17281 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 58.46 milliseconds.

• UKKi019-B / SAMEA17626168 WGS data

  The iPSC line UKKi019-B / SAMEA17626168 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line UKKi019-B is available for research use at www.EBiSC.org.

  Dataset EGAD50000001096

• Total RNA sequencing of fibroblasts from an individual with fragile X syndrome

  Total RNA sequencing of fibroblasts from an individual with a methylated CGG repeat >200x in the FMR1 5'UTR. Libraries were prepared with total RNA with Ribo-Zero ribosomal RNA depletion (illumina), and sequenced paired-end, 75bp on a NextSeq 550 system. This dataset contains three RNA-sequencing replicates from the same cell line.

  Dataset EGAD50000000920

• Sequencing data for ICGC Oesophageal Adenocarcinoma tissue samples - 100

  Samples from the "100" project that are in the ICGC PanCancer project.

  Dataset EGAD00001001071

• Whole-exome sequencing of liver cancer organoids

  Whole-exome sequencing was performed from organoids derived from 10 liver cancer biopsies (7 hepatocellular carcinoma and 3 cholangiocarcinoma), corresponding liver and non-tumoral biopsies. For 3 of the organoids, both early and late passage organoids were sequenced. Whole-exome sequencing was performed using the Agilent Clinical Research Exome capture kit followed by Illumina sequencing. BAM files are provided in this dataset.

  Dataset EGAD00001004205

• Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011290

• WXS Tumor Samples Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011680

• Metagenome for FINRISK2002

  The dataset contains data for n=7211 FINRISK 2002 participants who underwent fecal sampling. Demultiplexed shallow shotgun metagenomic sequences were quality filtered and adapter trimmed using Atropos (Didion et al., 2017), and human filtered using Bowtie2 (Langmead and Salzberg, 2012). The files are in FASTQ format.

  Dataset EGAD00001007035

• Epigenetic landscape of mixed phenotype leukemias

  Leukemias with ambiguous lineage comprise a number of loosely defined entities, often without a clear mechanistic basis. Here, we investigated a group of such leukemias with a CpG Island Methylator Phenotype (CIMP), previously identified as CEBPA-silenced AML. Transcriptomics and epigenomics analyses revealed a hybrid myeloid/lymphoid epigenetic landscape, whereas genetic alterations were heterogenous. This suggests that CIMP leukemias are defined by their shared epigenetic profile rather than a common genetic lesion. Gene expression enrichment showed strong similarity with ETP-ALL and an early lymphoid progenitor cell of origin. Accordingly, integration of differential methylation and expression revealed widespread silencing of myeloid transcription factors (TFs), among which CEBPA was key for differentiation arrest. Hypermethylation also resulted in loss of CTCF binding, accompanied by a few changes in chromatin interactions involving critical TFs like KLF4. In conclusion, epigenetic dysregulation, and not genetic lesions, explain the mixed phenotype of a group of CIMP leukemias resembling ETP-ALL.

  Study EGAS00001007094

• Molecular characterization of T-PLL by Next-Generation Sequencing

  Patients with T-cell prolymphocytic leukemia (T-PLL) were profiled with multiple OMICS approaches based on Next-Generation Sequencing (NGS). In total, data from RNA-Seq, Whole-Exome Sequencing, Whole-Genome Sequencing and amplicon panel analyses in 134 samples are available. All samples were processed as paired-end libraries on Illumina sequencing machines. The data are available as paired FastQ files.

  Dataset EGAD00001003825

• Whole exome sequencing of Ewing sarcoma and CIC-DUX4 sarcoma

  Whole exome sequencing of a collection of 6 Ewing sarcoma and 3 CIC-DUX4 sarcoma tumoroids plus 4 matched patient tumors and normal tissue. Tumoroids were established from digested patient tumor material as 3D culture in Matrigel. After 2-3 month of growth, Genomic DNA was isolated from individual tumoroid models using the DNeasy Blood & Tissue Kit (Qiagen) and used for whole exome sequencing. Genomic DNA from corresponding patient tumors and matched normal tissue was tested in parallel, if available.

  Dataset EGAD50000000556

• Single-cell RNA sequencing of metastatic colorectal cancer organoids treated with cetuximab

  Organoids were seeded in 12-well plates at a density of 5 × 10⁴ cells per well, embedded in 200 µL of Matrigel diluted 1:1 with culture medium, and maintained under EGF-deprived conditions. After four days of growth, organoids were either left untreated or treated with cetuximab (20 µg/mL). Following 72 hours of treatment, organoids were harvested, dissociated, and live single cells were sorted for single-cell RNA sequencing using the 10x Genomics platform.

  Dataset EGAD50000002104

• FFPE

  The mutational status of 112 recurrently mutated genes in B-cell lymphoma was examined by targeted next-generation sequencing (NGS). Libraries were performed with 150 ng of genomic DNA (gDNA) obtained from formalin-fixed paraffin-embedded (FFPE) biopsy using molecular-barcoded library adapters (ThruPLEX Tag-seq kit; Takara) coupled with a custom hybridization capture based method (SureSelect XT Target Enrichment System Capture strategy, Agilent Technologies Inc.) and sequenced in a MiSeq instrument (Illumina, 2x150bp).

  Dataset EGAD00001006565

• Type I Interferon and Cycling Lymphocytes in Macrophage Activation Syndrome

  We performed immune profiling of peripheral blood mononuclear cells from patients with Still's disease and macrophage activation syndrome (MAS) using bulk RNA sequencing and single-cell RNA sequencing. Three groups were included in the study: healthy controls, patients with Still's disease without macrophage activation syndrome, and patients with Still's disease and macrophage activation syndrome. We found that macrophage activation syndrome is associated with transcriptomic signatures of interferon upregulation and cell cycling. We identified cycling lymphocytes within T cell and NK cell populations that are correlated with MAS disease activity. All sequencing data are available through dbGaP.

  Study phs003310

• Single-Cell Atlas of Common Variable Immunodeficiency shows germinal center-associated epigenetic dysregulation in B cell responses

  Common variable immunodeficiency (CVID) is the most prevalent primary immunodeficiency. Here the authors perform single cell omics analyses in CVID discordant monozygotic twins and show epigenetic and transcriptional alterations associated with activation in memory B cells.

  Dataset EGAD00001008575

• Pangenomic classification of pituitary adenomas

  Pituitary neuroendocrine tumors (PitNETs) are common. They are classified in five main histological types: PitNETs of POU1F1 (Pit1) lineage -lactotroph, somatotroph and thyrotroph -, gonadotroph, and corticotroph PitNETs. Pituitary tumorigenesis is poorly understood. We report here a pangenomic characterization of 134 PitNETs from all types, based on exome, genome, transcriptome, miRnome and methylome. Pit1 lineage was associated with a specific epigenetic signature of diffuse DNA hypomethylation, and correlated with expression of Pit1 markers and chromosomal instability. 45% of somatotroph PitNETs showed GNAS mutations. GNAS-wild type somatotroph showed a distinct transcriptome profile, expressing gonadotroph transcription factor NR5A1 (SF1). Sparsely granulated somatotroph PitNETs was classified apart from somatotroph, owing to a thyrotroph transcriptome signature. 43% of corticotroph PitNETs showed USP8 mutations, sharing a low epithelial-mesenchimal transition (EMT) transcriptome signature. Silent corticotroph PitNETs showed a gonadotroph transcriptome signature evoking transdifferentiation, and lost somatostatin target SSTR5 expression.

  Study EGAS00001003642

• Sexual dimorphism in human immune system aging

  We isolated peripheral blood mononuclear cells (PBMCs) from 172 community-dwelling healthy volunteers (91 women, 81 men) ages spanning adult lifespan: 54 young (ages 22-40: 23 men, 31 women), 59 middle-aged (ages 41-64: 31 men, 28 women), and 59 older subjects (65+: 27 men, 32 women). PBMCs were profiled using ATAC-seq (54 men, 66 women), RNA-seq (41 men, 34 women), and flow cytometry (62 men, 67 women). Flow cytometry data is publicly available, genomic data for 121 individuals are provided here. These datasets revealed immune system aging signatures in men and women and showed in which ways aging differentially affects the immune systems of men and women. A subset of these samples have been generated and analyzed previously and can be found at EGA (EGAS00001002605). This dataset on dbGaP include EGA samples as well.

  Study phs001934

• Circulating Tumor Cell Heterogeneity in Neuroendocrine Prostate Cancer by Single Cell Copy Number Analysis

  Neuroendocrine prostate cancer (NEPC) is an aggressive variant of prostate cancer that may arise de novo or develop from pre-existing prostate adenocarcinoma as a mechanism of treatment resistance. Combined loss of tumor suppressors RB1, TP53, PTEN are frequent in NEPC but also present in a subset of prostate adenocarcinomas. Most clinical and preclinical studies support a trans-differentiation process, whereby NEPC arises clonally from a prostate adenocarcinoma precursor during the course of treatment resistance. Here we highlight a case of NEPC with significant intra-patient heterogeneity observed across metastases. We further demonstrate how single-cell genomic analysis of circulating tumor cells combined with phenotypic evaluation of cellular diversity can be considered as a window into tumor heterogeneity in patients with advanced prostate cancer. We performed whole genome sequencing of circulating tumor cells (CTCs) from patients with castration resistant adenocarcinoma (n=4) and neuroendocrine prostate cancer (n=8). CTCs were collected via Epic Sciences platform and single CTC genomic data (n=215) generated via Illumina NextSeq500. 

  Study phs002462

• Roche multiple sclerosis dataset

  The Roche multiple sclerosis dataset (Roche_MS) consists of 166 cortical grey matter (GM) and white matter (WM) samples from 83 unique individuals (29 controls and 54 cases). A total of 12,000 estimated cells from each sample were loaded on the 10x Single Cell Next GEM G Chip. cDNA libraries were prepared using the Chromium Single Cell 3’ Library and Gel Bead v3 kit according to the manufacturer’s instructions. cDNA libraries were sequenced using the Illumina NovaSeq 6000 System and NovaSeq 6000 S2 Reagent Kit v1.5 (100 cycles), aiming at a sequencing depth of minimum 30K reads/nucleus.

  Dataset EGAD00001009169

• MS meninges single nuclei RNA sequencing

  10X 3' (RNA) samples of isolated single nuclei from highly inflamed leptomeninges and adjacent grey matter from 3 MS patients used in the paper.

  Dataset EGAD50000001235

• Khoe-San whole genome sequencing

  High-coverage (>30X) whole genome data (FASTQ) for 25 southern African Khoe-San individuals (from five populations). These are the same individuals as in Schlebusch et al. 2020 (EGAD00001006183), but different data.

  Dataset EGAD50000001559

• Human Origins array data for 1510 individuals

  Genotype data typed on the Human Origins array for 1510 individuals published in "Dense sampling of ethnic groups within African countries reveals fine-scale genetic structure and extensive historical admixture."

  Dataset EGAD00001010015

• Whole-genome-seqeuncing IMFT

  Whole-genome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007804

• Genome-wide data for 11 Roma individuals

  This dataset includes genome-wide autosomal array data for 11 Iberian Roma individuals used in the Merchero project.

  Dataset EGAD00001007773

• ChIP-seq for GOF p53

  This dataset includes ChIP-seq data from two cell lines (HKCI-11 (GOFp53) and MIHA(WT p53)). All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005449

• WGS data of patients diagnosed with angiosarcoma

  Whole-genome sequencing (WGS) was performed for 13 pairs of tumor-normal and 5 tumor-only samples from patients diagnosed with angiosarcoma. Genomic DNA from tumor tissue was extracted with QIAamp DNA Mini Kit. The DNA for the matching normal was obtained from blood or buccal swabs and purified by Blood and Cell Culture DNA Mini kit or E.Z.N.A. Tissue DNA Kit (Omega Bio-tek) according to manufacturer’s instructions. The quantity and quality were assessed by Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) and agarose gel electrophoresis. All sequencing libraries were prepared using TruSeq Nano DNA Library Prep Kit (Illumina). Paired-end sequencing was performed on Illumina HiSeq X Ten as 2x151 bp.

  Dataset EGAD00001005366

• WGBS Discovery Samples

  The dataset contains valuable genomic data from a discovery cohort consisting of 29 individuals. This cohort is comprised of 8 healthy individuals (control), 8 patients with ST-segment elevation myocardial infarction (STEMI), 7 patients with non-ST-segment elevation myocardial infarction (NSTEMI), and 6 patients with unstable angina (UA). The genomic data was obtained by isolating cell-free circulating DNA (ccfDNA) and subjecting it to bisulfite conversion using a low-input BS-seq (PBAT) protocol. Sequencing was done on the Novaseq 6000 platform.

  Dataset EGAD00001010935

• WGS data of patients diagnosed with NKTL

  Whole-genome sequencing (WGS) was performed for 50 pairs of tumor-normal samples from patients diagnosed with NKTL. Genomic DNA from tumor tissue was extracted with QIAamp DNA Mini Kit. The DNA for the matching normal was obtained from blood or buccal swabs and purified by Blood and Cell Culture DNA Mini kit or E.Z.N.A. Tissue DNA Kit (Omega Bio-tek) according to manufacturer’s instructions. The quantity and quality were assessed by Quant-iT PicoGreen dsDNA Assay Kit (Invitrogen) and agarose gel electrophoresis. All sequencing libraries were prepared using TruSeq Nano DNA Library Prep Kit (Illumina). Paired-end sequencing was performed on Illumina HiSeq 2000 or HiSeq X Ten as 2x101 bp or 2x151 bp, respectively.

  Dataset EGAD00001005231

• Transcriptomic Profiling of Patient Derived Alternative Lengthening of Telomeres (ALT) and Non-MYCN-Amplified Neuroblastoma Cell Lines

  Patient derived neuroblastoma cell lines are excellent tools to study biology of the disease. While many previous studies sequenced neuroblastoma cell lines, there are very few ALT and non-MYCN-amplified neuroblastoma cell lines that were sequenced previously. Here, we present raw RNA sequencing data for 3 ALT (CHLA-90, SK-N-FI, COG-N-515) and 8 non-MYCN-amplified telomerase positive (CHLA-171, Felix, COG-N-579h, COG-N-615, COG-N-618h, COG-N-619h, COG-N-708h, COG-N-709) neuroblastoma cell lines. Additionally, gene expression data are provided as a supplement files.

  Study phs002421

• BAM file s of WGS data of Progressive supranuclear palsy patients

  BAM files of healthy controls (3) and Progressive supranuclear palsy (PSP) patients (4). Genomic DNA from donors was fragmented, end-polished, A-tailed, and ligated with Illumina adapters, followed by size selection. Libraries were PCR-amplified (unless PCR-free), purified with AMPure XP, assessed on the Agilent Fragment Analyzer, and quantified using Qubit and qPCR. Qualified libraries were pooled and sequenced on Illumina platforms, and low-quality reads or adapter-contaminated reads were removed. Clean data were then mapped to the hg38 reference genome using BWA.

  Dataset EGAD50000001758

• sWGS of OV04 PDX samples for ACN rascal study

  This dataset contains 148 .bam files of shallow WGS data (~0.1X) from OV04 PDX samples. Sequencing reads were aligned to the 1000 Genomes Project GRCh37-derived reference genome using the BWA aligner (v.0.07.17; CRUK-CI alignment pipeline).

  Dataset EGAD00001008119

• Human normal esophagus and Barrett's esophagus mtDNA sequencing

  BAM files containing paired-end mtDNA sequencing data from human esophageal samples of individuals that had progressed to dysplasia or developed Barrett's esophagus (BE) post-esophagectomy. BE biopsies and the background mucosa were analysed. Each patient (JE*) has associated mtDNA sequencing data from biopsies of stroma, BE and squamous and cardia tissue. Two technical replicates, denoted "A" and "B", were analysed for each biopsy. Libraries were sequenced via the Illumina MiSeq platform v2 (Illumina, San Diego, CA, USA) 300 cycles (150 nt paired-end).

  Dataset EGAD00001008310

• Whole genome sequencing on HiSeq platform of tumour-normal sample pairs from 183 melanoma cases

  Aligned, merged and deduplicated BAM files from HiSeq whole genome sequencing of 366 samples: matched tumour-normal pairs from 183 melanoma cases comprising 48 primary melanomas, 15 cell lines, and 120 metastases. Sequencing was performed on the Illumina HiSeq 2000 and Xten platforms at Australian and Korean sequencing centres. Data was aligned to the human genome (GRCh37) using BWA-MEM.

  Dataset EGAD00001003388

• HELIUS virome sequencing

  The dataset contains fecal WGS samples of 196 participants to the HELIUS study, as well as VLP filtrate sequencing for a subset of 48 participants.

  Dataset EGAD00001008765

• Small-RNA sequencing of pheochromocytoma and paraganglioma arising from germline SDHB mutations

  Single-end 75 basepair small-RNA sequencing of 90 SDHB-deficient non-metastatic and metastatic pheochromocytoma and paraganglioma. Samples were prepared using the NEXTFLEX® Small RNA-Seq Kit v3 (Bioo Scientific ). Samples were sequenced at the molecular genomics core (Peter MacCallum Cancer Centre) using 50bp single end sequencing on the Illumina NextSeq 500 (Illumina, USA). This dataset contains raw sequencing reads in FASTQ format.

  Dataset EGAD50000000501

• Transcriptomic changes in placenta associated with anesthesia, delivery mode and maternal diabetes

  Samples were from 34 mothers, 6 with gestational diabetes, 14 with type 1 diabetes and 14 without diabetes history with either vaginal (N=17) or cesarean section (n=17) delivery, comprising primary planned section (N=9) or secondary emergency section (N=8). Anesthesia methods during delivery included spinal (N=11), epidural (N=11), or local anesthesia (N=6), with unknown anesthesia information for six cases. Samples from each other were from the Villous and the Decidua part of the Placenta

  Dataset EGAD50000000701

• Low-coverage Single-cell Whole Genome Sequencing Data from Paired Meningioma Samples

  This dataset comprises low-coverage (~0.5X) whole genome sequencing data from 179 single cells isolated from paired meningioma samples (88 cells from initial grade II and 91 cells from recurrent grade III tumor from the same patient). The single-cell libraries were constructed using Primary Template Amplification and ResolveDNA protocol, with libraries subsequently sequenced on NextSeq 1000 using 2x150bp paired-end reads targeting 8M reads per cell. This dataset includes the sequencing data in Fastq format.

  Dataset EGAD50000001254

• Metagenomic data of patients with bipolar disorder or schizoprhenia spectrum disorder

  Metagenomic data of stool samples from 111 patients with either bipolar disorder or schizophrenia spectrum disorder. Data includes fq.gz files, mostly 1 forward and 1 reverse read per sample. Samples analysed in multiple lanes have 4 (paired) fastq files, which will have the same patient ID (example: 048_1 and 048_2, or 088_L1 and 088_L2. DNA was extracted from using the QIAamp Fast DNA Stool Mini Kit (Qiagen) following the manufacturer’s instructions. Shotgun metagenomic sequencing was carried out using llumina Novaseq 6000.

  Dataset EGAD50000001414

• Single cell resolution of human CNV body map (2019-10-02)

  12 tissues from the warm autopsy are selected for this project. Using 10X Chromium technology we will generate ~1000 single cell/nulei genomic libraries per tissue. Each tissue will be whole genome sequenced (~2 lanes per 1000 cells) on hiseq X10. per single cell we will generate CNV profile and we investigate the level of genomic heterogenity with in tissue and across different tissues. . This dataset contains all the data available for this study on 2019-10-02.

  Dataset EGAD00001005372

• Genomic Profiling of Relapsed and Refractory Childhood Cancers

  Through clinical trials focused on molecularly guided therapy in pediatric cancers (NCT01355679, NCT01802567, NCT02162732), the Beat Childhood Cancer Consortium performed paired tumor/normal whole exome sequencing and/or tumor mRNA sequencing for 202 pediatric or adolescent young adult patients with rare, relapsed and refractory cancers (including neuroblastoma, Ewing sarcoma, osteosarcoma, rhabdomyosarcoma, ependymoma, glioma, and other rare solid tumors). A subset of these patients had multiple biopsies sequenced, including longitudinal profiling.

  Study phs002238

• Blood Gene Signatures Associated with Stiffness After TKA

  In this study, we used PAXgene Blood RNA tubes collected from patients undergoing total knee arthroplasty (TKA) for osteoarthritis. Samples were collected with IRB approval and patient consent. We identified 8 patients with knee stiffness after TKA (cases) and 10 patients without post-TKA stiffness (controls). We isolated RNA from cases and controls for RNA-seq analyses, comparing samples collected the day of surgery and samples collected at 24 hours after surgery.

  Study phs002927

• Panel sequencing of endocrine-resistant breast cancer

  Patients with endocrine-resistant breast cancer in Stockholm Sweden. DNA obtained from patients primary and relapse tumors, and tumor-free lymph nodes used as germline control. DNA was extracted from formalin-fixed paraffin-embedded tissue and sequenced by 370-gene panel-based sequencing with Kapa HyperPlus library preparation and Twist Bioscience hybrid capture. Custom bait sets (panels) from Twist Bioscience. Paired end 2x150 bp using NovaSeq X. The data is presented as fastq-files.

  Study EGAS50000000236

• Whole-genome sequences of Korean populations generated by using long- and short-read sequencing technologies.

  We newly sequenced whole-genome of Korean participants by using long- and short-read sequencing platforms (n = 3 and n = 100 for long- and short-read sequencing, respectively). With these data, generated by Sequel II HiFi system (Pacific Bioscience) and DNBSEQ-T7 (MGI) sequencers, we identified a set of structural variations common in Korean population as well as the genetic features distinct from other ethnicities.

  Study EGAS50000000375

• Myeloma Genome Project Targeted Sequencing Panel - Oxford Data

  This dataset comprises the BAM files from targeted genome sequencing of CD138+ selected myeloma tumour samples from 21 individuals. In 5 cases there is only one tumour sample, but in the other 16 cases there are sequential samples, spanning treatment relapses. There are denoted Tumor A, B C etc. Therefore there are a total of 48 myeloma tumour samples. For each individual there is also a germline control samples, obtained either from peripheral blood or from CD138-selected bone marrow cells.

  Dataset EGAD00001008735

• Dissecting Autoimmune Cellular and Molecular Networks in Vitiligo

  This study consists of suction blister biopsies of primary human skin samples, collected from healthy patients, or patients with vitiligo. Healthy patients had healthy skin sampled. Vitiligo patients had both unaffected (non-lesional) and affected (lesional) skin sampled. The generated data consists of scRNA-seq samples generated following the inDrops method (Klein et al., 2015; PMID: 26000487).

  Study phs002455

• Long-read whole-genome sequencing-based concurrent haplotype phasing and aneuploidy profiling of single cells

  This dataset contains long-read whole-genome sequencing (lrWGS) data from 14 samples. Five lrWGS data are from single-cell (sc, sc_2, sc_3), multi-cell (mc, 10 cells), and bulk samples of HG002. The remaining nine lrWGS data are from two preimplantation genetic testing (PGT) families, including four from blood bulk DNA of the parental pairs and five from trophectoderm biopsies of two embryos from one family and three embryos from another family. The data are provided in raw FASTQ format and were generated using the PromethION device from Oxford Nanopore Technologies.

  Dataset EGAD50000000787

• Bulk RNA and ATACseq of 2 XLP patients and 5-6 HD

  The dataset contains five samples from P1, one pre-HSCT and four post-HSCT, one sample from P2 and 5-6 HD. RNAseq reads were processed using the LUMC BIOWDL RNAseq pipeline v5.0.0 (https://github.com/biowdl/RNA-seq). Genes with log2CPM≥1 in at least 10% of all samples were retained for downstream analysis. Differential gene expression analysis was performed using the dgeAnalysis R-Shiny application (https://github.com/LUMC/dgeAnalysis/tree/v1.4.4). ATACseq reads were processed using the LUMC BIOWDL Chipseq pipeline 1.0.0-dev (https://github.com/biowdl/ChIP-seq).

  Dataset EGAD50000002072

• WGS data from NEN patient derived tumor organoids (PDTOs) and matched parental tumors - UMCU/NKI

  The dataset includes cram files from WGS of 6 NEN tumors or metastases and matched PDTOs. For all tumors, cram files from WGS of either matched normal tissue or matched blood from the corresponding patients are included. Analysis VCF files are also included in the dataset. The sequencing was done with a NovaSeq 6000 instrument.

  Dataset EGAD00001009989

• SIGi001-A-13 / SAMEA104386250 WGS data

  The iPSC line SIGi001-A-13 / SAMEA104386250 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-13 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001031

• BIONi010-C-8 / SAMEA4454011 WGS data

  The iPSC line BIONi010-C-8 / SAMEA4454011 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-8 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001028

• BIONi010-C-3 / SAMEA4342740 WGS data

  The iPSC line BIONi010-C-3 / SAMEA4342740 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-3 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001034

• BIONi010-C-7 / SAMEA4454010 WGS data

  The iPSC line BIONi010-C-7 / SAMEA4454010 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-7 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001035

• BIONi010-C-6 / SAMEA4454009 WGS data

  The iPSC line BIONi010-C-6 / SAMEA4454009 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-6 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001037

• BIONi010-C-9 / SAMEA4454012 WGS data

  The iPSC line BIONi010-C-9 / SAMEA4454012 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-9 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001040

• SIGi001-A-3 / SAMEA4448571 WGS data

  The iPSC line SIGi001-A-3 / SAMEA4448571 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-3 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001041

• BIONi010-C-4 / SAMEA4452060 WGS data

  The iPSC line BIONi010-C-4 / SAMEA4452060 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-4 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001043

• EDi014-A / SAMEA4459369 WGS data

  The iPSC line EDi014-A / SAMEA4459369 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line EDi014-A is available for research use at www.EBiSC.org.

  Dataset EGAD50000001051

• EDi014-B / SAMEA4459371 WGS data

  The iPSC line EDi014-B / SAMEA4459371 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line EDi014-B is available for research use at www.EBiSC.org.

  Dataset EGAD50000001053

• SIGi001-A-7 / SAMEA4448730 WGS data

  The iPSC line SIGi001-A-7 / SAMEA4448730 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-7 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001060

• BIONi010-C-5 / SAMEA4452061 WGS data

  The iPSC line BIONi010-C-5 / SAMEA4452061 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-5 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001062

• BIONi010-C-2 / SAMEA4342705 WGS data

  The iPSC line BIONi010-C-2 / SAMEA4342705 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-2 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001068

• SIGi001-A-1 / SAMEA4451096 WGS data

  The iPSC line SIGi001-A-1 / SAMEA4451096 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-1 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001073

• SIGi001-A-10 / SAMEA4451117 WGS data

  The iPSC line SIGi001-A-10 / SAMEA4451117 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-10 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001074

• SIGi001-A-11 / SAMEA4451118 WGS data

  The iPSC line SIGi001-A-11 / SAMEA4451118 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-11 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001075

• SIGi001-A-12 / SAMEA104237570 WGS data

  The iPSC line SIGi001-A-12 / SAMEA104237570 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-12 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001076

• SIGi001-A-2 / SAMEA4451116 WGS data

  The iPSC line SIGi001-A-2 / SAMEA4451116 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-2 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001077

• SIGi001-A-6 / SAMEA4447426 WGS data

  The iPSC line SIGi001-A-6 / SAMEA4447426 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-6 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001078

• SIGi001-A-4 / SAMEA4448632 WGS data

  The iPSC line SIGi001-A-4 / SAMEA4448632 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-4 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001088

• SIGi001-A-5 / SAMEA4448708 WGS data

  The iPSC line SIGi001-A-5 / SAMEA4448708 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-5 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001092

• SIGi001-A-8 / SAMEA4448777 WGS data

  The iPSC line SIGi001-A-8 / SAMEA4448777 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-8 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001093

• SIGi001-A-9 / SAMEA4447499 WGS data

  The iPSC line SIGi001-A-9 / SAMEA4447499 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-9 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001095

• DAC for study "Single-nucleus brain transcriptomics reveals microglia dysfunction in Multiple System Atrophy"

  Dataset containing snRNA-seq samples from MSA or PD patients, and healthy controls. We aimed at identifying molecular processes at the single cell level that could identify common and/or disease-specific differences between healthy controls and patient groups. Frozen tissue samples from healthy controls, and multiple system atrophy or Parkinson's disease patients were excised and single nuclei were isolated following the 10x Genomics Chromium workflow.

  Dac EGAC50000000809

• 10X 3' V2 data of single immune cells in hepatocellular carcinoma

  The immune microenvironment of hepatocellular carcinoma (HCC) is poorly characterized. Combining two single-cell RNA sequencing technologies, we produced transcriptomes of CD45+ immune cells for HCC patients from five immune-relevant sites: tumor, adjacent liver, hepatic lymph node (LN), blood, and ascites. This is the droplet data of this study

  Dataset EGAD00001005961

• Paired-end Whole Exome-seq analysis of multi-centric lower grade glioma

  This dataset includes Nimblegen SeqCap EZ Exome v3 data for each lesion of three patients with multicentric glioma. For two patients, each lesion was sequenced along with whole blood. For a third patient, 3 pieces from the right lesion and 4 pieces from the left were sequenced along with whole blood. In each case BAM files that have been aligned with BWA mem alignment are available.

  Dataset EGAD00001003795

• Paired-WGS-two-families-with-GBA-variants-and-Parkinsons-disease

  We performed whole- genome sequencing, rare variant filtering, segregation analysis and functional validation of PD cosegregating rare genetic variation in two families (6 samples) segregating PD associated GBA variants c.115+1G>A (ClinVar ID: 93445, ) and p.L444P (ClinVar ID: 4288) respectively. The paired WGS sequencing was run on HiSeq X Ten and the library preparation kit was Illumina TruSeq DNA nano.

  Dataset EGAD00001006561

• GELATO clinical trial whole exome sequencing data (primary tumors and local recurrences)

  Paired-end whole exome sequencing of 10 lobular breast cancer primary tumors, 3 local recurrences and matched normal samples obtained from 10 unique patients from the GELATO clinical trial. The included raw sequencing data in fastq format was generated using Illumina NovaSeq 6000 from archived FFPE material (tumor data) and fresh frozen material (matched normal data).

  Dataset EGAD00001009836

• Epigenomic analysis of human dopaminergic neuron differentiation reveals LBX1, NHLH1 and NR2F1/2 as necessary for lineage specification

  Sample information: The 56 samples produced in this project come from the human iPSC line GM17602 (Coriell) where a tyrosine hydroxylase-T2A-mCherry reporter was inserted. A combination of epigenetic analysis (ATAC/ChIP) along transcriptomics.

  Dataset EGAD00001009288

• Exome sequencing of lung tissue conducted in SMC

  The data includes exome sequencing FASTQ files of 335 patients receiving immune checkpoint blockade therapy. The data only provides for WXS of tumor tissue.

  Dataset EGAD00001009101

• Intra-prostatic tumour evolution, steps in metastatic spread and histogenomic associations revealed by integration of multi-region whole genome sequencing with histopathological features

  We performed whole genome sequencing on 42 prostate cancer samples from the prostate, seminal vesicles and regional lymph nodes of five treatment-naive patients with locally advanced disease who underwent radical prostatectomy. Whole genome sequencing was performed as 150bp paired end reads on the Illumina NovaSeq 6000 platform.

  Dataset EGAD00001011174

• WXS Normal Samples Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011321

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• lpWGS of solid and liquid samples from female patients with metastatic breast cancer

  low-pass Whole Genome Sequencing (lpWGS) to assess the representativeness of seven body liquids from female patients with metastatic breast cancer. 20 patients. 216 liquid samples, 745 solid samples, 20 matched normal samples. 0.5X coverage. Illumina single read sequencing. Fastq files are provided. lpWGS from Richard et al., Nature Communications, 2025.

  Dataset EGAD50000001851

• Targeted sequencing data on sequential liquid biopsy samples from CSPC patients

  Sequencing data from newly diagnosed high emtastatic burder prostate cancer patients receiving an AR pathway inhibitor (ARPI) or docetaxel. Targeted sequencing data of prostate cancer relevant genes using the PCF-SELECT capture panel. cfDNA from PreADT, baseline, on-treatment (Cycle1 to 6) taken on ARPI or Docetaxel were sequenced as well as patient-matched WBC DNA

  Dataset EGAD50000001960

• Cancer Research UK Manchester Institute/ Cancer Research UK National Biomarker Centre Data Access Committee

  Cancer Research UK Manchester Institute/Cancer Research UK National Biomarker Centre Data Access Committee is created to • Review and approve data access requests. • Ensure data security and compliance with institutional and legal obligations. • Maintain accurate records of access decisions For questions or further information, please contact: Chair of the Data Access Committee: Caroline Wilkinson Email: dac@cruk.manchester.ac.uk

  Dac EGAC50000000795

• Single-cell whole-genome sequencing dataset of sorted CD3+, CD33+, and CD34+ cells from aplastic anemia

  This dataset contains raw single-cell whole-genome sequencing data generated from a single patient with aplastic anemia using the BioSkryb platform. Single cells were isolated based on surface marker expression (CD3+, CD33+, and CD34+) and subjected to whole-genome amplification followed by sequencing on an Illumina platform.

  Dataset EGAD50000002195

• RNAseq profiling of pediatric osteosarcoma

  Primary pediatric osteosarcoma samples were collected and profiled using RNAseq. When possible, germline and tumor samples were collected. For some patients, multiple tumor tissues were collected and sequenced. Some of the samples were used to derive PDTX models, which were also profiled with RNAseq. Paired end sequencing was performed on Illumina HiSeq instruments and FASTQ files reported.

  Dataset EGAD00001004538

• Transcriptome and Exome from longitudinal samples of human glioblastoma (newly added after 2015)

  We expanded our previous collection of longitudinal GBM patients (EGAS00001001041) by recruiting 21 additional patients. Tumor specimens were subjected to whole-exome sequencing (16 of 21 cases, with the matched normal/blood) and transcriptome sequencing (16 of 21 cases).

  Dataset EGAD00001002143

• Genomic Profiling of Advanced Pancreatic Cancer to inform therapy - WGS mapped reads

  Genomics-Driven Precision Medicine for Advanced Pancreatic Cancer - Early Results from the COMPASS Trial - WGS mapped reads

  Dataset EGAD00001003585

• Single-nucleus Isoforms of Down Syndrome Brains (long-read)

  16 DS and Control brains samples were prepared using the 10X Genomics Single Cell 3' v3 kit. Pre-fragmented cDNA libraries were loaded onto a Pacific Biosciences Sequel II to sequence single-nucleus isoforms.

  Dataset EGAD00001008286

• 2 10X multiomics (RNA+DNA) gray matter brain controls donors

  Single cell multiomics from 2 donor controls, expression and chromatin accessibility. Samples belong to gray matter tissue from the brain.

  Dataset EGAD00001008457

• DNA methylation-based classification of sinonasal tumors [DNA sequencing]

  This dataset contains raw exome sequencing data from nine sinonasal undifferentiated carcinoma FFPE samples and matched normal tissue that were assigned to a shared epigenetic class using DNA methylation-based classification. They were analyzed using the Twist Human Core Exome Plus Kit (Twist Bioscience) on a NovaSeq 6000 sequencer.

  Dataset EGAD00001009668

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Epilepsy related sudden death (2019-08-21)

  These samples include exome sequences of samples from patients who suffered Sudden Unexplained Death in Epilepsy. They all are of European descent. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005276