10984 results for "monedas ultimate team FC 26 Visité Buyfc26coins.com. Servicio premium a un precio estándar. Increíble..XLis"

in 51.90 milliseconds.

• Whole Tumor spatial heterogeneity in metastatic melanoma

  Heterogeneous inter-tumoral responses, sustained periods of apparent clinical benefit despite lack of objective response to various therapies, and even spontaneous remission are well known within a subpopulation of advanced melanoma patients. The molecular and cellular dynamics facilitating long-term survival remain poorly defined, particularly in the current era ofexposure to multiple potentially active therapies. We studied an exceptional case of long-term survival in a patient with non-responding metastatic melanoma in order to characterize the clonal and microenvironmental factors.We performed immunogenomic analysis of 3 metachronous tumors, and of 67 intratumor sub-regions of one metastatic lesion, usingwhole exome sequencing, RNA-sequencing, immunohistochemistry, and T cell receptor sequencing. Longitudinal analysesidentified mutations in severalknownresistance genes affecting distinctmetastases. Intra-tumoral immune signatures revealed spatially-distinct pockets of immune activation and suppression throughout the metastasis. A specific T cell VBeta CDR3 rearrangement was identified as both dominant and recurrent not only across multiple spatial points within a single tumor mass, but also across metachronous tumors spanning the patient’s disease course. Immunophenotyping of this T cell population with single-cell sequencingsuggestedrepeatedT-cell priming events leading to the persistence of both activated and exhausted T cells bearing this same TCR-Beta at any given time.Our findings highlight genomic and immune heterogeneityin metastatic disease, extending to the intra-tumoral leveland provide a rationale for integrative spatiotemporal analysis of metastatic lesions in the context of immune checkpoint blockade.

  Study EGAS00001003292

• Atypical 3q26/MECOM rearrangements genocopy inv(3)/t(3;3) in acute myeloid leukemia

  Acute myeloid leukemia (AML) with inv(3)/t(3;3)(q21q26) is a distinct WHO recognized entity, characterized by its aggressive course and poor prognosis. In this subtype of AML, the translocation of a GATA2 enhancer (3q21) to MECOM (3q26) results in overexpression of the MECOM isoform EVI1 and monoallelic expression of GATA2 from the unaffected allele. The full-length MECOM transcript, MDS1-EVI1, is not expressed as the result of the 3q26 rearrangement. Besides the classical inv(3)/t(3;3), a number of other 3q26/MECOM rearrangements with poor treatment response have been reported in AML. Here we demonstrate, in a group of 33 AML patients with atypical 3q26 rearrangements, MECOM involvement with EVI1 overexpression, but no or low MDS1-EVI1 levels. Moreover, the 3q26 translocations in these AML patients often involve super-enhancers of genes active in myeloid development (e.g. CD164, PROM1, CDK6 or MYC). In more than 50% of these cases allele specific GATA2 expression was observed, either by copy number loss or by an unexplained allelic imbalance. Altogether, atypical 3q26 recapitulate the main leukemic mechanism of inv(3)/t(3;3) AML, namely EVI1 overexpression driven by enhancer hijacking, absent MDS1-EVI1 expression and potential GATA2 involvement. Therefore, we conclude that both atypical 3q26/MECOM and inv(3)/t(3;3) can be classified as a single entity of 3q26-rearranged AMLs. Routine analyses determining MECOM rearrangements, EVI1 and MDS1-EVI1 expression are required to recognize 3q-rearranged AML cases.

  Study EGAS00001004325

• Partner-independent fusion gene detection by multiplexed CRISPR/Cas9 enrichment and long-read Nanopore sequencing

  Fusion genes are hallmarks of various cancer types and important determinants for diagnosis, prognosis and treatment possibilities. The promiscuity of fusion genes with respect to partner choice and exact breakpoint-positions restricts their detection in the diagnostic setting, even for known and recurrent fusion gene configurations. To accurately identify these gene fusions in an unbiased manner, we developed FUDGE: a FUsion gene Detection assay from Gene Enrichment. FUDGE couples target-selected and strand-specific CRISPR/Cas9 activity for enrichment and detection of fusion gene drivers (e.g. BRAF, EWSR1, KMT2A/MLL) - without prior knowledge of fusion partner or breakpoint-location - to long-read Nanopore sequencing. FUDGE encompasses a dedicated bioinformatics approach (NanoFG) to detect fusion genes from Nanopore sequencing data. Our strategy is flexible with respect to target choice and enables multiplexed enrichment for simultaneous analysis of several genes in multiple samples in a single sequencing run. We observe on average a 508-fold on-target enrichment and identify fusion breakpoints at nucleotide resolution - all within two days. We demonstrate that FUDGE effectively identifies fusion genes in cancer cell lines, tumor samples and on whole genome amplified DNA irrespective of partner gene or breakpoint-position in 100% of cases. Furthermore, we show that FUDGE is superior to routine diagnostic methods for fusion gene detection. In summary, we have developed a rapid and versatile fusion gene detection assay, providing an unparalleled opportunity for pan-cancer detection of fusion genes in routine diagnostics.

  Study EGAS00001003964

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models: validation cohort

  While cell-free DNA (cfDNA) in liquid biopsies is widely being used and investigated, free circulating RNA (extracellular RNA, exRNA) has the potential to improve therapy response monitoring and cancer detection due to its dynamic nature. A fundamental open question hampering the initiation of large-scale liquid biopsy collections for tumour exRNA analysis is that it remains unclear in which blood subcompartment tumour-derived exRNAs primarily reside. We set out to develop a host-xenograft deconvolution framework, exRNAxeno, with cDNA mapping strategies to either a combined human-mouse reference genome or both species genomes in parallel, that can be applied to exRNA sequencing data from liquid biopsies of human xenograft mouse models, enabling to distinguish (human) tumoural RNA from (murine) host RNA, and as such to specifically analyse tumour-derived exRNA. Subsequently, the preferred exRNAxeno combination pipeline was applied to total exRNA sequencing data from blood platelets and three plasma fractions from a breast cancer patient-derived and neuroblastoma cell line-derived xenograft mouse model. We show that tumoural exRNA concentrations are not determined by plasma platelet levels, while host exRNA concentrations increase with platelet content. Furthermore, a large variability in exRNA levels and gene content across individual mice is observed. In general, the tumoural gene detectability in plasma is correlated with the RNA expression levels in the tumour tissue or cancer cell line. Our results unravel new aspects of tumour-derived exRNA biology in xenograft mouse models.

  Study EGAS00001006582

• Differentially methylated CpGs in response to growth hormone administration in children with idiopathic short stature

  Background: Recombinant human growth hormone (rhGH) has shown a great growth-promoting potential in children with idiopathic short stature (ISS). However, the response to rhGH differs across individuals, largely due to genetic and epigenetic heterogeneity. Since epigenetic marks on the methylome can be dynamically influenced by GH, we performed a comprehensive pharmaco-epigenomics analysis of DNA methylation changes associated with long-term rhGH administration in children with ISS. Results: We measured DNA methylation profiles before and after GH treatment (with a duration of ~18 months in average) on 47 healthy children using customized methylC-seq capture sequencing. Their changes were compared and associated with changes in plasma IGF1 by adjusting sex, age, treatment duration, and estimated blood proportions. We observed a considerable inter-individual heterogeneity of DNA methylation changes responding to GH treatment. We identified 267 response-associated differentially methylated cytosines (DMC) that were enriched in promoter regions, CpG islands and blood cell-type specific regulatory elements. Furthermore, the genes associated with these DMCs were enriched in the biology process of "cell development", "neuron differentiation" and "developmental growth", and in the TGF-beta signaling pathway, PPAR Alpha pathway, endoderm differentiation pathway, adipocytokine signaling pathway as well as PI3K-Akt signaling pathway, and cAMP signaling pathway. Conclusion: Our study provides a first insight in DNA methylation changes associated with rhGH administration, which may help understand mechanisms of epigenetic regulation on GH-responsive genes.

  Study EGAS00001006115

• Non-muscle Invasive Bladder Cancer Molecular Subtypes Predict Differential Response to Intravesical Bacillus Calmette-Guérin

  The recommended treatment for patients with high-risk non-muscle invasive bladder cancer (HR-NMIBC) is tumor resection followed by adjuvant Bacillus Calmette-Guérin (BCG) bladder instillations. However, only 50% of patients benefit from this therapy. In case of progression to advanced disease, patients must undergo a radical cystectomy with significant morbidity and have a poor clinical outcome. Identifying tumors least likely to respond to BCG can translate into alternative treatments, such as early radical cystectomy or novel targeted or immunotherapies. Here we present molecular profiling of 132 BCG-naive, HR-NMIBC patients, and 44 post-BCG recurrences (34 matched), which uncovered three distinct BCG Response Subtypes (BRS1-3). Patients with BRS3 tumors have reduced recurrence and progression-free survival compared to BRS1-2. BRS3 tumors expressed high EMT-basal markers and had an immunosuppresive profile, which was confirmed with spatial proteomics. Tumors which recurred post-BCG were enriched for BRS3. BRS stratification was validated in a second cohort of 151 BCG-naive HR-NMIBC patients and the molecular subtypes outperformed guideline recommended risk stratification based on clinicopathological variables. For clinical application, we validated that a commercially approved assay was able to accurately predict BRS3 tumors (AUROC 0.86). Our findings provide a potential clinical tool for improved identification of HR-NMIBC patients at the highest risk of progression, which can be used to select patients for early radical cystectomy or novel subtype-directed therapies.

  Study EGAS00001006879

• Mid-frequency hearing loss is a characteristic clinical feature of OTOA-associated hearing loss

  In this study, we performed NGS analysis of a large Japanese hearing loss cohort, and identified 7 patients with OTOA-associated hearing loss. As novel clinical features identified in this study, the audiometric configurations of OTOA-associated hearing loss patients was found to be mid-frequency.

  Study JGAS000200

• CEITEC DAC

  A CEITEC Data Access Committee (DAC) is a body of one or more named individuals who are responsible for data release to external requesters. The members of DAC are selected members of research groups and their respective leaders. Multiple datasets may be affiliated to a single DAC. DAC continues communication with requester to understand the purpose of use, i.e. research setting the dataset is envisioned for by requester, to identify if data sharing is possible directly under current conditions for the dataset, or actions such as re-consenting is needed and desirable to accommodate the proposed research setting/data use.

  Dac EGAC50000000049

• Long-read sequencing identifies a common transposition haplotype predisposing for CLCNKB deletions

  Long-read whole genome sequencing, long-read long-range PCR sequencing, targetted long fragment long-read sequencing data of the CLCNKA/CLCNKB locus in 27 Bartter syndrome patients. Multiple different deletion alleles are identified and a new common transposition haplotype predisposing for CLCNKB deletions is described.

  Study EGAS00001007339

• Clinical and genetic analysis of a rare syndrome associated with neoteny

  We describe a novel syndrome in six patients with extreme developmental delay and the defining characteristic of neoteny. In an effort to discover any genetic causes of this syndrome whole genome sequence (WGS) analysis of the patients and their families was performed on Complete Genomics’ nanoarray platform.

  Study EGAS00001002419

• 120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  120 individuals from the TEENAGE study (Ntalla et al., 2013) have been genotyped on the Illumina HumanCoreExome-12v1-1_A array. This is a population-based study of adolescents from the Attica region in Greece

  Study EGAS00001001733

• Ultra-deep sequencing of cell-free DNA derived from reference materials and a patient with asymmetric overgrowth

  This dataset contains: Ultra-deep sequencing data using the Duplex sequencing technology of: 1.) SeraSeq cfDNA reference materials with spike-in variants with allele frequencies from 0% to 5% 2.) One cfDNA sample from a CRC patient 3.) One cfDNA sample from a patient with asymmetric overgrowth Paired-end sequencing was performed with 2x151 bp reads on the NextSeq 500 system. Data is provided as mapped .bam files (aligned to GRCh38/hg38).

  Dataset EGAD00001009784

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• CRUK Accelerator: Non-small cell lung cancer whole exome and RNA sequencing

  Whole exome and RNASeq raw sequencing data for a cohort 24 patients with non-small cell lung cancer, 15 adenocarcinoma (8 female, 7 male) and 9 squamous cell carcinoma(5 female, 4 male). Median age at diagnosis was 69. Tumour tissue and PBMCs were used for whole exome sequencing and RNA sequencing. This data was generated as part of a study funded by a Cancer Research UK Centres Network Accelerator Award Grant (A21998).

  Dataset EGAD00001007934

• Oral microbiota composition assessed with 16S rRNA sequencing from adults aged over 65 years old.

  This is a oral microbiota amplicon dataset derived from adult participants aged over 65 years old. It consists a total number of 491 samples, stored in 982 paired-end FASTQ files with sequence lengths of 200 nucleotides generated with a Illumina MiSeq. Of those 491 samples, 347 were used in analysis, the remaining 144 samples are control samples.

  Dataset EGAD00001007705

• Comprehensive RNA repository of tissue and plasma from patients with esophageal cancer or precursor lesions

  A comprehensive RNA repository (both coding and non-coding) from 17 patients diagnosed with esophageal adenocarcinoma, high-grade dysplastic or non-dysplastic Barrett’s esophagus. Per patient, a blood plasma sample, and a healthy esophageal and disease tissue sample were collected. This dataset includes both mRNA and small RNA sequencing data (fastq.gz files) of all tissue and plasma samples. In total,102 RNA-seq libraries from 51 samples (17 plasma and 34 tissue samples) were sequenced (plasma mRNA libraries were sequenced twice).

  Dataset EGAD00001006857

• Spatial RNA-sequencing of metastatic melanoma

  We performed RNA sequencing of 48 different regions sub-sampled from a metastatic melanoma biopsy that was treated with anti-PD-1 inhibitor. RNAseq was performed on samples with a minimum RNA integrity number (RIN) of 5.5 except for two cases (6A10 and 8A3) with RINs greater than 3. A minimum of 700ng of RNA were required for all samples undergoing RNAseq. Paired-end transcriptome reads were aligned using TopHat2, to the UCSC hg19 reference genome.

  Dataset EGAD00001005820

• DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq BAM files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001005757

• microRNA-seq of human serum from a longitudinal study of 66 women with no history of cancer

  This dataset includes microRNA sequencing data from 198 human serum samples, representing a subset of 66 women with no history of cancer who participated in the UKCTOCS study and with serum samples collected at three timepoints over a period of up to 5 years. Small RNA libraries prepared from the serum samples were sequenced with 50-bp single end reads on an Illumina HiSeq 2000 instrument. Data is provided as FASTQ files.

  Dataset EGAD00001004348

• Analysis of tumor periphery and center-specific mutations in renal cell carcinoma

  Renal cell carcinoma (RCC) is a genomically heterogeneous tumor. In the present project, the question whether intratumoral heterogeneity follows a zonal pattern indicating spatial niches was addressed. Whole exome sequencing of 16 paired samples from tumor periphery and center revealed a number of region-specific functional SNVs and Indels. Therefore, RCCs are not composed of evenly admixed tumor cells but show topological differences in their clonal composition.

  Dataset EGAD00001002067

• RNASeq_EGAS00001001306

  RNASeq sequencing. Each library was sequenced using TruSeq SBS Kit v3-HS, in paired-end mode with a read length of 2 × 76 bp. We generated more than 20 million paired-end reads for each sample in a fraction of a sequencing lane on HiSeq2000 (Illumina Inc.) following the manufacturer’s protocol. Image analysis, base calling and quality scoring of the run were processed using the manufacturer’s software Real Time Analysis (RTA 1.13.48) and followed by generation of FASTQ sequence files.

  Dataset EGAD00001001443

• Hip OA Functional Genomics RNAseq (2017-06-09)

  From 9 patients undergoing hip joint replacement surgery for osteoarthritis, we collected 3 cartilage samples each: a low-grade sample (no obvious evidence of damage or fibrillation); a high-grade sample (damaged and fibrillated cartilage); an osteophytic sample (overlaid bony protrusions mainly around the margins of the articular surface). Multiplexed libraries were sequenced on Illumina HiSeq 2000 (75bp paired-end read length) and a cram file was produced for each sample. This dataset contains all the data available for this study on 2017-06-09.

  Dataset EGAD00001003354

• Whole exome sequencing of young onset Primary Sclerosing Cholangitis

  Primary sclerosing chloangitis is a rare autoimmune disease of the liver (prevalence =10/100,000) with a mean age of onset of 40 years. We are currently undertaking GWASand immunochip experiments to identify loci underlying PSC susceptibility. Through ourcollaborators at the University of Calgary we have access to DNA from three parent-offspringtrios where the children required liver transplants due to PSC before the age of 9. These areextremely rare cases indeed and we believe that exome-sequencing represents a powerfulmeans of identifying the causal mutation underlying this severe phenotype.

  Dataset EGAD00001000671

• Action to Control Cardiovascular Risk in Diabetes (ACCORD-BioLINCC)

  Related StudiesWhole genome and whole exome data is available on a subset of participants with phs001411. ECG signal data is available with phs003562.ObjectivesThe purpose of this study was to determine if intensive glycemic control, multiple lipid management and intensive blood pressure control could prevent major cardiovascular events (myocardial infarction, stroke or cardiovascular death) in adults with type 2 diabetes mellitus. Secondary hypotheses included treatment differences in other cardiovascular outcomes, total mortality, microvascular outcomes, health-related quality of life and cost-effectiveness. BackgroundGlycemia Trial:Patients with type 2 diabetes mellitus die of cardiovascular disease (CVD) at rates two to four times higher than non-diabetic populations of similar demographic characteristics. They also experience increased rates of nonfatal myocardial infarction and stroke. With the growing prevalence of obesity in the United States, CVD associated with type 2 diabetes is expected to become an even greater public health challenge in the coming decades than it is now. Expected increases in event rates will be associated with a concomitant rise in suffering and resource utilization.The ACCORD study investigated whether intensive therapy to target normal glycated hemoglobin (HbA1c) levels would reduce cardiovascular events in patients with type 2 diabetes who had either established cardiovascular disease or additional cardiovascular risk factors when compared to standard therapy (HbA1c between 7.0% and 7.9%). A separate analysis investigated whether reduction of blood glucose concentration decreases the rate of microvascular complications in these patients. Lipid Therapy Trial: Patients with type 2 diabetes mellitus have an increased incidence of atherosclerotic cardiovascular disease attributable, in part, to associated risk factors such as dyslipidemia. This is characterized by elevated plasma triglyceride levels, low levels of high-density lipoprotein (HDL) cholesterol and small, dense low-density lipoprotein (LDL) particles. The ACCORD Lipid Therapy trial was designed to test the effect of a therapeutic strategy that uses a fibrate to raise HDL-C and lower triglyceride levels and uses a statin for treatment of LDL-C reduce the rate of CVD events compared to a strategy that only uses a statin for treatment of LDL-C on cardiovascular outcomes in patients with type 2 diabetes that were at high risk for cardiovascular disease. Blood Pressure Trial: Diabetes mellitus increases the risk of cardiovascular disease at every level of systolic blood pressure. Because cardiovascular risk in patients with diabetes is graded and continuous across the entire range of levels of systolic blood pressure, even at prehypertensive levels, the Seventh Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC 7) recommended beginning drug treatment in patients with diabetes who have systolic blood pressures of 130 mm Hg or higher, with a treatment goal of reducing systolic blood pressure to below 130 mm Hg. There is, however, a paucity of evidence from randomized clinical trials to support these recommendations. The ACCORD Blood Pressure trial tested the effect of a target systolic blood pressure below 120 mm Hg on major cardiovascular events among high-risk persons with type 2 diabetes compared to a strategy that targeted a SBP of EYE Substudy: Diabetic retinopathy, an important microvascular complication of diabetes, is a leading cause of blindness in the United States. Randomized, controlled clinical trials in cohorts of patients with type 1 diabetes and those with type 2 diabetes have shown the beneficial effects of intensive glycemic control and intensive treatment of elevated blood pressure on the progression of diabetic retinopathy. Elevated serum cholesterol and triglyceride levels have been implicated, in observational studies and small trials, as additional risk factors for the development of diabetic retinopathy and visual loss. The ACCORD EYE Substudy evaluated the effects of the ACCORD medical strategies on the progression of diabetic retinopathy in a subgroup of trial patients. MIND Substudy: Studies suggest that older persons with type 2 diabetes have at least twice the likelihood of developing late-life cognitive impairment or dementia compared to those without. The mechanisms underlying these cognitive disorders are increasingly thought to reflect a mixed pathology pattern with contributions from vascular, neurodegenerative and neurovascular processes. Pathophysiological mechanisms that have been described include inflammation, oxidative stress, energy imbalance, protein misfolding, glucocorticoid-mediated effects and differences in genetic susceptibilities. The ACCORD MIND substudy took as a premise that early intervention with the ACCORD therapeutic strategies to improve glycemic control could mitigate the adverse effects of type 2 diabetes on the brain. Participants10,251 participants with type 2 diabetes and HbA1c concentrations of 7.5% or more participated in the trial. Of these patients, 5518 were assigned to the lipid therapy arm and 4733 to the blood pressure arm. EYE Substudy: A subgroup of 2856 participants was evaluated for the effects of the ACCORD interventions at 4 years on the progression of diabetic retinopathy. Participants who, at baseline, had a history of proliferative diabetic retinopathy that had been treated with laser photocoagulation or vitrectomy were excluded. MIND Substudy: A subgroup of 2977 participants was evaluated for cognitive function and brain volume. The ACCORD MIND substudy excluded participants aged Design Participants were randomly assigned to undergo either intensive glycemic control (targeting a glycated hemoglobin level EYE Substudy: EYE Substudy participants were evaluated at two standardized and comprehensive eye examinations for the effects of the ACCORD interventions at 4 years on the progression of diabetic retinopathy by 3 or more steps on the Early Treatment Diabetic Retinopathy Study Severity Scale (as assessed from seven-field stereoscopic fundus photographs, with 17 possible steps and a higher number of steps indicating greater severity) or the development of diabetic retinopathy necessitating laser photocoagulation or vitrectomy. MIND Substudy: The cognitive primary outcome, the Digit Symbol Substitution Test (DSST) score, was assessed at baseline, 20 and 40 months. Total brain volume (TBV), the primary brain structure outcome, was assessed with MRI at baseline and 40 months in a sub-set of 632 patients. All patients with follow-up data were included in the primary analyses. Conclusions Glycemia Trial: As compared with standard therapy, the use of intensive therapy to target normal glycated hemoglobin levels for 3.5 years increased mortality and did not significantly reduce major cardiovascular events. (Action to Control Cardiovascular Risk in Diabetes Study Group, et al.,2008, PMID:18539917). Microvascular Outcomes of the Glycemia Trial: Intensive therapy did not reduce the risk of advanced measures of microvascular outcomes, but delayed the onset of albuminuria and some measures of eye complications and neuropathy. Microvascular benefits of intensive therapy should be weighed against the risk of increased total and cardiovascular disease-related mortality, increased weight gain, and higher risk for severe hypoglycemia. (Ismail-Beigi et al., 2010, PMID: 20594588) Lipid Therapy Trial: The combination of fenofibrate and simvastatin did not reduce the rate of fatal cardiovascular events, nonfatal myocardial infarction or nonfatal stroke, as compared with simvastatin alone. These results do not support the routine use of combination therapy with fenofibrate and simvastatin to reduce cardiovascular risk in the majority of high-risk patients with type 2 diabetes (ACCORD Study Group, et al., 2010, PMID: 20228404). Blood Pressure Trial: In patients with type 2 diabetes at high risk for cardiovascular events, targeting a systolic blood pressure of less than 120 mm Hg, as compared with less than 140 mm Hg, did not reduce the rate of a composite outcome of fatal and nonfatal major cardiovascular events (ACCORD Study Group, et al., 2010, PMID: 20228401). EYE Substudy: Intensive glycemic control and intensive combination treatment of dyslipidemia, but not intensive blood-pressure control, reduced the rate of progression of diabetic retinopathy (ACCORD Study Group, et al., 2010, PMID: 20587587). MIND Substudy: Although significant differences in TBV favored the intensive therapy, cognitive outcomes were not different. Combined with the unfavorable effects on other ACCORD outcomes, MIND findings do not support using intensive therapy to reduce the adverse effects of diabetes on the brain in patients similar to MIND patients (Launer et al., 2011, PMID: 21958949).

  Study phs003551

• NHLBI TOPMed: The Cleveland Family Study (CFS)

  The Cleveland Family Study (CFS) is one cohort involved in the WGS project. The CFS was designed to provide fundamental epidemiological data on genetic and non-genetic risk factors for sleep disordered breathing (SDB). In brief, the CFS is a family-based study that enrolled a total of 2284 individuals from 361 families between 1990 and 2006. The sample was selected by identifying affected probands who had laboratory diagnosed obstructive sleep apnea. All first degree relatives, spouses and available second degree relatives of affected probands were studied. In addition, during the first 5 study years, neighborhood control families were identified through a neighborhood proband, and his/her spouses and first degree relatives. Each exam, occurring at approximately 4 year intervals, included new enrollment as well as follow up exams for previously enrolled subjects. For the first three visits, data, including an overnight sleep study, were collected in the participants' homes while the last visit occurred in a general clinical research center (GCRC). Phenotypic characterization of the entire cohort included overnight sleep apnea studies, blood pressure, spirometry, anthropometry and questionnaires. The GCRC exam (n=735 selected individuals) included more comprehensive phenotype data on a focused subsample of the larger cohort, to permit linking SDB phenotypes with cardio-metabolic phenotypes, with an interest in identifying genetic loci that are associated with these related phenotypes. In this last round of data collection, a subset of 735 individuals was selected based on expected genetic informativity by choosing pedigrees where siblings had extremes of the apnea hypopnea index (AHI). Participants underwent detailed phenotyping including laboratory polysomnography (PSG), ECG, spirometry, nasal and oral acoustic reflectometry, vigilance testing, and blood and urine collection before and after sleep and after an oral glucose tolerance test. A wide range of biochemical measures of inflammation and metabolism were assayed by a Core Laboratory at the University of Vermont. 994 individuals were sequenced as part of TOPMed Phase 1, including 507 African-Americans and 487 European-Americans. Among the sequenced individuals, 156 were probands with diagnosed sleep apnea, an additional 706 were members of families with probands, and 132 were from neighborhood control families. 298 individuals were sequenced as part of TOPMed Phase 3.5, including 169 African-Americans and 129 European-Americans. Among the newly sequenced individuals, 33 were probands with diagnosed sleep apnea, an additional 214 were members of families with probands, and 51 were from neighborhood control families. Please note: Phenotype and pedigree data are available through "NHLBI Cleveland Family Study (CFS) Candidate Gene Association Resource (CARe)", phs000284.

  Study phs000954

• African Demographic History Study Using Illumina 1M Array Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs001780

• African Demographic History Study Based on WGS Data

  These data were used as part of a study to characterize genomic diversity in Africa, population substructure, and evolutionary history.

  Study phs003096

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Whole exome sequence analysis in multiple system atrophy

  To identify a susceptible gene for multiple system atrophy, exome sequence analysis was conducted in 14 patients and 7 controls.

  Study JGAS000009

• Analysis of Multiparametric MR imaging and tumor tissue sampling to identify response and acquired resistance to HIF-2 inhibition in patients with advanced clear cell renal cell carcinoma enrolled in a phase 1, multiple-dose, dose-escalation trial of PT2385, a HIF-2alpha inhibitor

  Study EGAS00001003506

• Neoadjuvant_Breast_Cancer_Validations

  This study aims to re-sequence findings from whole genome studies using a bespoke pulldown method to validate mutations in those genomes sequenced.

  Study EGAS00001000428

• Human non-malignant plasma cfRNA study - raw data

  mRNA capture sequencing on plasma sample from 88 patients with a non-malignant disease and from 37 healthy donors.

  Study EGAS50000001264

• Genomic profiling of esthesioneuroblastoma

  We performed whole exome and whole genome sequencing on a cohort of esthesioneurblastoma to understand the genetic underpinnings of this neoplasm.

  Study EGAS00001003225

• WTCCC2 Pre-eclampsia Study

  A WTCCC2 project genome-wide association study for pre-eclampsia (PA) in 4375 individuals from Colombia, genotyped on the Affymetrix 6.0 array.

  Study EGAS00001003349

• Discordant_Monozygotic_Twins_ALS (Epigenetics)

  We conducted a multi-omics study on a monozygotic twin pair discordant for amyotrophic lateral sclerosis. Data refers to 7 samples that are technical replicates from biological samples collected from the twins at two different time points (T1 and T2).

  Dataset EGAD00010002716

• RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  RNA-seq dataset for Mutation-specific non-canonical pathway of PTEN as a distinct therapeutic target for glioblastoma

  Dataset EGAD00001006877

• Whole-exome sequencing data from a head and neck cancer patient

  This dataset contains paired-end whole-exome sequencing data (2x50 bp) from the normal sample, three synchronous primary tumors and the recurrence of a head and neck cancer patient.

  Dataset EGAD00001006653

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• DNA Double Strand Breaks in KMT2A-Rearranged AML patients

  DNA breakage at specific rearrangement-participating genes, which are more sensitive to a range of environmental and chemotherapeutic agents than other regions of the human genome, contributes to the generation of leukemia-causing rearrangements, and can be used as a predictor of susceptibility to cancer caused by gene rearrangements. As a direct proof-of-principle regarding the feasibility of employing fragile site breakage to identify and monitor high-risk populations to allow personalized treatments, genome-wide DNA break mapping/sequencing was used to determine whether preferential DNA breaks are generated at the major breakpoint regions of KMT2A in AML remission patients with previously diagnosed KMT2A rearrangement. We are submitting break mapping data from three patients with KMT2A rearrangements and three non-fusion patients, with and without etoposide treatments.

  Study phs002804

• Genome wide association study for early onset coronary disease and related phenotypes (ADVANCE)

  ADVANCE (Atherosclerotic Disease, VAscular functioN, and genetiC Epidemiology) is a large epidemiological study of genetic and non-genetic determinants of coronary artery disease (CAD) that started in 2000 as a collaborative effort between researchers at Stanford University and Kaiser Permanente of Northern California. The overarching goal of the study is to improve our ability to prevent, diagnose and treat CAD. The initial study included recruitment of over 3600 subjects (including 1873 subjects with incident clinically significant coronary disease and 1745 control subjects) from multiple race/ethnic backgrounds. A subset of ~ 500 subjects with very early onset coronary disease (men < 45 and women < 55) and ~ 500 similar aged controls were genotyped using the Illumina 550K platform as part of an NIH funded effort within the STAMPEED consortium.

  Study phs000423

• Rapid Acceleration of Diagnostics - Digital Health Technologies (RADx-DHT): Large Scale Flu Surveillance Study (LSFS)

  The purpose of this study was to better understand behavioral and physiological functioning in relation to recent self-reported influenza and influenza-like-illness (ILI), including coronavirus disease (COVID-19). Over 65,000 Achievement members responded to a weekly one-click survey asking if they had experienced ILI within the previous 7-day period. If they responded no, they were given the option to complete a survey about their risk factors and behavior. If they responded yes, they were given the option to complete a survey asking about the specifics of the incident. Participants were also asked to sync their wearable activity trackers and health apps in order for researchers to better understand changes in behavioral and physiological outcomes related to self-reported ILI experiences.DOI: https://rapids.ll.mit.edu/10.57895/fkth-d352

  Study phs002539

• Genetic Epidemiology of Chronic Lymphocytic Leukemia

  Chronic lymphocytic leukemia (CLL) is a subtype of B-cell lymphoproliferative disorders (LPD), and is the most common form of adult leukemia in Caucasians in the United States. Small lymphocytic lymphoma (SLL) is also a B-cell LPD and is typically considered to be the same disease as CLL, based on pathology. We consider CLL and SLL as the same disease entity, and hereafter refer to both simply as "CLL". Using genealogical databases and cancer records, the familial clustering for CLL is one of the strongest for all cancer sites, strongly implicating germline genetic risk. We ascertained CLL cases and controls for a genomewide association study (GWAS) that was undertaken as part of the International Lymphoma Epidemiology (InterLymph) consortium GWAS. Some CLL cases are also part of extended high-risk CLLpedigrees.

  Study phs001568

• HNPCC-Sys: Molecular Characterization of Lynch Syndromes

  Lynch Syndrome (LS) tumors are characterized by constitutional mutations in DNA mismatch-repair genes. Colorectal cancers (CRCs) are the predominant tumor type in patients with LS. Here, we have used whole-genome and transcriptome sequencing of LS- CRC to find similarities and differences of mutation and gene expression characteristics between LS-CRC and sporadic CRC (data provided by TCGA via dbGaP). Furthermore, we were interested in the molecular heterogeneity of LS-CRC. We have performed a molecular characterization of LS-tumors and of matched tumor-distant reference colonic mucosa based on whole-genome DNA- and RNA-sequencing analyses. Our data indicates the existence of two subgroups of LS-CRCs, G1 and G2, where G1 tumors show a higher number of somatic mutations, higher microsatellite slippage and a different mutation spectrum.

  Study phs001407

• HuBMAP: Single-Cell Data from Human Tissues

  The small bowel and colon are organs critical for maintaining homeostasis of the human body by mediating nutritional absorption upon the ingestion of food. Though both organs are extensive in length, there are known differences in function and cellular heterogeneity within different portions of each. Also, a cross section anywhere in the bowel reveals a complex layering of components involved in absorption and secretion, motility of gut contents, circulation, and immunity. We are mapping the complexity of the the small bowel and colon with cell-to-cell resolution in histologic sections, both along their lengths and across multiple individuals. Our molecular data consist of single cell ATAC-seq and RNA-seq. These profiles are spatially mapped to histologic sections using CO-Detection by indEXing (CODEX), a highly multiplexed system of antibody-tagged target epitopes.

  Study phs002272

• Evolution of Resistance in ER+ Breast Cancer

  While the combination of endocrine therapy and CDK4/CDK6 inhibitors has been shown to be effective in the metastatic ER+ breast cancer setting, to test whether it is effective in an earlier stage neoadjuvant setting, the FELINE trial (NCT02712723) was established to test the efficacy of letrozole and ribociclib in a ER-positive, HER2-negative patients in a randomized, placebo-controlled, multicenter trial. Patients were randomized to one of three arms: those in Arm A received letrozole and placebo, Arm B letrozole and intermittent ribociclib, and Arm C letrozole and continuous ribociclib. Samples were collected at screening (Day 0), Cycle 1 (Day 14), and end of trial (Day 180). Samples from 24 patients, where cancer cells were present at Day 0 and one additional time point, were subjected to whole-exome sequencing profiling.

  Study phs002287

• Transcriptomic and Clonal Characterization of T Cells in the Human Central Nervous System

  The cerebrospinal fluid (CSF) is thought to be a main route for immune surveillance in the central nervous system (CNS). Understanding the composition and state of CSF in healthy individuals may provide insight into perturbations present during neuroinflammation. Here, we have used single-cell RNA and TCR sequencing to profile CSF and peripheral blood mononuclear cells (PBMCs) from healthy individuals and patients with relapsing-remitting multiple sclerosis (MS), a chronic autoimmmune disease. In addition, with the goal of understanding how transcriptional artefacts are introduced in transcriptomics experiments, we have performed single-cell and TCR sequencing to profile PBMCs from a healthy individual that were processed with the same enzymatic digestion used for tissues (such as the brain) in the presence or absence of transcription inhibitors. 

  Study phs002222

• Hereditary Cancer Predisposition Syndromes and Uveal Melanoma

  Uveal melanoma (UM) is a subtype of melanoma characterized by the strong contribution of genetic rather than environmental factors in the pathogenesis of the disease, making it an ideal model disease to study the genetic basis of cancer. The long-term goal of our laboratory is to determine the genes and mechanisms responsible for hereditary cancer predisposition associated with UM. BAP1 has been identified as a candidate gene with definitive association with predisposition to UM. However, pathogenic variants in BAP1 are detected in only a small subset of UM patients even those with strong personal and family history of cancer suggesting the existence of other candidate genes. The goal of this project is to identify novel candidate genes contributing to hereditary predisposition to UM in patients with no detectable germline pathogenic variant in BAP1.

  Study phs001943

• Somatic Mutations in Epilepsy: Whole Genome Sequence Analysis of Single Neurons

  Low-coverage whole-genome sequencing was performed on single-cells from resected brain tissues obtained from an individual with hemimegalencephaly (HMG) along with a somatic copy number variant (sCNV) of chromosome 1q in order to characterize the sCNV at the single cell level. Single neuronal nuclei and non-neuronal nuclei were isolated by fluorescence-activated cell sorting (FACS) using NeuN immunoreactivity to identify neurons. 46 neurons and 30 non-neuronal cells, as well as a batch of 10 and a batch of 100 cells from each group, were genome amplified using multiple displacement amplification (MDA) and sequenced on an Illumina HiSeq 2000 sequencer. Thirty-two samples were multiplexed into each HiSeq lane for single-end 50 bp runs, obtaining ~5 million pass-filter reads per sample.

  Study phs002615

• The Oral Microbiome and Head and Neck Cancer

  Oral microbiota may influence head and neck squamous cell carcinoma (HNSCC) development, potentially related to carcinogen metabolism. The human oral cavity hosts a diverse microbiota, including bacteria and fungi. We performed shotgun sequencing and ITS1 sequencing on 236 HNSCC case participants who developed HNSCC during a mean follow-up of 5.1 years and 458 matched controls who remained HNSCC-free. Oral samples were obtained from a prospective nested case-control study within three epidemiological cohorts: the American Cancer Society Cancer Prevention Study II Nutrition Cohort (ACS CPS-II), the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial (PLCO), and the Southern Community Cohort Study (SCCS). Control participants were selected using 2:1 frequency matching based on cohort, age, sex, race and ethnicity, and time since oral sample collection.

  Study phs004018

• Single-Cell Atlas of Human Liver and Blood Immune Cells Across Fatty Liver Disease Stages

  The goal of the study was to investigate immunological correlates of human fatty liver disease progression. We generated a single-cell RNA-seq (scRNA-seq) atlas of immune cells from liver fine needle aspirates (FNAs) and paired peripheral blood mononuclear cells (PBMCs) from a full-spectrum Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD)/Metabolic Dysfunction-Associated Steatohepatitis (MASH) human cohort, using the 3' 10X Genomics platform. Using computational analyses to assess changes in cellular frequencies and function, we found heightened immunoregulatory programs with profibrotic potential alongside a shift from antigen-specific to natural killer cytotoxic functions in the liver with MASH progression. Available data include raw single-cell transcriptomic data (FASTQ files) for each sample type (PBMC, FNA) per patient alongside clinical and histological measurements of fatty liver disease.

  Study phs004044

• exploration of biomarkers discriminating squamous cell carcinoma from other lung cancers

  Targeted therapies based on the molecular and histological features of cancer types are becoming standard practice. The most effective regimen in lung cancers is different between squamous cell carcinoma (SCC) and adenocarcinoma (AD). Therefore a precise diagnosis is crucial, but this has been difficult, particularly for poorly differentiated SCC (PDSCC) and AD without a lepidic growth component (non-lepidic AD). Biomarkers enabling a precise diagnosis are therefore urgently needed. To achieve this goal, we initially performed CAGE (Cap Analysis of Gene Expression) to quantify promoter activities on 97 frozen tissues from surgically resected lung cancers (22 SCC and 75 AD). We furhter expanded the transcriptome profiling to cover additional 48 malignant neoplasm of bronchus and lung, including mesothelioma and metastatic lung cancers derived from other tissues.

  Study JGAS000488

• Transcriptomic profiling of circulating regulatory T cells from follicular lymphoma patients before and after Lenalidomide treatment

  Lenalidomide has demonstrated a favorable efficacy profile in follicular lymphoma (FL) in combination with anti-CD20 antibodies. However, in vivo administration of Lenalidomide in FL patients triggers a proliferation of functional regulatory T cells (Tregs), and a high percentage of Tregs before and along the course of treatment with Lenalidomide/anti-CD20 combination is of poor prognosis. In this study, we evaluated the impact of Lenalidomide on circulating Treg in 3 FL patients using single cell RNA sequencing (scRNAseq). For this purpose, we took advantage of the GALEN clinical trial (NCT01582776), where Lenalidomide was initiated one week before starting the anti-CD20 antibody Obinutuzumab, allowing us to compare the transcriptomic profile of immune cells before (D0) and at day 7 (D7) of treatment by Lenalidomide alone.

  Study EGAS50000001048

• Whole-exome sequencing of breast cancer metastasis and corresponding blood samples

  This study included samples from metastatic breast cancer patients who underwent a biopsy in the context of SAFIR01 (NCT01414933), SAFIR02 (NCT02299999), SHIVA (NCT01771458) and MOSCATO (NCT01566019) prospective trials. These French multicentre trials used high throughput genome analysis on fresh frozen tumor biopsies as a therapeutic decision tool for metastatic cancer patients, with solid cancers (SHIVA, MOSCATO) or specifically with breast cancer (SAFIR01, SAFIR02). All patients gave their informed consent for translational research and genetic analyses of their somatic DNA. Overall, whole-exome sequencing for a total of 216 pairs of metastatic tumor and unmutated DNA derived from corresponding blood samples was performed using Illumina technology. The results of the analysis of the mutational profile of metastatic breast cancer was reported in Lefebvre et al. (PMID:28027327).

  Study EGAS00001001695

• Tumor-associated preferred end coordinates and somatic variants as signatures of circulating tumor DNA

  Cell-free DNA fragmentation is a nonrandom process. We showed that cell-free DNA fragments with ends at certain genomic coordinates had higher likelihoods of being derived from hepatocellular carcinoma. Other coordinates were associated with cell-free DNA molecules originating from the liver. Quantitative assessment of cell-free DNA molecules bearing these respective groups of end signatures correlated with the amounts of tumor-derived or liver-derived DNA in plasma. There were millions of tumor-associated plasma DNA end coordinates across the genome. Due to their high prevalence, they were more readily detectable than somatic mutations as a cancer signature in plasma. Hence, detection of tumor-associated plasma DNA ends may offer a cost-effective means of capturing evidence for the presence of cancer through liquid biopsy assessment.

  Study EGAS00001003160

• Germline Aberrations of PAX5 Cause Susceptibility to pre-B cell Acute Lymphoblastic Leukemia

  A novel heterozygous germline variant, c.547G>A (p.Gly183Ser), in the paired box protein encoding gene, PAX5, was found to segregate with disease in two unrelated kindreds with autosomal dominant pre-B cell acute lymphoblastic leukemia (ALL). Leukemic cells from both families exhibited 9p deletion, with loss-of-heterozygosity and retention of the mutant PAX5 allele at 9p13 . Two additional sporadic ALL cases with 9p loss demonstrated PAX5 Gly183 substitution in the leukemic cells. Functional analysis of the PAX5 germline variants demonstrated reduced transcriptional activity, as well as decreased interaction with Groucho-4. These data extend the role of PAX5 alterations in the pathogenesis of pre-B ALL, and implicate PAX5 in a novel syndrome of germline susceptibility to pre-B cell neoplasia.

  Study EGAS00001000447

• Pediatric Low-Grade Glioma RNA and Targeted Sequencing

  Pediatric low-grade gliomas (pLGG) are frequently driven by genetic alterations in the RAS/MAPK pathway yet show unexplained variability in their clinical outcome. To address this, we characterized a cohort of >1,000 clinically annotated pLGG. 84% of cases harbored a driver alteration, while those without an identified alteration also often exhibited up-regulation of the RAS/MAPK pathway. pLGG could be broadly classified based on their alteration type. Rearrangement-driven tumors were diagnosed at a younger age, enriched for WHO grade I histology, infrequently progressed, and rarely resulted in death as compared to SNV-driven tumors. Further sub-classification of clinical-molecular correlates stratified pLGG into risk categories. These data highlight the biological and clinical differences between pLGG subtypes and opens avenues for future treatment refinement.

  Study EGAS00001004242

• 10x genomics single cell RNA-seq and ATAC-seq from 10 pre-menopausal patients fimbriae and ampullary part of the fallopian tube

  The fallopian tube, connecting the uterus with the ovary, is a dynamic organ that undergoes cyclical changes and is the site of several diseases, including serous cancer. Here, we use single-cell technologies to construct a comprehensive cell map of healthy pre-menopausal fallopian tubes, capturing the impact of the menstrual cycle and menopause on different fallopian tube cells at the molecular level. The comparative analysis between pre- and post-menopausal fallopian tubes reveals substantial shifts in cellular abundance and gene expression patterns, highlighting the physiological changes associated with menopause. Further investigations into menstrual cycle phases illuminate distinct molecular states in secretory epithelial cells caused by hormonal fluctuations. The markers we identified characterizing secretory epithelial cells provide a valuable tool for classifying ovarian cancer subtypes.

  Study EGAS50000000628

• Clinical relevance of TCGA subtypes for gastric cancer patients

  There is a clinical need for the availability of molecular biomarkers in the tratment of gastric cancer (GC), since survival rates remain poor with a 5-year survival rate of only ~`40% for patients with resectable disease. These markers will elad to a more tailored approach in the treatment of GC, which enhances efficacy and reduces toxicity. Recently, The Cancer Genome Atlas (TCGA) classified GC patients into four molecular subgroups: Epstein Barr Virus positive (EBV+), genomically stable (GS), microsatellite instable (MSI), and chromosomal instable (CIN). For this purpose we aim to collect tumor tissue blocks from patients who participated in the Dutch D1/D2 or the CRITICS trial and who gave informed consent for translational studies. Associations between TCGA subtypes and outcomes to these different therapeutic options will be analyzed.

  Study EGAS50000000779

• ECM-free patient-derived organoids preserve diverse prostate cancer lineages and uncover in vitro-enriched cell types

  Patient-derived organoids (PDOs) hold promise for modeling various cancers, yet their application in prostate cancer (PCa) has been limited due to low culture success and the predominance of non-tumor-like cells. Using 164 PCa samples and optimizing culture conditions, we demonstrate that an extracellular matrix (ECM)-free culture method improves PDO take-rates, fostering cell populations with luminal and PCa-specific characteristics. Single-cell RNA sequencing (scRNA-seq) reveals that these ECM-free PDOs closely mirror their original tumors at the transcriptomic level and maintain a diverse array of tumor cell types, unlike traditional Matrigel-based cultures which predominantly yield benign-like cells. This study introduces a PCa PDO single-cell atlas, providing a valuable resource for advancing prostate cancer research.

  Study EGAS50000000807

• Loss-of-activity-mutation in the cardiac chloride-bicarbonate exchanger AE3 causes short QT syndrome

  Patients with short QT syndrome (SQTS) may present with syncope, ventricular fibrillation or sudden cardiac death. Six SQTS susceptibility genes, encoding cation channels, explain less than 25% of SQTS cases. Here we identify a missense mutation in the anion exchanger (AE3)-encoding SLC4A3 gene in two unrelated families with SQTS. The mutation causes reduced surface expression of AE3 and reduced membrane bicarbonate transport. Slc4a3 knockdown in zebrafish causes increased cardiac pHi, short QTc, and reduced systolic duration, which is rescued by wildtype but not mutated SLC4A3. Mechanistic analyses suggest that an increase in pHi and decrease in [Cl-]i shortened the action potential duration. However, other mechanisms may also play a role. Altered anion transport represents a mechanism for development of arrhythmia and may provide new therapeutic possibilities.

  Study EGAS00001002632

• Multiple migrations to the Philippines during the last 50,000 years

  A key link to understand human history in Island Southeast Asia is the Philippine archipelago and its poorly investigated genetic diversity. We collected and analyzed the most comprehensive set of population-genomic data for the Philippines, 1028 individuals covering 115 indigenous communities. We demonstrate that the Philippines were populated by at least five waves of human migration. The Cordillerans migrated into the Philippines prior to the arrival of rice agriculture, where some remain to be the least admixed East Asians carrying an ancestry shared by all Austronesian-speaking populations; thereby challenging an exclusive Out-of-Taiwan model of joint farming-language-people dispersal. Altogether, our findings portray Philippines as a crucial gateway, with a multilayered history, that ultimately changed the genetic landscape of the Asia-Pacific region.

  Study EGAS00001005083

• Germline SDHB-inactivating mutation in gastric spindle cell sarcoma (HIPO-021)

  Gastrointestinal stromal tumors (GISTs) are the most frequent mesenchymal tumors of the gastrointestinal tract. Inactivating mutations or epigenetic deregulation of succinate dehydrogenase complex (SDH) genes are considered defining features of a subset of GIST occurring in the stomach. Based on comprehensive molecular profiling and biochemical analysis within a precision oncology program, we identified hallmarks of SDH deficiency (germline SDHB-inactivating mutation accompanied by somatic loss of heterozygosity, lack of SDHB expression, global DNA hypermethylation, and elevated succinate/fumarate ratio) in a 40-year-old woman with undifferentiated gastric spindle cell sarcoma that did not meet the diagnostic criteria for other mesenchymal tumors of the stomach, including GIST. These data reveal that the loss of SDH function can be involved in the pathogenesis of non-GIST sarcoma of the gastrointestinal tract.

  Study EGAS00001004277

• Persistent Mutation Burden Drives Sustained Anti-Tumor Immune Responses

  Tumor mutation burden is an imperfect proxy of tumor foreignness and has therefore failed to consistently demonstrate clinical utility in predicting responses in the context of immunotherapy. We evaluated mutations in regions of the genome that are unlikely to undergo loss and discovered that clonal mutations in single-copy regions and those present in multiple copies per cell constitute a persistent tumor mutation burden (pTMB) that is linked with therapeutic response to immune checkpoint blockade. Persistent mutations were retained in the context of tumor evolution under selective pressure of immunotherapy and tumors with a high pTMB content were characterized by a more inflamed tumor microenvironment. pTMB imposes an evolutionary bottleneck that cancer cells cannot overcome and may thus drive sustained immunologic tumor control in the context of immunotherapy.

  Study EGAS00001006660

• The Iberian Roma genetic variant server

  The Roma are the most numerous ethnic minority in Europe. The Iberian Roma arrived in the Iberian Peninsula five centuries ago and still today, they keep a strong group identity. Demographic and cultural reasons lie behind a high rate of Mendelian disease often related to founder variants. We have analysed exome data from 119 Iberian Roma individuals collected from 2018 to 2020. A database of variant frequency has been implemented (IRPVS) and made available online. We have analysed the carrier rate of founder private alleles as well as pathogenic variants present in the general population. Significant enrichment in structural variants involving gene clusters related to keratinization and epidermal growth suggest that evolutive mechanisms have developed towards climate and environmental adaptation. IRPVS can be accessed at http://irpvs.clinbioinfosspa.es/

  Study EGAS00001006758

• GCparagon: Evaluation and correction of GC biases in cell-free DNA at the fragment level

  We present GCparagon, a two-stage algorithm for computing and correcting GC biases in cell-free DNA (cfDNA) samples. The length of the highly fragmented cfDNAs and the number of GC bases are essential parameters in the calculations. Regions of low mappability, known reference genome assembly errors and regions surrounding assembly gaps are excluded from the bias computation. GCparagon outputs a bias matrix and an optional tagged BAM file with GC bias balance weights as alignment tags. Parallelization allows calculation of a GC bias estimate in less than 2 minutes per sample with between 99.0% and 99.9% of fragments already corrected. We propose that GCparagon can help standardize cfDNA applications and evaluate the impact of GC bias on algorithms used in the analysis of liquid biopsy data.

  Study EGAS00001006963

• Evolutionary landscape of clonal hematopoiesis in 3359 individuals from the general population

  This project contains longitudinal data for processed somatic variant calls and data on core phenotypic variables for 3359 community-based individuals ≥60 years, a sub-cohort of the population-based Lifelines cohort (167,729 participants). Cases with peripheral blood count abnormalities and population-based controls were included. Next-generation sequencing data were generated with a median time period of 43 months between baseline and follow-up visit. For 327 individuals a third visit sample was included. Error-corrected sequencing was performed using single-molecule tagged molecular inversion probes targeting 27 myeloid and lymphoid driver genes. The threshold for variant calling was set at ≥1% VAF and ≥10 consensus variant reads. Details on sample selection, sequencing technique, variant calling procedures and data curation are described (van Zeventer et al. 2023).

  Study EGAS00001007087

• Direct Comparative Analysis of 10X Genomics Chromium and Smart-seq2

  Single cell RNA sequencing (scRNA-seq) is widely used for profiling transcriptomes of individual cells. The droplet-based 10X Genomics Chromium (10X) approach and the plate-based Smart-seq2 full-length method are two frequently-used scRNA-seq platforms, yet there are only a few thorough and systematic comparisons of their advantages and limitations. Here, by directly comparing the scRNA-seq data by the two platforms from the same samples of CD45- cells, we systematically evaluated their features using a wide spectrum of analysis. Smart-seq2 detected more genes in a cell, especially low abundance transcripts as well as alternatively spliced transcripts, but captured higher proportion of mitochondrial genes. The composite of Smart-seq2 data also resembled bulk RNA-seq data better. For 10X-based data, we observed higher noise for mRNA in the low expression level. Despite the poly(A) enrichment, approximately 10-30% of all detected transcripts by both platforms were from non-coding genes, with lncRNA accounting for a higher proportion in 10X. 10X-based data displayed more severe dropout problem, especially for genes with lower expression levels. However, 10X-data can better detect rare cell types given its ability to cover a large number of cells. In addition, each platform detected different sets of differentially expressed genes between cell clusters, indicating the complementary nature of these technologies. Our comprehensive benchmark analysis offers the basis for selecting the optimal scRNA-seq strategy based on the objectives of each study.

  Dataset EGAD00001005448

• Transcriptome human nasal epithelium

  1. Odors are detected, firstly, by olfactory sensory neurons (OSNs) in the olfactory epithelium of the nose. This neurons then project directly to the olfactory bulb in the brain. Olfaction depends on cellular regeneration of the OE, olfactory bulb and hippocampus, and on their continual re-wiring. The olfactory neural pathway includes regions of the frontal, temporal and limbic brain, which in turn overlap with brain areas involved in brain disorders. OSNs are the only aspect of the human brain exposed to the external environment. This not only makes them vulnerable to environmental changes, but also accessible for biomedical studies. We have already sequenced and developed a protocol for analyzing the transcriptome of mouse main olfactory epithelium and single OSNs. We propose here to perform a similar study for samples from the human olfactory epithelium. We have developed a minimally invasive method for obtaining human OSNs, among other cells from the nasal epithelium. In this experiment, we have obtained cell samples from the olfactory epithelium, including OSN, from healthy volunteers. We would like to further characterize them by RNA sequencing. This will give us valuable insight into human olfaction. It will also provide a first step into a new avenue to study, and find biomarkers for, brain diseases though the analysis of these easily available neurons. This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

  Dataset EGAD00001002226

• Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response

  The study 'Bladder Cancer Organoids as a Functional System to Model Different Disease Stages and Therapy Response' reports the genomic characterization at the single allele level upon Whole Exome Sequencing of Bladder Cancer (BLCa) Patient Tumor (PT) samples obtained from 18 patients and corresponding Patient Derived Organoids (PDOs), implementing the SPICE pipeline (Ciani Y et al). Our cohort included 21 PTs and 22 PDOs. In this study, we generated a unique biobank resource of BLCa organoids that encompasses a broad spectrum of disease stages. We demonstrated that PDOs retain cancer heterogeneity and mutational burden. Furthermore, we observed that BLCa PDO can have different morphologies which may reflect tumor-specific features. Indeed, a solid morphology may be associated with more advanced tumors, as supported by the high PDO genomic burden and high primary tumor stage. Moreover, with our drug screening pipeline, we demonstrated the clinical relevance and feasibility of using a BLCa PDO-based drug assay for comparing the standard of care (SOC) drugs with compounds not currently in use for BLCa. Response to SOC was highly heterogeneous with approximately 50% of non-muscle invasive bladder cancer and 33% of muscle invasive bladder cancer PDOs showing no or minimal response. The most effective targeted therapy was lapatinib. We used an integrative analysis of drug response profiles with matched PDO genomic analysis to determine enrichment thresholds for candidate markers of therapy resistance and sensitivity. Importantly, by assessing the clinical history of longitudinally sampled cases, the clonal evolution of the disease could be determined and matched with PDO drug response profiles.

  Study phs003149

• Genomic Studies of Bipolar Disorder in a Large Cohort from The Netherlands

  The transcriptomes of whole blood samples of a large cohort of individuals from the Netherlands were assayed using RNA-seq. These whole blood samples included patients diagnosed with schizophrenia or bipolar disorder, family members of patients, and healthy controls. Within the whole blood dataset, about 600 of the samples were sequenced to an average of 13.9 million mapped reads per sample, while about 2,000 were sequenced to an average of 5.9 million mapped reads per sample, in order to assess changes in power to detect eQTLs based on sample size. We find that expression, defined as the log transcripts per million reads (TPMs), is highly correlated when comparing the moderate (13.9M) and lower (5.9M) coverage datasets. Additionally, a subset of about 150 individuals provided fibroblast cell lines which were assessed for the levels of gene expression using RNA-seq at an average of 50 million mapped reads per sample. We use downsampling techniques to generate synthetic datasets derived from this real fibroblast RNA-Seq data to explore the relationship between coverage and number individuals in an eQTL analysis. Corresponding individual-level genotypes for the samples included in the expression matrix are also made available. The genotypes were derived from multiple other project cohorts, each using different genotyping platforms including OmniExpress Exome, Global Screening Array, Illumina550, and PsychChip. A Plink file set of these cohorts is provided here after merging the separate project file sets and extracting only the individuals who have expression data also provided here; quality control for SNP-missingness is recommended. We demonstrate in this study that given a fixed budget, eQTL discovery power can be increased by lowering the sequencing depth per sample to allow for an a greater number of individuals sequenced. 

  Study phs002856

• The Human Phenotype Project (HPP) is a large-scale deep-phenotype prospective longitudinal and ethnically diverse cohort

  The Human Phenotype Project (HPP) is a large-scale deep-phenotype prospective longitudinal and ethnically diverse cohort and biobank that we established. To date, approximately 28,000 participants have enrolled in the study, with over 13,000 having completed their initial visit. The project is aimed at identifying novel molecular signatures with diagnostic, prognostic and therapeutic value, and at developing AI-based predictive models for disease onset and progression. A unique feature of the HPP is its deep and longitudinal profiling that includes medical history, lifestyle and nutritional habits, vital signs, anthropometrics, blood tests, continuous glucose and sleep monitoring, imaging modalities and molecular profiling of the transcriptome, genetics, gut, vaginal and oral microbiome, metabolome and immune system. For several of these modalities, the HPP is the first or largest cohort of its kind. Our analyses of this data provide novel insights into the variation of phenotypes with age and ethnicity, highlighting the importance of having ethnically diverse cohorts and the need for establishing age-dependent norms. We demonstrate how the HPP can be used to unravel personalized molecular signatures of disease by comparison to patient-specific and disease-specific matched healthy controls. Leveraging the extensive dietary and lifestyle HPP data, we systematically identify associations between lifestyle factors and health outcomes. Finally, we present a multi-modal foundation AI model that is trained using self-supervised learning on diet and CGM data and outperforms existing methods in predicting future onset of disease. We extend this AI framework to integrate all data modalities of each subject as a continuous sequence of diverse medical events, creating a digital twin that can simulate interventions and predict health trajectories and outcomes.

  Study EGAS00001008040

• Whole genome sequencing of a breast cancer cohort with known functional homologous recombination status

  Optimal patient selection for PARP inhibitors and double strand break (DSB) inducing chemotherapy is of great clinical importance. In principle, the use of these therapies can be extended beyond germline BRCA1/2 mutated cancers. Although several methods for detection of BRCA-like tumors have been developed, a golden standard is lacking. We have developed the RECAP test, a functional HR assay exploiting the formation of RAD51 foci in proliferating cells after ex vivo irradiation of fresh primary breast cancer (BrC) tissue. The RECAP test seems robust and has an advantage over genetic tests, due to its functional character for exploring the HR phenotype. Another type of HRD test is the BRCAness classifier, which is based on specific genomic patterns derived from copy number data of BRCA1/2 mutated BrCs that also occur in sporadic cancers. The BRCAness classifier is a robust test that is easily applicable in the clinic and has also been validated to predict in vivo response to high dose chemotherapy in clinical trials. More recently, a new HRD test based on genomic signatures which can be extracted from whole genome sequencing has been published, HRDetect. Studies comparing these different HRD tests within the same cohort of patients do not yet exist. Here, we have the unique opportunity to compare three HRD tests within the same cohort. We aim to compare three different HRD tests (RECAP, BRCAness classifier and HRDetect) within the same cohort of primary BrCs (n=41). As a secondary aim, we will analyze additional genetic alterations in HRD tumors (both BRCA-deficient and BRCA-proficient HRD tumors).

  Study EGAS00001005572

• A transcriptomic approach to understand patient susceptibility to pneumonia after abdominal surgery

  Rationale Nosocomial infections are a major healthcare challenge, developing in over 20% of patients aged 45 or over undergoing major-abdominal surgery, with postoperative pneumonia associated with an almost five-fold increase in 30-day mortality. Objectives To describe immune-pathways and gene-networks altered following major-abdominal surgery and identify transcriptomic patterns associated with postoperative pneumonia. Methods and Measurements From a prospective consecutive cohort (n=150) undergoing major-abdominal surgery whole-blood RNA was collected preoperatively and at three time-points postoperatively (2-6, 24 and 48hrs). Twelve patients diagnosed with postoperative pneumonia and 27 matched patients remaining infection-free were identified for analysis with RNA-sequencing. Main Results Compared to preoperative sampling, 3,639 genes were upregulated and 5,043 downregulated at 2-6hrs. Pathway-analysis demonstrated innate-immune activation with neutrophil-degranulation and Toll-like-receptor signalling upregulation alongside adaptive-immune suppression. Cell-type deconvolution of preoperative RNA-sequencing revealed elevated S100A8/9-high neutrophils alongside reduced naïve CD4 T-cells in those later developing pneumonia. Preoperatively, a gene-signature characteristic of neutrophil-degranulation was associated with postoperative pneumonia acquisition (P=0.00092). A previously reported Sepsis Response Signature (SRSq) score, reflecting neutrophil-dysfunction and a more dysregulated host response, at 48hrs postoperatively, differed between patients subsequently developing pneumonia and those remaining infection-free (P=0.045). Analysis of the novel neutrophil gene-signature and SRSq scores in independent major-abdominal surgery and polytrauma cohorts indicated good predictive performance in identifying patients suffering later infection. Conclusions Major-abdominal surgery acutely upregulates innate-immune pathways while simultaneously suppressing adaptive-immune pathways. This is more prominent in patients developing postoperative pneumonia. Preoperative transcriptomic signatures characteristic of neutrophil-degranulation and postoperative SRSq scores may be useful predictors of subsequent pneumonia risk.

  Study EGAS00001007229

• A catalog of the genetic causes of Hereditary Angioedema in the Canary Islands (Spain)

  Hereditary angioedema (HAE) is a rare disease where known causes involve C1 inhibitor dysfunction or dysregulation of the kinin cascade. The updated HAE management guidelines recommend performing genetic tests to reach a precise diagnosis. Unfortunately, genetic tests are still uncommon in the diagnosis routine. Here, we characterized for the first time the genetic causes of HAE in affected families from the Canary Islands (Spain). Whole-exome sequencing data was obtained from 41 affected patients and unaffected relatives from 29 unrelated families identified in the archipelago. The Hereditary Angioedema Database Annotation (HADA) tool was used for pathogenicity classification and causal variant prioritization among the genes known to cause HAE. Manual reclassification of prioritized variants was used in those families lacking known causal variants. We detected a total of eight different variants causing HAE in this patient series, affecting essentially SERPING1 and F12 genes, one of them being a novel SERPING1 variant (c.686-12A>G) with a predicted splicing effect which was reclassified as likely pathogenic in one family. Altogether, the diagnostic yield by assessing previously reported causal genes and considering variant reclassifications according to the American College of Medical Genetics guidelines reached 66.7% (95% Confidence Interval [CI]: 30.1-91.0) in families with more than one affected member and 10.0% (95% CI: 1.8-33.1) among cases without family information for the disease. Despite the genetic causes of many patients remain to be identified, our results reinforce the need of genetic tests as first-tier diagnostic tool in this disease, as recommended by the international WAO/EAACI guidelines for the management of HAE.

  Study EGAS00001006547

• Transcriptome of Chronic Pain and Disease

  The Functional Genomics Section (FGS) is a part of the National Institute of Dental and Craniofacial Research (NIDCR) within the National Institutes of Health (NIH). Research at the FGS focuses on understanding the mechanics involved in nociception through both clinical samples from patients with chronic pain and mouse models of pain. Pain is relayed from the periphery to the central nervous system through specialized sensory neurons known as nociceptors. The cell body of nociceptors resides in neuronal structures that branch off of the spinal cord known as dorsal root ganglia (DRG). The DRG is a heterogenous tissue containing not only sensory neurons like nociceptors, but also glial cells, capillaries, fibroblasts, and resident macrophages. The interaction between the nociceptors and these DRG cell types can have a significant role in affecting neuronal hyperexcitability and downstream pain sensitivity. To better understand the cellular factors involved in producing conditions of chronic pain, DRGs from consenting organ donors were collected from individuals experiencing pain disorders such as painful diabetic neuropathy and rheumatoid arthritis. A multi-omics approach is being used to identify molecular mechanisms that lead to pain hypersensitivity in patients with chronic pain.  

  Study phs002548

• Whole Exome Sequencing in Alopecia Areata Identifies Rare Mutations in KRT82

  Alopecia areata (AA) is an autoimmune disorder, in which the body's own immune cells attack hair follicels resulting in hair loss. It is a complex genetic disease with 14 associated loci previously identified in our genome-wide association study (GWAS). In the study, we performed the whole-exome sequencing (WES) on 849 AA patients with the aim to identify the novel rare variants in genes contributing to AA susceptibility. We performed gene-collapsing analyses and identified keratin 82 (KRT82 Gene ID: 3888) as the highest associated AA gene in the three rare damaging collapsing models with p<6.7E-07 in one of the models. The KRT82 gene is a hair-specific type II keratin expressed in the hair shaft cuticle during the anagen phase of the hair cycle. We reported the lower expression of KRT82 in AA hair follicles, compared to controls, and the KRT82 expression is absent from the bulb region, the site of AA immune attack. This study emphasizes the significance of using WES and gene collapsing analyses to identify rare variation in a functionally relevant risk gene using a moderate sample size.  

  Study phs002632

• Whole Genome Sequencing in the Inner City Asthma Consortium (ICAC) Cohorts

  We performed whole-genome sequencing on individuals from the Asthma Phenotypes in the Inner City (APIC) and Urban Environment and Childhood Asthma (URECA) study cohorts, which consist of children with asthma who live in low-income neighborhoods across 10 U.S. cities. APIC was a one-year, prospective, observational study of children ages 6-17 with asthma. URECA was a prospective, observational study featuring a birth cohort of children with a high risk of developing asthma based on family history. We performed whole-genome sequencing on 1,035 individuals (ages 5-17 yrs; 67% Black, 25% Hispanic; 66% with MD-diagnosed asthma; APIC=508, URECA=527). Sequence read processing, quality control, and variant calling were performed using the Genome Analysis Toolkit suite (GATK v4). Variant call sites were annotated according to the filters applied in our common variant (minor allele frequency ≥ 1%) association studies, based on predicted false positive rates, genotype quality and depth, and population-adjusted Hardy-Weinberg equilibrium. Principal components of ancestry were calculated using high quality, linkage-disequilibrium-pruned single-nucleotide variants, accounting for subject relatedness, using PC-Air and PC-Relate.

  Study phs002921

• Whole Genome Association Study of Systemic Lupus Erythematosus

  The goal of this collaborative study was to identify new genetic risk factors for Systemic Lupus Erythematosus (SLE). To do this we conducted a genome-wide scan by combining the resources and expertise from a number of SLE researchers to establish a large sample set comprising 1311 SLE cases and 3340 controls. The SLE case samples were genotyped from the following collections: 338 subjects from the Autoimmune Biomarkers Collaborative Network (ABCoN), an NIH/NIAMS funded repository, 141 subjects from the Multiple Autoimmune Disease Genetics Consortium (MADGC), 613 subjects from the University of California San Francisco (UCSF) Lupus Genetics, and 335 subjects from the University of Pittsburgh Medical Center (UPMC), plus 8 samples collected at The Feinstein Institute for Medical Research. A total of 3583 control samples were examined in the association analyses. As part of this project, 1861 control samples were selected and then genotyped from the New York Cancer Project (NYCP), based on self-described ethnicity, gender and age. In addition, genotype data from 1722 control samples (all self-described North Americans of European descent) were obtained from the publicly available iControlDB database (http://www.illumina.com/pages.ilmn?ID=231).

  Study phs000122

• Genetic Epidemiology of Ovarian Cancer Histotypes

  Epithelial ovarian cancer is a highly fatal malignancy with known genetic etiology; however, it is estimated that a substantial portion of narrow sense heritability remains to be discovered. The goal of this research was to use genetic information from distantly related ovarian cancer cases to identify regions of the genome that may harbor rare risk variants for epithelial ovarian cancer. The study was conducted in the setting of the Utah Population Database, a statewide data resource in which extensive ancestry data are linked to Utah Cancer Registry records. Focusing on families with a statistically significant excess risk of epithelial ovarian cancer, we used the Infinium Global Screening Array v.3.0 to generate germline genotyping data for distantly related cases. We then applied Shared Genomic Segment Analysis to each set of related cases to identify genomic regions that may harbor ovarian cancer risk variants. Eleven regions were identified. Genotype data are available through dbGaP for one case from each pedigree. Genotype data from other ovarian cancer cases within the high-risk pedigrees as well as the pedigrees' corresponding structures can be requested and made available with approval from the Utah Resource for Genetic and Epidemiologic Research (RGE).

  Study phs003140

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Molecular Determinants of Esophageal Cancer in Tanzania

  We describe the genomic profiles of 61 esophageal squamous cell carcinoma (ESCC) cases from Tanzania and compare them to profiles from an existing cohort of ESCC cases from Malawi. We also provide a comparison to ESCC tumors in The Cancer Genome Atlas Program (TCGA). Despite a high burden of ESCC in Eastern Africa, investigations into the genomics in this region are nascent. This represents the largest comprehensive genomic analysis of ESCC from sub-Saharan Africa to date. We observed substantial transcriptional overlap with other squamous histologies via comparison with TCGA PanCan dataset. DNA analysis revealed known mutational patterns, both genome-wide as well as in genes known to be commonly mutated in ESCC. TP53 mutations were the most common somatic mutation in tumors from both Tanzania and Malawi but were detected at lower frequencies than previously reported in ESCC cases from other settings. In a combined analysis, two unique transcriptional clusters were identified: a proliferative/epithelial cluster and an invasive/migrative/mesenchymal cluster. Mutational signature analysis of the Tanzanian cohort revealed common signatures associated with aging and cytidine deaminase activity and an absence of signature 29, which was previously reported in the Malawi cohort.

  Study phs003217

• Whole-Exome Sequencing Study of Diabetic Nephropathy

  To identify rare variants of diabetic kidney disease (DKD), we conducted a whole-exome sequencing (WES) study. This study employed an extreme case–control design, which included a selection of the 593 most rapidly progressing DKD cases from the Chronic Renal Insufficiency Cohort (CRIC) Study (phs000524). In this two-stage WES study of DKD, participants with DKD from the CRIC were compared with control groups of participants without DKD from another cohort in the first stage. Suggestive signals identified in the first stage were confirmed in the second stage analysis among a diverse population with existing whole-genome sequencing (WGS) data. Generalized linear mixed models, which accounted for genetic relatedness and adjusted for age, sex and ancestry, were used to test associations between single variants and DKD. Gene-based aggregate rare variant analyses were conducted using an optimized sequence kernel association test implemented within our mixed model framework. As a result, we identified four novel gene loci, DIS3L2, KRT6B, ERAP2 and NPEPPS, that achieved exome-wide significance and may play an important role in the DKD disease course. This large WES study provides novel insights into DKD's molecular mechanisms.

  Study phs003429

• Temporal Evolution Reveals Bifurcated Lineages in Aggressive Neuroendocrine Small Cell Prostate Cancer Trans-Differentiation

  Trans-differentiation from adenocarcinoma to small cell neuroendocrine (SCN) cancer is an adverse consequence of treatment escape in various cancers, including prostate, lung, and bladder cancers (Balanis and Sheu et al., PMID 31287989). Expression of dominant negative p53 (TP53DN), myrAkt1, RB1-shRNA, c-Myc, and Bcl2(PARCB forward transformation) using human naïve prostate basal epithelial cells recapitulated both transcriptional and histological characteristics of small cell neuroendocrine prostate cancer (NEPC) (Park et al., PMID 30287662). To study the temporal transcriptional landscape during this trans-differentiation process, we conducted a time course study using a PARCB model by integrating multi-omics sequencing, including bulk RNA-sequencing and ATAC-sequencing on samples taken at different time point, as well as single cell RNA sequencing on serial xenograft tumors. We found a common SCN pathway that resulted in two distinct end states defined by mutually exclusive expression of ASCL1 and ASCL2. Further investigation using CUT&RUN sequencing identified TFAP4 as a potential epigenetic regulator of both proteins. Our study reveals temporal and transcriptional changes from prostate adenocarcinoma to NEPC trans-differentiation.

  Study phs003230

• Immunogenetics of BCG Vaccination and Pediatric Tuberculosis

  We examined genetic variation associated with BCG-induced innate immune responses and susceptibility to pediatric tuberculosis (TB) disease. South African study participants were enrolled at the South African Tuberculosis Vaccine Initiative (SATVI) as part of a larger BCG vaccination study. This area has one of the highest rates of TB incidence in the world. Infants were vaccinated with BCG at birth, and a nested case-control study was performed over a 2-year prospective observation period, which resulted in 135 infant TB cases and 521 controls. Whole blood was collected from BCG vaccinated infants at 10 weeks of age. Genotyping was performed with the llumina MegaEx Beadchip, and GWAS was performed against TB disease to assess for associations between genetic variants and susceptibility to TB. In addition, a subset of infants were assessed for BCG-induced innate immune responses (N=198). For these, whole blood was stimulated with BCG or media and flow cytometry was used to measure BCG-induced PDL1, CD40, and cytokine expression in myeloid (mDC) and plasmacytoid (pDC) dendritic cells, monocytes, and neutrophils. Cellular GWAS was then performed to associate genetic variants with BCG-induced immune responses.

  Study phs003406

• Development of cell lines and mouse models of bone and soft tissue sarcoma to establish novel treatment

  Malignant giant-cell tumors are extremely rare bone sarcomas that transform from conventional giant-cell tumors during long periods of treatment. We have applied the culture methods and succeeded in establishing patient-derived organoids (PDO) of rare sarcomas. This study aimed to investigate the genomic characteristics of our established novel organoids from human malignant giant-cell tumors. The developed tumors with xenograft were genomically analyzed to compare their characteristics with those of the original tumors. Genetic changes over time throughout treatment were analyzed, and the genomic status of the established organoid was confirmed. Next generation sequencing revealed that the established organoids lacked the H3-3A G34W mutation. The xenografted organoids of the malignant giant-cell tumor had phenotypes genetically similar to those of the original tumor. The established organoids were confirmed to be derived from human malignant giant-cell tumors. In summary, the present study demonstrated a novel organoid model of a malignant giant-cell tumor that was genetically confirmed to be a malignant transformed tumor. Our organoid model could be used to elucidate the molecular pathogenesis of a malignant giant-cell tumor and develop novel treatment modalities.

  Study JGAS000618

• High-coverage whole-genome sequencing reveals structural variations in triple-negative breast cancer

  Triple-negative breast cancer (TNBC) cells do not express estrogen receptors, progesterone receptors or human epidermal growth factor receptor 2 (HER2). Currently, apart from poly ADP-ribose polymerase (PARP) inhibitors, there are few effective therapeutic options for this cancer type. Here, we present a comprehensive characterization of genetic alterations in TNBC via high-coverage whole-genome sequencing along with transcriptomic and whole-exome sequencing. Silencing of BRCA1 gene impaired the homologous recombination (HR) pathway in a subset of TNBC, which exhibited similar phenotypes with tumors with BRCA1 mutations; they harbored many structural variations (SVs) with relative enrichment for tandem duplication. Clonal analysis suggested that TP53 mutations and methylation of CpG dinucleotides in the BRCA1 promoter were the early events of carcinogenesis. SVs were associated with driver oncogenic events such as amplification of MYC, NOTCH2 or NOTCH3 and impacted tumor suppressor genes including RB1, PTEN and KMT2C. We also identified a variety of oncogenes that could transform 3T3 mouse fibroblast cells, suggesting that individual TNBC tumors may undergo a unique driver event that can be targetable. Thus, we revealed several features of TNBC that had important clinical implications.

  Study JGAS000095

• Single cell atlas of large B-cell lymphoma

  Large B-cell lymphomas (LBCL) are clinically and biologically heterogeneous lymphoid malignancies, shaped by complex tumor and microenvironments that play a critical role in disease progression. There has been no direct and comprehensive single-cell characterization of tumor microenvironment in LBCL that simultaneously captures lymphoid, myeloid, and stromal populations across a sufficiently large cohort to reveal reproducible and biologically meaningful patterns. Here, we performed single-nucleus multiome profiling, coupled with bulk DNA and RNA sequencing, on 232 tumor and control biopsies to comprehensively map cell subpopulations of LBCL. Through this integrative approach, we identified Lymphoma Microenvironment Archetype Profiles (LymphoMAPs)—distinct, reproducible patterns defined by the co-occurrence of functionally specialized cell subsets. We further characterized the cell-cell communication pathways that shape these transcriptional phenotypes within archetypes. Importantly, we discovered associations between specific LymphoMAPs and clinical and molecular features of LBCL, including response to CD19 CAR T-cell therapy. Our study provides a valuable resource of lymphoid, myeloid, and non-hematopoietic cell states in LBCL and offers a framework for understanding how the abundance and functional state of cells within the tumor microenvironment may drive inter-patient variability in therapeutic outcome.

  Study EGAS50000001022

• Novel regional age-associated DNA methylation changes within human common disease-associated loci

  Background: Advancing age progressively impacts on risk and severity of chronic disease. It also modifies the epigenome, with changes in DNA methylation, due to both random drift and variation within specific functional loci. Results: In a discovery set of 2,238 peripheral-blood genome-wide DNA methylomes (MeDIP-seq) aged 19-82 years, we identified 71 age-associated Differentially Methylated Regions (a-DMRs, p < 1.85 x 10-8) within the Linkage Disequilibrium (LD) blocks of the NIH Catalogue of published GWAS SNPs. This included 52 novel regions, 29 within loci not covered by 450k or 27k Illumina array, and with marked enrichment for Poised Promoters and Enhancers across multiple cell types. In a replication set of 2,084 DNA methylomes, 95.7% of the a-DMRs showed the same direction of ageing effect, with 80.3% and 53.3% replicated to p < 0.05 and p < 1.85 x 10-8, respectively. Conclusion: By analysing the functionally enriched disease and trait-associated regions of the human genome, we identified novel epigenetic ageing changes, which could be useful biomarkers or provide mechanistic insights into age-related common diseases.

  Study EGAS00001001910

• Whole-genome methylation profiling of menstrual stem cells identifies novel biomarkers for endometriosis

  Endometriosis is a highly prevalent condition that remains underdiagnosed and poorly managed due to the lack of clinically validated biomarkers and limited understanding of its underlying pathophysiology. Although menstrual blood–derived stem cells (MenSCs) have been implicated in disease pathogenesis, their potential as a diagnostic source has not been systematically explored. We conducted a clinical study including 42 women (19 with endometriosis and 23 controls) to evaluate whether DNA methylation profiles from freshly isolated MenSCs could identify disease-specific biomarkers. Whole-genome DNA methylation sequencing identified differentially methylated regions (DMRs) enriched in genes associated with key features of endometriosis, including inflammation, tissue remodelling, and developmental processes. These DMRs robustly discriminated cases from controls, independently of technical and clinical confounders. Machine learning models trained and validated on these regions demonstrated strong diagnostic performance (specificity 83%, sensitivity 79%). Integration with an independent single-cell RNA sequencing dataset suggested that the identified DMRs may influence gene expression, supporting their biological relevance. Collectively, these findings highlight MenSC DNA methylation profiling as a promising, non-invasive strategy for early diagnosis and personalised management of endometriosis. (PubMed IDs will be provided once the manuscript is published.)

  Study EGAS50000001640

• Distinct portrayal of lesions in synchronous multifocal lung adenocarcinoma revealed by genome sequencing

  Distinguishing multiple primary lung cancers in the synchronous multifocal intrapulmonary lesions has important significance on clinical staging and therapeutic decision. To investigate genomic aberration profiles, we applied whole genome and whole exome sequencing, and microarray-based comparative genomic hybridization on 15 intrapulmonary tumors derived from six patients with synchronous multifocal lung cancers having similar histological diagnosis. Any pair of intrapulmonary tumors in a single patient, which shared the identical genetic background and environment, showed an extinctive heterogeneity between each other. Phylogenetic relationship analysis indicated an independently branched evolution among all the tumors, suggesting they were multiple primary lung cancers. EGFR or KRAS mutations were found in 7 or 3 out of the 15 tumors, from 3 or 2 patients, respectively. Somatic mutational heterogeneity of these two genes in a single patient was also observed. Our analysis indicates genomic aberration profiling is valuable for identification of multiple primary lung cancer, especially when high histopathological concordance was observed between lesions. We also suggest a thoroughly molecular diagnosis against therapeutic target genes should be taken for each accessible nodule before making a plan for adjuvant therapy.

  Study EGAS00001001572

• Genome-wide cell-free DNA fragmentation in patients with cancer

  Cell-free DNA (cfDNA) in the blood provides a noninvasive diagnostic avenue for patients with cancer. However, characteristics of the origins and molecular features of cfDNA are poorly understood. We developed an approach to evaluate fragmentation patterns of cfDNA across the genome and found that cfDNA profiles of healthy individuals reflected nucleosomal patterns of white blood cells, while patients with cancer had altered fragmentation profiles. We applied this method to analyze fragmentation profiles of 236 patients with breast, colorectal, lung, ovarian, pancreatic, gastric, or bile duct cancers and 245 healthy individuals. A machine learning model incorporating genome-wide fragmentation features had sensitivities of detection ranging from 57% to >99% among the seven cancer types at 98% specificity, with an overall AUC of 0.94. Fragmentation profiles could be used to identify the tissue of origin of the cancers to a limited number of sites in 75% of cases. Combining our approach with mutation based cfDNA analyses detected 91% of cancer patients. The results of these analyses highlight important properties of cfDNA and provide a proof of principle approach for screening, early detection, and monitoring of human cancer.

  Study EGAS00001003611

• Germline mutations in the transcription factor IKZF5 cause thrombocytopenia.

  To identify novel causes of hereditary thrombocytopenia, we performed a genetic association analysis of whole-genome sequencing data from 13,037 individuals enrolled in the NIHR BioResource, including 233 cases with isolated thrombocytopenia. We found an association between rare variants in the transcription factor encoding gene IKZF5 and thrombocytopenia. We report five causal missense variants in or near IKZF5 zinc fingers (Znfs), of which two occurred de novo and three co-segregated in three pedigrees. A canonical DNA-Znf binding model predicts that three of the variants alter DNA recognition. Expression studies showed that chromatin binding was disrupted in mutant compared to wild-type (WT) IKZF5 and electron microscopy revealed a reduced quantity of alpha granules in normally sized platelets. Proplatelet formation (PPF) was reduced in megakaryocytes (MKs) from seven cases relative to six controls. Comparison of RNA-seq data from platelets, monocytes, neutrophils and CD4 T-cells from three cases and 14 healthy controls showed 1,194 differentially expressed genes in platelets but only four DEGs in each of the other blood cell types. In conclusion, IKZF5 is a novel transcriptional regulator of megakaryopoiesis and the eighth transcription factor associated with dominant thrombocytopenia in humans.

  Study EGAS00001003736

• RNA sequencing and Illumina 2.5M SNP array data collected from 675 commonly used human cancer cell lines.

  Tumor-derived cell lines have served as vital models to advance our understanding of oncogene function and therapeutic response1. Although substantial effort has been directed to defining the genomic constitution of cancer cell line panels2–4, the transcriptome – which represents the active program of a cell – remains understudied. Here, we describe RNA sequencing and SNP array analysis of 675 commonly used human cancer cell lines. We explore numerous transcriptome features including coding and non-coding gene expression, transcribed mutations, gene fusion and expression of non-human sequences. Aside from many known aberrations we find new surprising characteristics, including more than 2200 unique fusion gene pairs representing a vast, testable repertoire of oncogenic fusions, many of which have analogs found in primary human tumors. We show that a combination of multiple genome and transcriptome features in a novel pathway-based approach enhances prediction of response to various targeted therapeutics. Our results provide valuable new insights into these critical pre-clinical models and provide added context for interpreting the numerous studies that employ these widely used cell lines.

  Study EGAS00001000610

• Single-cell multidimensional profiling of tumor cell heterogeneity in supratentorial ependymomas

  Supratentorial ependymomas (ST-EPNs) are aggressive and treatment-resistant pediatric brain tumors that form along the human cortex, with suspected origin from radial glia cells. Although histologically similar, ST-EPNs are molecularly classified into six distinct subgroups, many of them remaining understudied. Here, we integrated molecular cell states and spatial architecture to resolve the cellular origins and aberrant differentiation trajectories of ST-EPNs at single-cell resolution. We show that, while all ST-EPNs display a unified origin from neuroepithelial cells, different subgroups harbor highly diverse cell states and differentiation potential associated with neural or ependymal differentiation. Spatial mapping uncovered a higher-order structural tumor organization driven by presence of the mesenchymal state, and refines classical histological features based on detailed molecular resolution. By benchmarking a morpho-molecular cell-state classification system in different disease models and human tumors, we identified four cellular subtypes defined by the architecture of neurite-like extensions that mediate either self-renewal or fast, saltatory invasive phenotypes reminiscent of neurons during neurodevelopment. Collectively, our study provides a comprehensive framework for the study of ST-EPN cellular states, and reveals biologically relevant tumor compartmentalization with potential clinical implication.

  Study EGAS50000001513

• Whole genome and transcriptome analysis of medullary thyroid cancer

  Medullary thyroid cancer is the neoplasm of the calcitonin-producing parafollicular cells of the thyroid gland. The hormone calcitonin acts to lower the blood calcium level, counteracting the effects of the parathyroid hormone; it can also serve as a biomarker for the presence or recurrence of medullary thyroid cancer. Surgery is the only curative treatment for this cancer. Targeted therapeutics vandetanib and cabozantinib are approved for the treatment of aggressive and metastatic tumors that are not amenable to surgery. The use of these multikinase inhibitors are supported by the observed overactivation of the RET oncoprotein in a large sub-population of medullary thyroid cancers; however, not all patients carry oncogenic alterations of this kinase. Hence, there is a need for molecular characterization of medullary tumors on the genomic scale with the aim of identifying targetable mutations. Here, we describe the genomic profiles of two medullary thyroid cancers and report the presence of a putative oncogenic BRAF fusion in one. Such alterations previously observed in other malignancies and known targets of available drugs, can benefit patients who currently have no therapy options.

  Study EGAS00001001473

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  Systematic discovery of transcription factor (TF) landscapes in low-input samples and at single cell level is a major challenge in the fields of molecular biology, genetics, and epigenetics. To address this, we present here cleavage under Dynamic targets and Tagmentation (DynaTag), which allows robust mapping of specific TF-DNA interactions via the use of a physiological salt solution during sample preparation. Using this method, we revealed occupancy alterations for 15 different TFs in stem cell and cancer tissue models. Of note, we showcased for NANOG, MYC, and OCT4 differentially occupied genomic loci during stem cell differentiation, both in bulk and at single-cell resolution. DynaTag demonstrated superior signal-to-background ratio and occupancy resolution in comparison to CUT&RUN and ChIP-seq. In addition, a model for small cell lung cancer chemotherapy treatment in vivo showed increased chromatin occupancies of the gain-of-function mutant P53 p.R248Q, FOXA1, and MYC at altered gene pathways, such as epithelial-mesenchymal-transition. Altogether, these results highlight the technical advancement of DynaTag to uncover TF landscapes in cell models and in tissues of a complex disease model.

  Study EGAS50000001074

• Whole exome sequencing of bladder tumors

  Bladder carcinomas are immunogenic, and patients with bladder cancer benefit from immune checkpoint therapy. This is correlated to a high tumor mutation burden, which provides a higher number of neoepitopes that can be recognized by tumor-specific CD8+ T cells. Intravesical Bacillus Calmette-Guérin (BCG) is used to treat non-muscle invasive bladder cancer (NMIBC), but its mechanism of action remains elusive. Most lymphocytes appearing in the urine of BCG-treated patients are CD4+ T cells though preclinical studies showed that CD8+ T cells are also necessary for BCG treatment efficacy. It is currently unknown which proportion of patients with non-metastatic bladder cancer develop a spontaneous antitumor CD8+ response, and if BCG treatment influences this response. were prepared using the xGen Dual Index UMI Adapters (IDT), and genomic DNA (gDNA) extracted (DNeasy kit, Qiagen) from formalin-fixed paraffin- embedded (FFPE) or snap-frozen tumor tissue, as well as autologous lymphocytes. Libraries were subjected to paired-end sequencing using Illumina HiSeq4000 with a coverage depth of 250X. Library preparation was carried out with the AllType FASTplex NGS 11 Loci Flex Kit (One Lambda), and sequencing was conducted on the Illumina MiSeq platform.

  Study EGAS50000001248

• Low and variable tumor reactivity of the intratumoral TCR repertoire in human cancers

  Infiltration of human cancers by T cells is generally interpreted as a sign of immune recognition, and there is a growing effort to reactivate dysfunctional T cells at such tumor sites. However, these efforts only have value if the intratumoral T cell receptor (TCR) repertoire of such cells is intrinsically tumor-reactive, and this has not been established in an unbiased manner for most human cancers. To address this issue, we analyzed the intrinsic tumor-reactivity of the intratumoral TCR repertoire of CD8+ T cells in ovarian and colorectal cancer – two tumor types for which T cell infiltrates form a positive prognostic marker. Data obtained demonstrate that a capacity to recognize autologous tumor is limited to approximately 10% of intratumoral CD8+ T cells. Furthermore, in two out of four patient samples tested, no tumor-reactive TCRs were identified, despite infiltration of their tumors by T cells. These data indicate that the intrinsic capacity of intratumoral T cells to recognize adjacent tumor tissue can be rare and variable, and suggest that clinical efforts to reactivate intratumoral T cells will benefit from approaches that simultaneously increase the quality of the intratumoral TCR repertoire.

  Study EGAS00001003119