influence on patients’ survival (DFS and OS). 4. Carrying high coverage targeted gene sequencing of driver cancer genes and genes whose mutation is of therapeutic importance in order to compare clinically-relevant genetic differences between several multifocal breast cancer lesions. 5. Evaluating the impact of the distance between the different lesions on the clinical outcome but also on the genetic differences. 6. Comparing gene expression patterns between several multifocal breast cancer lesions and correlate them with the results of the targeted genes screen. 7. Characterizing the genomic and transcriptomic status of cancer related genes in metastatic lesions (local recurrence, positive lymph node or distant metastatic sites) from the same multifocal invasive ductal breast cancer patients in order to evaluate the consequence of genomic and transcriptomic heterogeneity of multifocal lesions on metastatic lesions. Multiple (multifocal/multicentric) breast carcinomas, especially when occurring in the same breast, represent a real challenge for both pathologists and clinicians in terms of identifying the cellular origin and the best therapeutic choice. This project has the potential to identify genetic/transcriptomic differences existing between several lesions constituting multifocal breast cancers, which in the routine clinical practice are usually considered to be homogeneous among them. We foresee validating significant results in a larger series of patients and this, in turn, could have a remarkable impact on the treatment and clinical management of multifocal breast cancers. Indeed, we hope to provide some evidence whether or not each focus matters in multifocal and multicentric breast cancer to define the adequate therapeutic approach, especially in the context of targeted therapies. The work to be done at Sanger will be target gene screen pooling of 1400 samples.

  Study EGAS00001000407

• Study of Melanoma Risk in Australia and the United Kingdom

  The results from a small number of melanoma GWAS have been published. Initial studies identified several pigmentation- and nevus-associated loci that mediate an effect on melanoma risk, however, these studies were somewhat limited in that sample number (hence power) was low, they used first-generation low density SNP arrays, or used pools of DNA samples. Subsequently, additional melanoma GWAS have been completed, including a "Phase 2" study by the International Melanoma Genetics Consortium (GenoMEL), a full GWAS of the Australian sample resource previously used in a pooled-DNA GWAS, and study conducted through the MD Anderson Cancer Center and the Brigham and Women's Hospital. The groups who performed these studies have recently shared data and replicated a number of new melanoma susceptibility loci. Aside from the identification of novel loci, there are two additional notable outcomes of these studies. Firstly, an examination of the observed versus expected test statistics (Q-Q plot) from the Australian study, even after removing data from SNPs within known replicated susceptibility loci, reveals that there remains an excess of positive results. Similarly, the latest GenoMEL study finds almost three times as many SNPs reaching p-values between 10-4 and 10-5 as would be expected by chance. In the light of other studies of complex traits [1], these data suggest that studies based on additional melanoma samples from the same population are likely to identify an even larger "polygenic tail" and should prove invaluable in identifying and characterizing the underlying loci. A second observation, is that the effect size for replicated associations differs very little between GWAS. Given the strong effect of ultraviolet radiation (UVR) on risk of melanoma this might be expected to affect penetrance, particularly in the Australian and English samples, which are ethnically similar, but have very different sun exposures. We hypothesize that those SNPs whose effects are strongly mediated by UVR exposure may have smaller marginal effects on risk and are therefore harder to detect initially, suggesting a whole category of genetic effects that are unexplored.Indeed, most melanoma GWAS performed to date used samples from both European and Australian populations in discovery and or replication, and thus, existing studies have been poorly powered to detect associations with a wide difference in effect between these low- and high-UVR populations. Here, we wish to pursue this hypothesis further and plan to genotype additional cases drawn from the English and Australian populations. This will serve two complementary objectives: firstly, it will greatly increase our collective power to detect additional new melanoma risk alleles; secondly, it will highlight associations that are stronger specifically within the context of either low-UVR or high-UVR exposure environments. We posit that these data will be invaluable, not just for identifying novel melanoma-associated loci, but also for addressing gene-environment interactions. We have available a collection of valuable resources to help fulfill our aims. These include a considerable number of well-characterized and ungenotyped Australian and UK melanoma cases, as well as existing genotype data from sets of Australian and UK cases and population-based controls. We propose the following Specific Aims: To extend our current collective melanoma GWAS by genotyping a large number of additional UK and Australian cases. To jointly analyze these data and identify new melanoma risk loci. To determine whether pre-existing and new melanoma risk alleles show different degrees of association between the English and Australian populations, and assess whether these differences might be due to differences in sunlight exposure.

  Study phs000519

• Genome-Wide Association Study of Breast Cancer in the African Diaspora - the ROOT study

  The paucity of data on the genetic epidemiology of breast cancer for racial/ethnic groups other than those of European ancestry hinders the development of innovative interventions to reduce health disparities. Women in the African Diaspora experience a disproportionate burden of pre-menopausal breast cancer in comparison to all other races for reasons that remain unknown and understudied. This higher proportion of early-onset breast cancer might suggest a stronger genetic component in these populations. Genome-wide association studies (GWAS) have revealed several genetic loci that confer risk of breast cancer. Because all GWAS started the discovery stage in women of European ancestry and replicated mainly in women of European ancestry, we propose a novel approach for a GWAS in indigenous African women to identify alleles associated with breast cancer risk which will then be replicated in other populations. This innovative design builds on our current understanding of the etiologic heterogeneity in breast cancer and the distribution of breast cancer molecular subtypes which differ between women of African ancestry and women of European ancestry. The major objective of the proposed studies is to get to the "root" causes of breast cancer by identifying breast cancer risk alleles in a pooled sample of women of African ancestry and to replicate our findings in other populations. To achieve this objective, we conducted a case control study of breast cancer in women of African ancestry, including Africans living in Nigeria, African Americans and African Barbadians. We will genotype ~3800 individuals using the Illumina HumanOmni2.5-Quad platform. We will conduct both standard and novel genetic analyses of the data to map genes associated with breast cancer susceptibility, verify genotyping and carry out fine-mapping studies in genes or regions showing association with breast cancer risk, and replicate in other African American and non-African American populations. By pooling unique resources from studies throughout the African Diaspora, this study has the potential to identify risk alleles in several genes that contribute to increased breast cancer risk and may have implications for early detection, prognosis and treatment of breast cancer in ALL women. This should ultimately lead to improved outcomes for those who suffer a disproportionate burden of early-onset breast cancer.

  Study phs000383

• Foregut Microbiome in Development of Esophageal Adenocarcinoma

  The distal esophagus is an important anatomical area where gastric acid reflux can cause reflux esophagitis (RE), Barrett's esophagus (BE) (intestinal metaplasia), and esophageal adenocarcinoma (EA). The incidence of EA has increased 6-fold in the U.S. since the 1970s, parallel to a significant increase in the prevalence of gastroesophageal reflux diseases (GERD). Although specific host factors might predispose one to disease risk, such a rapid increase in incidence must be predominantly environmental. The cause remains unknown. Our hypothesis is that changes in the foregut microbiome are associated with EA and its precursors, RE and BE in the GERD sequence. We will conduct a case control study to characterize the microbiome in every stage of the GERD sequence as well as analyze the trend in changes in the microbiome along disease progression toward EA. Specific Aim 1. To conduct a comprehensive population survey of the foregut microbiome and demonstrate its association with GERD sequence, by a 16S rRNA gene survey. We will analyze samples of the foregut microbiome at three anatomic loci: mouth, distal esophagus, and gastric corpus. Changes of the microbiota in the distal esophagus will be correlated with the phenotypes. Spatial relationship between the esophageal microbiota and upstream (mouth) and downstream (stomach) foregut microbiotas as well as temporal stability of the microbiome-disease association will also be examined. Specific Aim 2. To define distal esophageal metagenome and demonstrate its association with GERD sequence, by shotgun metagenomic analysis. We will first classify samples of the metagenome into metagenotypes by between-sample k-mer distance and correlate the metagenotypes with the four phenotypes. Subsequent detailed analyses will include pathway-disease and gene-disease associations. DNA viruses and fungi, if identified, also will be correlated with the phenotypes. A significant association between the foregut microbiome composition and GERD sequence, if demonstrated, will be the first step for eventually testing the causal hypothesis that an abnormal microbiome is required for the development of the sequence of phenotypic changes toward EA. If EA and its precursors represent a microbial ecological disease, treating the cause of GERD might become possible, for example, by normalizing the microbiome through use of antibiotics, probiotics, or prebiotics. Causative therapy for GERD could prevent its progression and reverse the current trend of increasing incidence of EA.

  Study phs000260

• Kids First: The Genomic Basis of Structural Birth Defects Associated with Chromosome 18 Copy Number Changes

  Chromosome abnormalities are a common cause of structural birth defects. Both childhood cancers and structural birth defects are critical and costly conditions associated with substantial morbidity and mortality. Elucidating the underlying genetic etiology of these diseases has the potential to profoundly improve preventative measures, diagnostics, and therapeutic interventions.However, because these genomic copy number changes involve multiple genes and because most of these conditions are individually rare, defining the specific causative genes behind specific phenotypes has been a challenge. We met that challenge by spending the last 28 years enrolling and evaluating anyone with a chromosome 18 abnormality. The cohort now includes over 700 individuals with a wide variety of chromosome 18 copy number changes (CNV), as well as their parents. Because the vast majority of these participants have individually unique CNVs, we have been able to perform extensive genotype-phenotype correlations resulting in 58 publications. Of the 263 genes on chromosome 18, 28 are linked to specific hemizygous phenotypes. However, most have low penetrance. Genomic sequence data could identify variants in the extant allele that are hypermorphic and compensate for hemizygosity, or are hypomorphic and exacerbate hemizygosity. Additionally, there are phenotypes within this cohort that are rare, or an extreme version of one of the more common phenotypes. Genomic sequence data could help discover new biallelic conditions by revealing functional sequence variants of the extant allele. In both of these cases, there could also be variants in other genes on other chromosomes that may be associated with the phenotype that confer susceptibility or resilience. Inclusion of this unique cohort in the Gabriella Miller Kids First Pediatric Research Program can advance the goals of the program in several ways. First, by adding known susceptibility loci to the existing Kids First cohorts for the structural birth defects that are also found in our cohort. Second, for those structural birth defects known to be polygenetic, this cohort has a single defined risk factor which can simplify the search for secondary factors. Third, these studies can also bring clarity to people with chromosome 18 conditions and help to make the genotype more accurately predict phenotype. This approach could be a model for understanding the many other rare chromosome abnormalities which collectively are a common cause of structural birth defects.

  Study phs002627

• Immune-Related Adverse Events after Immune Checkpoint Blockade-Based Therapy are Associated with Improved Survival in Advanced Sarcoma

  Immune activation after immune checkpoint blockade (ICB) can lead to a unique group of adverse events (AEs), which have been associated with improved outcome in many carcinomas. The association between immune-related AEs (irAEs) and outcome in patients with sarcoma is not well studied. This study has two components: (1) a retrospective clinical study of irAEs among 131 patients treated with ICB at Memorial Sloan Kettering Cancer Center and (2) an analysis of a subset of these patients who have whole transcriptome sequencing available for analysis. In the clinical study portion, we reviewed a cohort of patients with advanced sarcoma treated on prospective clinical trials utilizing ICB-based therapy between April 2017 and January 2020. The objectives were to pool the safety data from each trial, identify irAEs, and correlate them with best overall response by RECIST 1.1, progression-free survival (PFS) and overall survival (OS). Association of irAEs with response and survival was assessed using a Cox regression model. A total of 131 patients were included. Forty-two (32%) had at least one irAE of any grade and 16 (12%) had at least one Grade ≥ 3 irAE. On Cox analysis adjusting for clinical covariates that were significant in the univariate setting, the hazard ratio (HR) for an irAE (HR 0.662, 95% CI 0.421 - 1.041) approached, but did not reach statistical significance for PFS (P = 0.074), while patients had a significantly lower HR for OS (HR 0.443, 95% CI 0.246 – 0.798; P = 0.007) compared to those without or before an irAE. Tumor samples with available RNA sequencing data were stratified by presence of an irAE to identify patterns of differential gene expression. In total, 71 unique patients had RNA sequencing available for analysis. The transcriptomes of 31 of these patients have been previously uploaded to dbGaP (phs002852), leaving 36 unique transcriptomes that have not been previously publicly shared. Three patients did not agree for their sequencing to be publicly shared. Therefore, 33 unique patient samples will be uploaded to this dbGaP study. Overall, this study found that gene expression profiling on baseline tumor samples from patients who had an irAE had higher numbers of tumor-infiltrating dendritic cells, CD8+ T cells, and regulatory T cells as well as upregulation of immune and inflammatory pathways.

  Study phs003284

• Whole Blood Transcriptomics of Patients With Melioidosis

  Melioidosis is a neglected tropical infection caused by the Gram negative bacterium Burkholderia pseudomallei that is associated with high mortality rates in southeast Asia. The goal of this study was to a) identify human blood leukocyte transcriptomic features and pathways specific to melioidosis (vs other etiologies of infection), b) identify transcriptomic features and pathways specific to fatal melioidosis, and c) identify transcriptomic predictors of death in patients with melioidosis. This study used clinical data and whole blood leukocyte samples from a subset of participants in the Ubon Sepsis Study, a prospective single-center cohort study conducted at Sunpasitthiprasong Hospital, Ubon Ratchathani, Thailand between 2013 and 2017. Participants in the Ubon Sepsis Study had suspected or documented infection with accompanying systemic manifestations of infection and were enrolled, with blood sampling, within 24 hours of admission to the study hospital. Enrolled patients were followed over time and vital status was determined at 28 days after enrollment. The subset of participants from the parent Ubon Sepsis Study cohort selected for this study was comprised of 164 patients with melioidosis (defined as having a culture of clinical sample positive for B. pseudomallei), 35 patients with Gram negative bacteremia due to either Escherichia coli or Klebsiella pneumoniae, 16 patients with Gram positive bacteremia due to Staphylococcus aureus, and 19 patients who had negative blood cultures and no clinical sample culture-positive for B. pseudomallei. Fifty uninfected control patients with or without diabetes were recruited from the outpatient department and blood donation center at Udon Thani hospital, Udon Thani, Thailand from 2018 to 2019. Blood was collected at the time of enrollment in Tempus Blood RNA tubes. RNA was extracted using the Tempus Spin RNA Isolation kit. RNA sequencing (RNA-Seq) was performed at the University of Washington Northwest Genomics Center. Analysis was performed using a variety of statistical methods. The main finding of the study was that the transcriptomes of melioidosis patients, compared to patients with other infections, were characterized by upregulation of interferon signaling. The transcriptomes of patients with fatal melioidosis were notable for upregulation of inflammatory and type 2 immune responses and downregulation of genes related to T-cell function. A five-gene (EPHB1, SYCP2L, MERTK, IL5RA, and SPOCK1) predictive signature for death in melioidosis was developed.

  Study phs003724

• Kids First: Genetics of Pediatric Germ Cell Tumors

  The Gabriella Miller Kids First Pediatric Research Program (Kids First) is a trans-NIH effort initiated in response to the 2014 Gabriella Miller Kids First Research Act and supported by the NIH Common Fund. This program focuses on gene discovery in pediatric cancers and structural birth defects and the development of the Gabriella Miller Kids First Pediatric Data Resource (Kids First Data Resource). All of the genomic and phenotypic data from this study are accessible through dbGaP. The data is also available at the Kids First Portal, where other Kids First datasets can also be accessed in the cloud for data analysis, data visualization, collaboration and interoperability, open to all researchers and developers.Pediatric malignant germ cell tumors (GCTs) represent approximately 6% of childhood cancers, including 3% of tumors in children aged 0-14 years and 15% of tumors in adolescents. GCTs are heterogeneous and grouped together due to the presumed common cell of origin, the primordial germ cell (PGC). GCTs typically occur in the testes or ovaries; however, extragonadal GCTs can occur and are likely a result of abnormal germ cell migration during development. Evidence suggests that GCTs, including those diagnosed in adults, are initiated in utero. Thus, alterations in normal embryonic development are likely to be especially relevant to GCT etiology. Germline susceptibility has not been evaluated in an agnostic fashion in pediatric GCT, mainly due to a lack of an adequate number of samples; however, emerging evidence supports a genetic etiology.In the two Kids First GCT projects, we will evaluate genetic susceptibility to intracranial and extracranial GCT by sequencing probands and their unaffected parents. The goals of the project are to: 1) evaluate the contribution of rare genetic variants in GCT through the use of aggregate burden tests, focusing on genes and established regulatory regions; 2) identify de novo SNVs and CNVs in pediatric GCT using a case-parent triad design; and 3) identify molecular signatures in GCT tumor specimens, overall and by age group and tumor characteristics. Whole Genome Sequencing (WGS) data generated through the Gabriella Miller Kids First Pediatric Research Program will provide an opportunity to investigate the genetic origins of GCT in a diverse set of samples. Given the limited knowledge of GCT etiology and biology, the results of the proposed analyses are likely to have a big impact on the field.

  Study phs002322

• CRCbiome: Gut metagenome of Norwegian screening participants using FIT sampling

  The study aims to characterize the gut metagenome of Norwegian screening participants and assess the ability of the gut metagenome to identify those at need for colonoscopy. Background: Colorectal cancer (CRC) screening reduces CRC incidence and mortality. However, current screening methods are either hampered by invasiveness or suboptimal performance, limiting their effectiveness as primary screening methods. To aid in the development of a non-invasive screening test with improved sensitivity and specificity, we have initiated a prospective biomarker study (CRCbiome), nested within a large randomized CRC screening trial in Norway. We aim to develop a microbiome-based classification algorithm to identify advanced colorectal lesions in screening participants testing positive for an immunochemical fecal occult blood test (FIT). We will also examine interactions with host factors, diet, lifestyle and prescription drugs. The prospective nature of the study also enables the analysis of changes in the gut microbiome following the removal of precancerous lesions. Methods: The CRCbiome study recruits participants enrolled in the Bowel Cancer Screening in Norway (BCSN) study, a randomized trial initiated in 2012 comparing once-only sigmoidoscopy to repeated biennial FIT, where women and men aged 50–74 years at study entry are invited to participate. Since 2017, participants randomized to FIT screening with a positive test result have been invited to join the CRCbiome study. Self-reported diet, lifestyle and demographic data are collected prior to colonoscopy after the positive FIT-test (baseline). Screening data, including colonoscopy findings are obtained from the BCSN database. Fecal samples for gut microbiome analyses are collected both before and 2 and 12 months after colonoscopy. Samples are analyzed using metagenome sequencing, with taxonomy profiles, and gene and pathway content as primary measures. CRCbiome data will also be linked to national registries to obtain information on prescription histories and cancer relevant outcomes occurring during the 10 year follow-up period. Discussion: The CRCbiome study will increase our understanding of how the gut microbiome, in combination with lifestyle and environmental factors, influences the early stages of colorectal carcinogenesis. This knowledge will be crucial to develop microbiome-based screening tools for CRC. By evaluating biomarker performance in a screening setting, using samples from the target population, the generalizability of the findings to future screening cohorts is likely to be high.

  Study EGAS50000000170

• Sensitive and robust liquid biopsy-based detection of PIK3CA mutations

  Over the last years, the treatment of hormone receptor-positive metastatic breast cancer patients has dramatically changed. Combination strategies attempting to overcome resistance to endocrine therapy such as targeting the PI3 kinase pathway are gaining importance. The phase III SOLAR-1 trial demonstrated the benefit of the addition of alpelisib to fulvestrant, thereby providing further clinical evidence of the increasing importance of PIK3CA testing. Here, we performed a comparison of liquid biopsy and tissue-based detection of PIK3CA mutations in HR-positive metastatic breast cancer patients. Plasma samples and the latest available tumor tissue from 69 patients with metastatic hormone-receptor positive breast cancer were analyzed for PIK3CA hotspot mutations. A high-resolution NGS assay (SiMSen-Seq) was used for plasma samples covering 11 recurrent PIK3CA mutations, used for stratification in SOLAR-1. Additionally, mFAST-SeqS was used to estimate the tumor fractions in the plasma samples. For tumor tissue samples, targeted Ion Torrent NGS was employed. Matched tissue and plasma samples were available from 63 patients. PIK3CA mutations were detected in 46.1% of the tissue samples and in 50.7% of the plasma samples. The variant allele frequency (VAF) ranged from 4.36% to 72.93% with a median of 28.60% in tissue samples, and from 0.28% to 49.85% with a median of 1.17% in plasma samples. The most frequent variants in tissue and plasma were H1047R, E545K, and E542K. We detected at least one of 11 PIK3CA mutations from the SOLAR-1 trial in 51/63 patients, both in tissue and plasma. In 7 patients, such mutations were found only in plasma. In 5 patients, PIK3CA mutations found in tissue were not detectable in ctDNA, 2 of which had a low tumor fraction.Together, in 33/67 plasma samples without detectable PIK3CA mutations, 18 samples had elevated tumor fraction, implicating true negative results. In the remaining 15 patients with low tumor fraction, additional tissue analysis was needed. SiMSen-Seq-based detection of PIK3CA mutations in plasma shows advantageous concordance with the tissue analyses. A combination with an untargeted, mutation-independent approach for detecting ctDNA fractions may confirm a negative PIK3CA result and thereby enhance the performance of the SiMSen-Seq test. This combinatory approach for selecting suitable patients for alpelisib treatment should be validated in larger patient cohorts.

  Study EGAS00001004940

• Molecular_characterization_of_invasive_lobular_carcinoma

  Invasive lobular carcinoma (ILC) is the second most common histological subtype of breast cancer accounting for 10-15% of cases. ILC differs from invasive ductal carcinoma (IDC)with respect to epidemiology, histology, and clinical presentation. Moreover, ILC is lesssensitive to chemotherapy, more frequently bilateral, and more prone to form gastrointestinal, peritoneal, and ovarian metastases than IDCs. In contrast to IDC, the prognostic value ofhistological grade (HG) in ILC is controversial. One of the three major components of histological grading (tubule formation) is missing in ILC which hinders the process of gradingin this histological subtype and results in the classification of approximately two thirds of ILC as HG 2.Over the last decade, a number of gene expression signatures have shed light onto breast cancer classification, allowing breast cancer care to become more personalized. Withrespect to the management of estrogen receptor (ER)-positive breast cancer, several gene expression signatures provide prognostic and/or predictive information beyond what is possible with current classical clinico-pathological parameters alone. Nevertheless, most studies using gene expression signature have not considered different histologic subtypesseparately. Recently, a comprehensive research program has elucidated some of the biological underpinnings of invasive lobular carcinoma. Genetic material extracted from 200 ILC tumor samples were studied using gene expression profiling and identified ILCmolecular subtypes. These proliferation-driven gene signatures of ILC appear to have prognostic significance. In particular, the Genomic Grade (GG) gene signature improved upon HG in ILC and added prognostic value to classic clinico-pathologic factors. In addition this study demonstrated that most ILC are molecularly characterized as luminal-A (~75%)followed by luminal-B (~20%) and HER2-positve tumors (~5%). Moreover, we investigated the prognostic value of known gene signatures/ gene modules in the same cohort of ILC. As a second step within the scope of this project, we aim to investigate the interactionsbetween somatic ILC tumor mutations to observed transcriptome findings. To this end, we aim to perform somatic mutation analysis for the ILC tumors for which Affymetrix gene expression profiling is available. To this end, we will use a gene screen assay, which specifically interrogates the mutational status of a few hundreds of cancer genes. We believe that this pioneering effort will be fundamental for a tailored treatment of ILC withimprovement in patients' outcome.

  Study EGAS00001000292

• Multi-omics data of 1000 Inflammatory Bowel Disease patients

  Portal available at https://1000ibd.org Inflammatory bowel disease (IBD) is a chronic complex disease of the gastrointestinal (GI) tract. Patients with IBD can experience a wide range of symptoms, but the pathophysiological mechanisms that cause these individual differences in clinical presentation remain largely unknown. In consequence, IBD is currently classified into subtypes using clinical characteristics. If we are to develop a more targeted treatment approach, molecular subtypes of IBD need to be discovered that can be used as new drug targets. To achieve this, we need multiple layers of molecular data are generated from the same IBD patients.We initiated the 1000IBD project to prospectively follow more than 1000 IBD patients from the Northern provinces of the Netherlands. For these patients, we have collected a uniquely large number of phenotypes and generated multi-omics profiles. To date, 1,215 participants have been enrolled in the project and enrolment is on-going, with 609 patients being present in the first data release. Phenotype data collected for these participants includes information on dietary and environmental factors, drug responses, and adverse drug events. Genome information has been generated using genotyping (ImmunoChip, Global Screening Array and HumanExomeChip) and sequencing (whole exome sequencing and targeted resequencing of IBD susceptibility loci), transcriptome information generated using RNA-sequencing of intestinal biopsies and microbiome information generated using both sequencing of the 16S rRNA gene and whole genome shotgun metagenomic sequencing.All molecular data generated within the 1000IBD project will be shared in multiple data on the European Genome-Phenome Archive (www.ega-archive.org). The first data release, will contain basic phenotypes for 609 participants, genotypes of 314 participants, gut microbiome data generated by tag sequencing the 16S gene of feces from 315 participants and intestinal biopsies from 107 participants, and gut microbiome metagenomic sequencing of feces of 355 participants . Future releases will comprise many more additional phenotypes and -omics data layers. 1000IBD data can be used by other researchers as a replication cohort, a dataset to test new software tools, or a dataset for applying new statistical models.

  Study EGAS00001002702

• Defective Homologous Recombination DNA Repair as Therapeutic Target in Advanced-Stage Chordoma (HIPO_021)

  HIPO project: HIPO_021 Importance: Chordomas are rare tumors of the axial skeleton and skull base with few therapeutic options and no clinically validated molecular drug targets. The value of comprehensive genomic analyses for guiding medical therapy of patients with advanced-stage chordoma is unknown.Objective: To identify therapeutically tractable genetic lesions in a cohort of chordoma patients within a genomics-guided precision oncology program and to document the outcome of individualized, molecularly targeted chordoma therapy.Design, Setting, and Participants: We performed whole-exome sequencing of tumor and matched germline control samples from seven patients with locally advanced or metastatic chordoma who were enrolled in a cross-institutional molecular stratification registry trial for younger adults with advanced-stage cancer across all histologies and patients with rare tumors. All patients were heavily pretreated and had progressive disease prior to molecular analysis.Interventions: Individualized medical therapy was administered according to the patients’ molecular profiles.Main Outcomes and Measures: Candidate therapeutic targets identified by whole-exome sequencing and response to genotype-directed therapy.Results: All patients harbored alterations of two or more genes known to be involved in DNA repair via homologous recombination (HR), including heterozygous deletions of ERCC6, FANC family members, RAD51L (n = 6), BRCA2 (n = 5), ATR, CHEK2, RAD18, RAD51B, and XRCC3 (n = 4); inactivating PTEN mutations coupled with loss of heterozygosity (n = 2); and pathogenic germline variants in BRCA2 (n = 1), NBN (n = 1), and CHEK2 (n = 1) that were accompanied by somatic deletion of the corresponding wild-type alleles. Consistently, a mutational signature associated with defective HR was enriched in all samples and co-occurred with extensive genomic instability, as evidenced by HR deficiency scores and high numbers of large-scale state transitions. These results prompted off-label treatment with the poly(ADP-ribose) polymerase (PARP) inhibitor olaparib in a patient whose tumor was refractory to irradiation and systemic treatment with imatinib, which led to a prolonged response and substantial clinical improvement.Conclusions and Relevance: Advanced-stage chordomas are frequently characterized by genomic imprints of defective HR DNA repair. HR deficiency represents a new therapeutic opportunity in this intractable disease through repositioning of PARP inhibitors that warrants further exploration in clinical trials.

  Study EGAS00001002720

• NHLBI TOPMed: Defining the Time-Dependent Genetic and Transcriptomic Responses to Cardiac Injury Among Patients with Arrhythmias

  The UMMS miRhythm Study is an ongoing study of adult patients undergoing an elective electrophysiology study or arrhythmia ablation procedure for a supraventricular or ventricular arrhythmia, including atrial fibrillation (AF). Atrial fibrillation is a major clinical and public health problem that is related to atrial pathologic remodeling. Few tools are available to quantify the activity or extent of this remodeling, rendering it difficult to identify individuals at risk for AF. Previous studies have suggested an important role for miRNA in cardiovascular disease through gene expression regulation, making this a promising avenue for studying AF mechanisms. The aim of the study is to determine the time-dependent changes to key circulating miRNAs in a model of planned atrial injury and remodeling via ablation. Such knowledge might provide additional insight into the biology and activity of the acute atrial injury response, and furthermore, inform new targets for development of preventative interventions or allow for better AF risk stratification. To assess pathways regulating atrial pathological remodeling, patient blood samples are collected prior to their ablation procedures and also at a regularly scheduled 1-month follow-up appointment. Plasma expression of miRNA is measured using high-throughput quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), providing novel insights into the regulatory processes underlying AF, as well as acute atrial injury in vivo. Additionally, data collected from whole-genome sequencing (WGS) is used to supplement miRNA analyses and further explore new relations between genes and abnormal heart rhythm.

  Study phs001434

• Breast Cancer Family Registry

  The Breast Cancer Family Registry (BCFR) is a multi-center prospective cohort, comprised of over 30,000 women and men from nearly 12,000 families from the United States, Canada, and Australia. Our BCFR resource has been used, and continues to be used, by breast cancer researchers around the world in order to find new ways to prevent, diagnose, and treat cancer. The BCFR provides an extensive and diverse range of resources, expertise, and specialized skills, and has several unique strengths: 1) the collection of a large number of individuals and families across a wide spectrum of breast cancer risk, including both affected and unaffected individuals; 2) the large collection of families with early-onset breast cancer; 3) the large collection of racial/ethnic minority families not replicated elsewhere; 4) the extensive molecular characterization performed to date; and 5) active follow-up of both probands and family members. Thus, the BCFR comprises a unique cohort of probands and family members at familial/genetic risk of breast cancer that will continue to facilitate a wide range of research studies, such as gene discovery, examination of cancer-related outcomes and risk factors in high-risk subjects, investigation of novel behavioral interventions, and cancer prevention trials among at-risk family members. Consequently, the BCFR Cohort, as one of the few cohorts available worldwide with biospecimens and extensive molecular and genetic characterization, combined with epidemiologic data and long-term follow up, will be an invaluable resource for translational research in the genetic epidemiology of breast cancer.

  Study phs002835