17281 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 68.84 milliseconds.

• Sequence Data from the phase 2 PrE0505 trial of Durvalumab with First Line Platinum-Pemetrexed for Unresectable Pleural Mesothelioma

  Dataset comprises of 84 bam files from exome sequencing data, including 40 tumor-normal pairs and 4 normal files. Each sample is numbered by the patient case ID such as 135, 156 and so on. The filenames are suffixed with "_tumor" and "_normal" to indicate tumor and normal bam files respectively.

  Dataset EGAD00001008016

• BLUEPRINT ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  ChIP-seq data for cells in the haematopoietic lineages, from adult and cord blood samples.

  Study EGAS00001000326

• FASTQ Data from In Situ Hi-C on Medulloblastoma Tissue Samples

  29 Hi-C datasets [8 G3 (MB3667, MB3687, MB3690, MB3692, MB3693, MB4010, MB4037, MB4141), 13 G4 (MB0558, MB3510, MB3670, MB3689, MB3716, MB3760, MB3761, MB3807, MB4079, MB4132, MB4174, MBSF7, SNC_2_5), 7 SHH (MB3612, MB3661, MB3662, MB3695, MB3697, MB3724, MB4143), and 1 WNT (MB4036)]. Fresh tissue samples were obtained from The Hospital for Sick Children (Toronto, ON). In situ Hi-C libraries were generated using approximately 2.5 million dissociated cells as input. All Hi-C libraries were sequenced at 150 bp PE with a Hi-Seq X instrument (Illumina) at McGill Genome Centre (Montreal, QC).

  Dataset EGAD50000000771

• 252 human breast cancer samples in WGS and WES

  We analyzed chromothripsis in 252 human breast cancers from two patient cohorts (149 metastatic breast cancers, 63 untreated primary tumors, 29 local relapses, 11 longitudinal pairs) using whole-genome and whole-exome (paired) sequencing. A lot of the WGS samples were sequenced on Illumina HiSeq X-Ten using Illumina TruSeq Nano DNA. For exome sequencing Agilent_SureSelect_V5+UTRs has been used (sequencing on Hiseq2000, Hiseq2500 and Hiseq4000). For exome sequencing Agilent_SureSelect_V5+UTRs has been used (sequencing on Hiseq2000, Hiseq2500 and Hiseq4000).

  Dataset EGAD00001007563

• TIGER samples

  The TIGER samples dataset contains PISA cohort samples which consist of paired RNA-seq and genotyping array data. It contains 127 RNA-seq pair-end samples in fastq format and 127 individuals genotypes in PLINK format.

  Dataset EGAD00001007990

• DDD_1 hypermutated individual

  CRAM files and VCF for DDD_1 and their parents. Also de novo mutations file for hypermutated DDD_1 child as described in the manuscript ‘Genetic and chemotherapeutic influences of germline hypermutation’ by Kaplanis et al. which will be published in Nature shortly.

  Dataset EGAD00001008497

• McGill EMC Community projects Release 7 for cell line "hTERT RPE1"

  Complete reference epigenome (as defined by IHEC) of normal hTERT RPE1 cell line as well as hTERT RPE1 cell lines engineered to express EPC1-PHF1 and JAZF1-SUZ12 fusion proteins, found in Endometrial Stromal Sarcoma.

  Dataset EGAD00001007680

• Mutation and Microsatellite Burden Predict Response to PD-1 Inhibition in Children with Germline DNA Replication Repair Deficiency: An Observational Registry Study

  This dataset contains raw data from polyA RNAseq, hybrid capture target TCR panel data, and bam files from whole exome sequencing on 39 tumors with matched germline blood.

  Dataset EGAD00001008036

• EGAD00010000702

  SNP-chip genotyping data for one proband in the DDD study (Ref : Carvalho AJHG 2015)

  Dataset EGAD00010000702

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• DKFZ-St.Jude Medulloblastoma - 218 CEF control exomes

  218 control exomes, CEF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006659

• WGS

  Whole Genome sequencing. 1 ug of genomic DNA from each lymph node sample was used for the construction of a TruSeq DNA PCR Free (350) library before sequencing in a Illumina HiSeq X Ten (2 × 151 bp). Mean coverage 30x.

  Dataset EGAD00001005423

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• DKFZ-St.Jude Medulloblastoma - 70 PAN-GATC control exomes

  Exome controls for 70 individuals, PAN-GATC cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006661

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Analysis File for 87 Argentinean individuals

  VCF for 87 Argentinean samples. Only SNPs (no indels) that passed the Affymetrix QC. Data from Luisi et al. 2020. Plos One. Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina. Reference Allele column does NOT contain reference allele from genome assembly.

  Dataset EGAD00001006227

• Expression array

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed.
This dataset contains expression array data for 32 patients of the screening cohort with 8 of them having paired normal tissue plus an additional relapse tumor/normal pair of one of those 8 patients and a patient only with normal tissue. Data was generated on a HumanHT-12 v4 Bead Array (Illumina) and is stored in IDAT file format.

  Dataset EGAD00010002596

• Single-nucleus mRNA-Sequencing of prenatal and postnatal samples from the brain and its border regions

  Single-nucleus mRNA Sequencing of prenatal and postnatal samples from the brain and its border regions. Most samples were multiplexed with several samples run in one 10X reaction. A separate immune cell dataset was combined with published data from Braun et al 2023 and Yang et al 2021 integrated using harmony is included.

  Dataset EGAD50000000044

• ICARUS-BREAST01 Dataset

  A phase II clinical trial (NCT04965766) of patritumab deruxtecan in 99 breast cancer patients. Whole-exome sequencing (WES) is available for 43 tumor samples and 43 blood samples collected at entry into the trial. RNA-squencing is available for 44 samples comprising 22 samples collected at entry into the trial and 22 samples collected during treatment (cycle 1 day 3, cycle 1 day 19, or cycle 2 day 3) from 22 patients.

  Dataset EGAD50000000773

• Transcriptome analysis of patient-derived Schwann cells isolated from human sural nerve biopsies

  This dataset contains the transcriptome analysis of human Schwann cell cultures obtained from sural nerve biopsies from six patients with polyneuropathies (N=3/patient, totalN=18) as well as the nerve fascicles from where they were isolated (N=1/patient, totalN=6). In addition, this dataset includes 8 samples out of commercial human Schwann cell cultures and one sample of a fibroblast culture, which serve as controls for further analysis.

  Dataset EGAD50000001021

• A first-in-human clinical study of an allogenic iPSC-derived corneal endothelial cell substitute transplantation for bullous keratopathy

  iPSC-derived corneal endothelial cell substitutes recover pathological corneal edema. No adverse reactions are observed after one year follow-up. Gene mutations may appear despite whole genome sequencing of the master cell bank. This study contains WGS data.

  Study EGAS50000000672

• Whole exome sequencing data for Molecular Characterization of ETMRs

  This dataset contains exome sequencing data from 21 samples. Sequencing of samples using whole-exome sequencing was per- formed by creating libraries using the IlluminaTruSeq exome enrich- ment kit following the manufacturer’s instructions after size selection. Size selection was performed by fractionation using a Covaris ultra- sonicator and subsequent selection was performed using a 1.5% gel Pippin Prep cassette (Sage Science). One lane per sample has been sequenced resulting in 42 Fastq files (paired end).

  Dataset EGAD00001006210

• The spatial organization of intratumor heterogeneity and evolutionary trajectories of metastasis in hepatocellular carcinoma

  A dataset consisting of Multi-regional Whole Exome Sequencing (WES) and Whole Genome Sequencing (WGS) data for 54 samples from 9 patients with hepatocellular carcinoma. The dataset includes 45 tumor samples and 9 normal blood samples. Selected somatic variants were validated by Sequenom. Patients covered are: Patient 1, Patient 2, Patient 3, Patient 4, Patient 5, Patient 6, Patient 7, Patient 8, Patient 9 and Patient 10.

  Dataset EGAD00001003138

• Multiple myeloma follow-up Dataset

  77 samples collected from 35 multiple myeloma patients. Each patient provided one healthy sample and one primary tumor sample and, in some cases, also samples collected after the progression of the disease.

  Dataset EGAD00001010161

• Longitudinal Transcriptomic Profiling of Endothelial Progenitor Cells in Post-COVID-19 Patients: Insights at 3 and 6-Months Post-SARS-CoV-2 Infection

  Raw transcriptomic data from endothelial cells of post-COVID patients and healthy controls. Samples were collected from post-COVID patients at 3 months (n = 6) and 6 months (n = 6) post-infection, as well as from healthy control individuals (n = 5). All post-COVID patients were hospitalized during the first wave of the pandemic. Among them, half developed pulmonary embolism (TEP; n = 6), while the other half did not (no TEP; n = 6).

  Dataset EGAD50000001452

• 10X single cell RNA- and feature barcode sequencing of 38 AML samples

  This dataset contains fastq-files from single cell 3' RNA- and feature barcode sequencing of AML samples using 10X technology (Chromium Single Cell 3ʹ Reagent Kit v3). In total, the dataset contains data from 38 AML samples from either bone marrow or peripheral blood, representing the following genetic subtypes: NPM1-mutated, myelodysplasia related, TP53-mutated, CBFB::MYH11, RUNX1::RUNX1T1, AML without class-defining mutations, and AML meeting criteria of two subtypes. The data consists of sequenced gene expression libraries from 38 samples and feature barcoding libraries covering a panel of 10-14 surface proteins for 34 samples.

  Dataset EGAD50000001577

• Ribosomal profiling on Epstein-Barr virus transformed B-lymphoblastoid cell lines

  Epstein-Barr virus-transformed B-lymphoblastoid cell lines from six individuals (HG00114, HG00282, NA12005, NA12044, NA12717 and NA12751) of the GEUVADIS Project were selected for ribosomal profiling. For each EBV-LCL, 20 million cells were treated with 2 μg/ml harringtonine and 100 μg/ml cycloheximide. After lysing cells in lysis buffer supplemented with 100 μg/ml cycloheximide, ribosome complexes were purified by density purification. Small RNA molecules were isolated using the NucleoSpin miRNA Kit (Bioke, Leiden, Netherlands), followed by RNA PAGE gel separation. Universal linkers were added after dephosphorylation. After reverse transcription, the cDNA was circularized and, after ribosomal RNA depletion, barcoded and sequenced on Illumina NextSeq 500.

  Dac EGAC50000000209

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• EM-seq data from plasma cfDNA samples of ALS patients, control and C9-carriers

  This dataset contains targeted EM-seq data from 61 plasma cfDNA samples spanning 20 sporadic ALS, 10 C9orf72-ALS, 10 asymptomatic C9orf72 expansion carriers, and 21 non-disease controls. Libraries were prepared with the NEBNext Enzymatic Methyl-seq (EM-seq) kit, captured using the Twist Human Methylome Panel (3.98 M CpGs; 123 Mb), and sequenced on Illumina NovaSeq 6000 (150 bp paired-end; ~45× on-target depth) with unmethylated lambda DNA spike-in and a 20% PhiX balance library. The dataset includes per-sample gzipped FASTQ files (R1/R2) and minimal metadata.

  Dataset EGAD50000001808

• Whole Genome Sequences of 18th century African descended individuals from Charleston, South Carolina.

  This study presents Whole Genome Sequencing results from the Anson Street African Burial Ground Project, which is a community-based initiative aimed at understanding the histories of 37 Ancestors in Charleston, South Carolina. Here we report fastq files for all 37 Ancestors. DNA was extracted at the University of Tennessee-Knoxville following Dabney et al. 2013, and dual index libraries prepared using a modified NEBNext Ultra II kit with partial USER enzyme digestion. Libraries were then enriched for human genomic DNA (MyBaits) and sequenced on Illumina Platforms.

  Dataset EGAD00001009643

• Blood plasma and FFPE derived total RNA seq dataset from DLBCL and PMBCL patients

  Blood plasma samples (n=168) and matched diagnostic formalin-fixed paraffin-embedded (FFPE) tissue samples (n=69) of DLBCL patients, PMBCL patients and healthy controls were collected between 2016-2021. Plasma samples were collected at diagnosis, at interim evaluation, after treatment, and in case of refractory or relapsed disease. RNA was extracted from 200 µl plasma using the miRNeasy serum/plasma kit and from FFPE tissue using the miRNeasy FFPE kit. RNA was subsequently sequenced on a NovaSeq 6000 instrument using the SMARTer Stranded Total RNA-seq pico v3 library preparation kit.

  Dataset EGAD00001011679

• ProstOmics - Spatial Transcriptomics

  Spatial transcriptomics data (ST) from 32 human prostate tissue samples originating from 8 prostate cancer patients (5 patients with post-surgery relapse). The ST data was acquired using the Visium Spatial Gene Expression kit which resulted in over 20 000 spatially defined spots for the 32 tissue samples. The raw transcriptomics data is RNA-seq. The individual samples have information on patient origin and sample type (cancer, cancer-adjacent field-effect normal or normal sample far from cancer). Each ST spot has metadata such as sample origin, histology class (stroma, normal epithelium, cancer of various grading etc), number of cells and estimated cell type fractions. Patient metadata include information of age at surgery, time (months) until reported relapse, total follow-up time, pre-surgery PSA, post-surgery T-stage and metastasis status.

  Dataset EGAD50000000603

• Bulk and Single-Nuclei RNA-seq with ATAC-seq of Breast Tumors Pre- and Post-Palbo ciclib/Endocrine Therapy

  This dataset comprises bulk and single-nuclei multiomic profiles from patients with ER+/HER2- early breast cancer enrolled in the NeoRHEA phase 2 trial. The bulk RNA-seq component includes 78 pre-treatment and 49 post-treatment tumor samples from 97 patients. The single-nuclei component includes matched pre- and post-treatment samples from 37 patients, totaling 63 samples analyzed by simultaneous snRNA-seq and snATAC-seq. Combined, the data contains bulk transcriptional profiles and single-nuclei gene expression/chromatin accessibility matrices for over 226,000 high-quality nuclei, encompassing tumor, immune, and stromal cells. Technologies used include Illumina NovaSeq 6000 for sequencing and the 10x Genomics Chromium platform (Multiome kit for single-nuclei, standard RNA library prep for bulk).

  Dataset EGAD50000002038

• GWAS on covid-19 severity and susceptibility in the province of Bergamo, Italy

  This is a case-control GWAS that involved the voluntary recruitment of inhabitants of the Bergamo province via an online questionnaire. We collected detailed clinical data and verified all information through personal interviews. Cases (severe COVID-19; G1) and controls (mild or asymptomatic COVID-19, G2; non-infected, G3) were matched by age, sex and risk factors

  Study EGAS00001007310

• Rapid Acceleration of Diagnostics - Digital Health Technologies (RADx-DHT): NIH Digital Health Solutions for COVID-19: SAFER-COVID - Integration of Testing and Digital Health

  SAFER-COVID provides a set of self-management tools to consumers to track symptoms, test results, vaccine record, and environmental factors, such as exposure to others. Consumers may choose to integrate data from wearables and electronic health records (EHR) for self management. These data are used to enable multiple use cases such as return-to-work, activity risk assessment and self-management within SAFER-COVID.DOI: https://rapids.ll.mit.edu/10.57895/cmt5-gh78

  Study phs002540

• Dataset for hepatopancreaticobiliary_malignancy-RNA

  Rare cancer sequencing data of 119 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008863

• Oncogenic FOXL2C134W has gain-of-function chromatin remodeling activity that reprograms glucocorticoid receptor occupancy to promote ovarian granulosa cell tumor growth

  This dataset contains bam files from the whole exome sequencing performed on granulosa cell tumors and 7 sequencing experiments performed on human-derived KGN granulosa cell tumor cells and isogenic cell lines. The latter include transcription factor ChIP-seq for Foxl2 as well as transcription factor ChIP-seq for Foxl2 and GR under dexamethasone treatment and untreated conditions, two ATAC-seq data sets, two RNA-seq data sets, and Histone marks ChIP-seq.

  Dataset EGAD50000000880

• Mutational analysis of an oligoprogressive sarcomatoid hepatocellular carcinoma treated with an immune checkpoint inhibitor.

  The dataset is composed of three sequenced tumor samples: (I) Meta-bone-557 (bone metastasis obtained from occipital lesion resection during treatment with Liposomal doxorubicin); (II) Meta-CNS-888 (brain metastasis obtained from surgical resection during treatment with Nivolumab); (III) Primary-liver-463 (primary hepatic tumor obtained from surgical resection during treatment with Nivolumab). Genomic DNA from tumor samples was extracted using GeneRead DNA FFPE kit (Qiagen), containing Uracyl-D Glycosylase, according to the manufacturer’s instructions. Whole-exome libraries were prepared using SureSelect XT Clinical Research Exome Target Enrichment kit (Agilent Technologies # 5190-7338). Sequences (150bp paired-end) were generated on a NextSeq 500 sequencing platform (Illumina).

  Dataset EGAD00001006982

• Targeted Sequencing of 173 genes

  Targeted sequencing of 173 genes in 2433 primary breast tumours. Data includes 2433 tumour samples, 523 adjacent normal (breast) samples and 127 blood samples. Libraries were prepared with Illumina's Nextera custom enrichment kit targetting all the exons of the most frequently mutated breast cancer genes. Libraries were multiplexed (48 libraries per lane) and sequenced on Illumina HiSeq 2000 (100bp paired-end reads). Somatic mutations were calling with a custom pipeline. We identified 40 mutation-driver (Mut-driver) genes, and determined associations between mutations, driver CNA profiles, clinical-pathological parameters and survival. We assessed the clonal states of Mut-driver mutations, and estimated levels of intra-tumour heterogeneity using mutant-allele fractions. The results emphasize the importance of genome-based stratification of breast cancer, and have important implications for designing therapeutic strategies. Referece: Pereira et al. (2016) The somatic mutation profiles of 2,433 breast cancers refines their genomic and transcriptomic landscapes. Nature Communications

  Dataset EGAD00001002115

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma samples (99 FFPE tumor tissue derived DNA and 9 circulating tumor DNA) and corresponding germline DNA of 38 controls. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dac EGAC50000000261

• Transcriptomic sequences of small intestinal Plasma cells from Celiac disease patients

  Transcriptomic sequences of small intestinal Plasma cell (PCs)s from Celiac disease patients. RNAseq data produced using Illumina paired-end (75bp) reads. Includes only raw data of sequences (fastq format). Samples from seven Celiac disease patients and four healthy controls. Samples from Celiac disease patients contain sub-groups of PCs that are either specific or not specific to autoantigen of the disease (TG2).

  Dataset EGAD00001004481

• Next generation sequencing data of circulating tumor DNA and matched tumor tissues

  For each subject, genomic DNA from whole blood, circulating cell free DNA and tumor tissues (whenever possible) were performed targeting next generation sequencing on Illumina Miseq or Hiseq 4000 platforms. The sequencing results of whole blood were used to distinguish germline and somatic mutations. Specimens were collected from patients with different kinds of solid tumors, but most are lung cancer patients.

  Dataset EGAD00001003176

• BCG Molecular Subtyping

  Dataset for the paper: Non-muscle Invasive Bladder Cancer Molecular Subtypes Predict Differential Response to Intravesical Bacillus Calmette-Guérin

  Dataset EGAD00001010065

• Whole exome sequencing of advanced gastric cancer

  To define the cellular characteristics of malignant ascites of advanced gastric cancer patients and search for therapeutic strategies, we obtained 5 malignant ascites and 1 cerebrospinal fluid from five patients with gastric cancer. We analyzed single-cell RNA-seq data of 180 cells from 4 malignant ascites and 1 cerebrospinal fluid metastasis using Fluidigm® C1™ System. Whole exome sequencing data was also generated from blood or tumor tissue.

  Dataset EGAD00001005740

• Hepatitis B virus integrations promote local and distant oncogenic driver alterations in hepatocarcinogenesis

  This study contain the WGS and WEX aligned bam files and RNA-seq fastq files for human liver tumors.

  Dataset EGAD00001006426

• Age-dependent association of clonal hematopoiesis with COVID-19 mortality in patients over 60 years

  Targeted sequencing with the Myeloid Solutions™ Panel (MYS) of SOPHiA Genetics for COVID-19 patientds (n=241 deceased, n=239 survivors).

  Dataset EGAD50000000001

• The Transcriptomic Landscape of Oncogenic PI3K Reveals Key Functions in Splicing and Gene Expression Regulation

  This study includes RNA-seq of paired tumor biopsies from PIK3CA-mutated breast cancer patients that underwent treatment with PI3Kα inhibitors.

  Study phs002840

• IMSGC and MultipleMS project MS patients from Spain

  Genotype and phenotype data on 151 MS patients from Spain. All individuals were whole-genome genotyped on the Illumina Global Screening Array and files are provided in plink2 format (pgen / pvar / psam files). Provided phenotypes are sex, year of birth, age and Age Related Multiple Sclerosis Severity (ARMSS) score.

  Dataset EGAD00010002492

• IMSGC and MultipleMS project MS patients from Greece

  Genotype and phenotype data on 140 MS patients from Greece. All individuals were whole-genome genotyped on the Illumina Global Screening Array and files are provided in plink2 format (pgen / pvar / psam files). Provided phenotypes are sex, year of birth, age and Age Related Multiple Sclerosis Severity (ARMSS) score.

  Dataset EGAD00010002493

• IMSGC and MultipleMS project MS patients from Norway

  Genotype and phenotype data on 575 MS patients from Netherlands. All individuals were whole-genome genotyped on the Illumina Global Screening Array and files are provided in plink2 format (pgen / pvar / psam files). Provided phenotypes are sex, year of birth, age and Age Related Multiple Sclerosis Severity (ARMSS) score.

  Dataset EGAD00010002485

• IMSGC and MultipleMS project MS patients from Austria

  Genotype and phenotype data on 246 MS patients from Austria. All individuals were whole-genome genotyped on the Illumina Global Screening Array and files are provided in plink2 format (pgen / pvar / psam files). Provided phenotypes are sex, year of birth, age and Age Related Multiple Sclerosis Severity (ARMSS) score.

  Dataset EGAD00010002487

• IMSGC and MultipleMS project MS patients from Netherlands

  Genotype and phenotype data on 209 MS patients from Netherlands. All individuals were whole-genome genotyped on the Illumina Global Screening Array and files are provided in plink2 format (pgen / pvar / psam files). Provided phenotypes are sex, year of birth, age and Age Related Multiple Sclerosis Severity (ARMSS) score.

  Dataset EGAD00010002488

• IMSGC and MultipleMS project MS patients from UK

  Genotype and phenotype data on 943 MS patients from UK. All individuals were whole-genome genotyped on the Illumina Global Screening Array and files are provided in plink2 format (pgen / pvar / psam files). Provided phenotypes are sex, year of birth, age and Age Related Multiple Sclerosis Severity (ARMSS) score.

  Dataset EGAD00010002491

• CLL PacBio LRTS IsoSeq

  This dataset contains long read transcriptome sequencing of 19 chronic lymphocytic leukemia (CLL) patients with or without mutation in SF3B1, as well as 6 B cell samples from healthy individuals. The BAM files are unaligned CCS reads.

  Dataset EGAD50000000076

• High-grade serous ovarian carcinoma tumour whole genome sequencing variants

  Tumour somatic variants (in VCF format) called from paired tumour-germline whole genome sequencing (using IDT library preparation system followed by sequencing on Illumina NovaSeq platform) of three high-grade serous ovarian tumour samples. The dataset comprises three VCF variant files.

  Dataset EGAD50000001131

• APS-1 Global Gene Expression

  Single cell sequencing of expanded regulatory T cells (Tregs) in 9 APS-1 patients and 9 age and gender matched controls. Gene expression (GEX) libraries were generated by using the Library Construction Kit from 10x genomics.

  Dataset EGAD50000000260

• Dataset for "HPV integration induces gene fusions" (Illumina)

  Illumina whole-genome sequencing data for "HPV integration induces gene fusions" We performed short read whole-genome sequencing of five HPV+ head and neck cancer samples using Illumina. The reads are submitted in bam or fastq file format.

  Dataset EGAD50000001305

• Raw scRNA-seq data for “Characterization of intestinal immune responses in generalized human and murine lipodystrophy”

  Raw 10X 5' v3 scRNA-seq data (GEX) for PBMC of 3 helthy donors and two AGLCD patient timepoints as well as of LPMC of 3 Crohns disease patients and one timepoint of the AGLCD patient.

  Dataset EGAD50000002190

• Raw scTCR-seq data for “Characterization of intestinal immune responses in generalized human and murine lipodystrophy”

  Raw 10X 5' v3 scTCR-seq data (TCR) for PBMC of 3 helthy donors and two AGLCD patient timepoints as well as of LPMC of 3 Crohns disease patients and one timepoint of the AGLCD patient.

  Dataset EGAD50000002191

• ChIP-seq for 10 samples

  This dataset contains ChIP-seq data generated from two patient-derived xenograft (PDX) models. For each model, sequencing data are provided from input control (n=1), IgG control (n=2), and FOXF1 immunoprecipitation (n=2). All the 10 samples are in bam file type.

  Dataset EGAD50000001786

• Genome-wide data of Erasmus Rucphen Family (ERF) Study

  The data consists of 678189 genome-wide polymorphic variants of 3658 individuals from ERF/GRIP region in a variant call format (vcf) file. ERF has been genotyped with different genotyping platform: Illumina 318 k, 350 k, 610 k and Affymetrics 200 k.

  Dataset EGAD00001003571

• BRIDGE SPEED April 2016

  Whole genome sequencing CRAM files for four samples from the BRIDGE Consortium (SPEED project) with pathogenic variants in a gene associated with a movement disorder.

  Dataset EGAD00001002070

• DKFZ-St.Jude Medulloblastoma - 225 clinical cases, control exomes with some paired tumor.

  225 clinical cases, control exomes with some paired tumor data, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006665

• Somatic copy-number alterations in plasma circulating tumor DNA from advanced EGFR-mutated lung adenocarcinoma patients

  This is the raw data obtained from shallow whole-genome sequencing of plasma DNA (plasma-seq) for calling of somatic copy number alterations as well as focal amplifications from patients with lung cancer.

  Dataset EGAD00001007505

• Colorectal organoids and tumoroids - pulldown (2018-08-13)

  Targeted capture of cancer gene panel bait set in single cell derived organoids from colon tissue and colorectal cancer from 1 patient. . This dataset contains all the data available for this study on 2018-08-13.

  Dataset EGAD00001004292

• SmartSeq2 index cultures

  SmartSeq2 read out of index cultured cell sorted with the classification and erythroid-myeloid panel developed in main Figure 6.

  Dataset EGAD00001008187

• WGS of NPC268_Tumor and NPC268_Cell_line

  This dataset contains WGS data in the form of BAM files for NPC268 - "Tumor" derived from snap-frozen tissue while "Cell line" derived from late passage NPC268 cell line. Extracted DNA was sent for 100x and 60x WGS with Novogene via Apical Scientific Sdn Bhd.

  Dataset EGAD00001010292

• Oncoprint GSCCs

  This dataset contains DNA sequencing data from 7 GSCCs (data for BT569 is not available). We performed focused exome sequencing (43 most mutated genes in GBM), combined with OneSeq analysis (Agilent) on the GSCCs and identified both shared and GSCC-specific mutations. For CME038, whole genome sequencing was performed.

  Dataset EGAD00001011276

• Single-nucleus APP Isoforms in Down Syndrome Brains (long-read)

  16 DS and Control brain samples were prepared using the 10X Single Cell 3' v3 kit. Pre-fragmented libraries were selectively amplified for APP using custom designed primers.

  Dataset EGAD00001008284

• Single-nucleus SPP1 Isoforms in Down Syndrome Brains (long-read)

  16 DS and Control brain samples were prepared using the 10X Single Cell 3' v3 kit. Pre-fragmented libraries were selectively amplified for SPP1 using custom designed primers.

  Dataset EGAD00001008285

• Single-nucleus BIN1 Isoforms in Down Syndrome Brains (long-read)

  16 DS and Control brain samples were prepared using the 10X Single Cell 3' v3 kit. Pre-fragmented libraries were selectively amplified for BIN1 using custom designed primers.

  Dataset EGAD00001008288

• miRNA and mRNA transcriptome data

  This dataset contains 278 miRNA and 20 mRNA transcriptomes generated as part of the study "miR-374a-5p regulates inflammatory genes and monocyte function in inflammatory bowel disease."

  Dataset EGAD00001008683

• Targeted sequencing of breast cancer susceptibility genes for 1,995 Japanese breast cancer patients

  This dataset consists of 106 bam files. Each sample from 10-20 consecutive patient extractions were combined into one DNA pool, generating a total of 106 DNA pools. We sequenced 11 genes implicated in hereditary breast cancer using the SureSelect Custom kit.

  Dataset EGAD00001006368

• DKFZ-St.Jude Medulloblastoma - 41 MB germline cases, exome data

  Germline exome tumor/control pairs for 41 medulloblastoma cases, MBG cohort sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006658

• A phase II trial of the aurora kinase A inhibitor alisertib for patients with castration resistant and neuroendocrine prostate cancer: efficacy and biomarker evaluation

  Neuroendocrine prostate cancer (NEPC) is an aggressive variant of prostate cancer that may develop de novo or as a mechanism of treatment resistance. N-myc is capable of driving NEPC progression. Alisertib inhibits the interaction between N-myc and its stabilizing factor Aurora-A, inhibiting N-myc signaling, and suppressing tumor growth. In this single arm, multi-institutional open label phase 2 clinical trial of alisertib, sixty men were treated with alisertib 50mg twice daily for 7 days every 21-days. Eligibility included metastatic prostate cancer and at least one: small cell neuroendocrine morphology; ≥50% neuroendocrine marker expression; new liver metastases without PSA progression; elevated serum neuroendocrine markers. The primary endpoint was six-month radiographic progression free survival. Pre-treatment biopsies were evaluated by whole exome and RNA-seq.

  Study phs001666

• Germline variants in patients with rare cancers - control samples WGS and WES

  The control samples (mostly blood) of 351 samples (paired WGS and WES sequencing) are in this dataset. The WGS was in nearly all cases at an Illumina HighSeq X Ten with the Illumina TruSeq Nano DNA Kit. The WES mostly on Illumina HighSeq 4000 with the Agilent SureSelect V5 plus UTRs Kit.

  Dataset EGAD00001010047

• Genomic and transcriptomic analysis of thymic epithelial tumors

  Thymic epithelial tumors (TETs), comprising various histologic types of thymomas and thymic carcinomas, originate from thymic epithelial cells. Each histologic type is typically associated with a distinct immune cell composition and clinical manifestation. A better understanding of the cellular origins and molecular pathways underlying this heterogeneity is needed to improve patient stratification and treatment. Here, we conducted an integrated genomic and transcriptomic analysis of 124 thymomas and 13 thymic carcinomas, including 20 newly sequenced cases combined with 117 cases from publicly available datasets. This approach stratified TETs into three subgroups with different possible origins: GTF2I-mutant (GTF2I-type) thymomas, copy number-altered (CN-type) thymomas, and thymic carcinomas.

  Study EGAS00001004227

• RNA-Seq data of hepatoma (Huh7 derived) and Ph5CH cells and primary hepatocytes

  The innate immune response of cells of hepatic origin (Huh7, Huh7.5, PH5CH and primary human hepatocytes (PHH), 66 samples) was analyzed by transcriptome analysis (RNAseq) upon supernatant delivery or transfection of synthetic dsRNA (poly(I:C)). Expression of TLR3 and RIG-I was reconstituted by lentiviral transduction in Huh7 and Huh7.5 cells. The sequencing is single RNA-Seq on an Illumina HiSeq 4000 with the Illumina TruSeq stranded mRNA kit.

  Dataset EGAD00001007083

• COVID-19 progression and resolution in common variable immunodeficiency patients

  116,958 single-cell transcriptomes from samples of peripheral blood mononuclear cells (PBMCs) from five CVID patients at three distinct stages of the SARS-CoV-2 infection: 1) baseline, before viral infection, 2) progression, during viral infection, and 3) convalescence, once the viral infection had been resolved and the patient was PCR negative. CVID patients were under regular immunoglobulin replacement therapy and displayed only mild symptoms during SARS-CoV-2 infection.

  Dataset EGAD00001009773

• Oxford Nanopore targeted RNA-based amplicon data of 12 classical HLA genes

  The dataset consists of Oxford Nanopore targeted RNA-based amplicon data of 12 classical HLA genes (HLA-A, -B, -C, -DRA, -DRB1, -DRB3, -DRB4, -DRB5, -DQA1, -DQB1, -DPA1, and DPB1) of 50 healthy individuals. The 12 classical genes were sequenced in two separate gene pools on R9.4 flowcells using MinION sequencer. Per individual, gene pool 1 contains HLA-A, -B, -C, -DRB1, -DRB3, -DRB4, -DRB5, and -DPB1 and gene pool 2 HLA-DRA, -DQA1, -DQB1, and -DPA1. The dataset includes 100 fastq files of Oxford Nanopore 2D reads (50 for gene pool 1 and 50 for gene pool 2).

  Dataset EGAD00001006814

• PBMC gene expression profiles in diet treated celiac disease upon oral gluten challenge

  This dataset contains PBMC genome-wide RNAseq reads from 21 samples and one expression matrix file after alignment and aggregation of the 21 samples. The samples are case-control drawn on day 6 from long-term GFD treated CD patients after 3 day oral gluten challenge, on day 0 from patient controls on long-term GFD treatment, and on day 6 from 4 week GFD treated healthy controls after 3 day oral gluten challenge.

  Dataset EGAD00001006655

• Sequencing data for oesophageal and related samples - Alex Frankell et al (WGS)

  Data supporting: "The landscape of selection in 551 Esophageal Adenocarcinomas defines genomic biomarkers for the clinic." Frankell et al. WGS (BAM files) 379 matched tumour-normal pairs

  Dataset EGAD00001004417

• Next Generation Sequencing Characterization of Hematopoietic Stem and Progenitors Cells in Human Systemic Lupus Eryhtematosus (2)

  This dataset contains RNA-sequencing of Bone marrow-derived CD34+ cells from Healthy Controls (n=2) and SLE patients (n=10). SLE patients are divided into two categories based on severity: patients with moderate/mild disease (n=4) and patients with severe disease (n=6). Libraries were generated using the Illumina TruSeq Sample Preparation kit v2. Single-end 75-bp mRNA sequencing was performed on Illumina NextSeq 500. The raw fastq files are uploaded.

  Dataset EGAD00001009744

• Neuroblastoma patient WGS data

  Paired tumor and normal WGS of primary neuroblastomas. This is an update of the „Berlin Neuroblastoma Dataset” (EGAS00001004022). This data was used for the analysis of circular RNA expression and regulation in neuroblastoma.

  Dataset EGAD00001008123

• CITEseq data

  Single-cell whole transcriptome and antibody expression for bone marrow samples from Cohorts A and B. CITEseq protocol was followed. 37 and 77 surface markers were measured in each cohort, respectively (see Supplementary Table 1). For details on cell sorting prior scRNAseq see the methods section of the manuscript.

  Dataset EGAD00001010187

• Next Generation Sequencing Characterization of Hematopoietic Stem and Progenitors Cells in Human Systemic Lupus Eryhtematosus

  This dataset contains RNA-sequencing of Bone marrow-derived CD34+ cells from Healthy Controls (n=2) and SLE patients (n=8). SLE patients are divided into two categories based on severity: patients with moderate/mild disease (n=3) and patients with severe disease (n=5). Libraries were generated using the Illumina TruSeq Sample Preparation kit v2. Single-end 75-bp mRNA sequencing was performed on Illumina NextSeq 500. The raw fastq files are uploaded.

  Dataset EGAD00001005052

• Extensive patient-to-patient single nuclei transcriptome heterogeneity in pheochromocytomas and paragangliomas

  Pheochromocytomas (PC) and paragangliomas (PG) are rare neuroendocrine tumors of varied genetic makeup, associated with high cardiovascular morbidity and a variable risk of malignancy. We focused on PCPG tumors with germline SDHB and RET mutations, representing distinct prognostic groups with worse or better prognoses, respectively. We applied single-nuclei RNA sequencing (snRNA-seq) on tissue samples from 11 patients.

  Study EGAS00001006230

• Analysis of copy number variation landscape of glioma by shallow coverage whole genome sequencing

  We reported shallow coverage whole genome sequencing (WGS) is an economic method for identification of whole genome somatic copy number variation (SCNV). Combining with a Taqman low density array (TLDA) designed for molecular subtyping of glioma, it enabled classification of glioma into biological entities with different cellular origin and genomic alterations. Further, we also showed shallow-coverage WGS enabled systematic identification of clonal and subclonal SCNV in glioma genomes and the burden and pattern of SCNV can serve as an objective marker of tumor progression and predict risk and relapse.

  Study EGAS00001003690

• RNA-seq data from 121 tumor samples with muscle invasive bladder cancer.

  In this study, a total of 300 patients with MIBC receiving chemotherapy were included; 62 received NAC before cystectomy and 245 received first-line chemotherapy upon detection of locally-advanced (T4b) or metastatic disease. Treatment response, defined as pathological downstaging (< pTa,CIS,N0) after NAC or complete or partial response after first-line treatment (RECIST criteria). RNA-seq was performed using the QuantSeq kit FWD HT kit (Lexogen) using 500 ng input RNA from 121 tumor samples. Data provided here consist of 780 fastq files for RNA-seq.

  Study EGAS00001004505

• Whole-transcriptome sequencing of hepatocellular carcinoma biopsies (TACE study)

  We performed a transcriptomic analysis of hepatocellular carcinomas (HCCs) and paired non-tumor biopsies to identify predictive biomarkers for response to transarterial chemoembolization (TACE). We identified several transcripts which are predictive of response to TACE.

  Study EGAS00001005558

• New Brain Tumor Entities Emerge from Molecular Classification of CNS-PNETs

  Primitive neuroectodermal tumors of the central nervous system (CNS-PNETs) are highly aggressive, poorly differentiated embryonal tumors occurring predominantly in young children but also affecting adolescents and adults. Herein we demonstrate that a significant proportion of institutionally diagnosed CNS-PNETs display molecular profiles indistinguishable from those of various other well defined CNS tumor entities, facilitating diagnosis and appropriate therapy for patients with these tumors. From the remaining fraction of CNS-PNETs we identify four new CNS tumor entities, each associated with a recurrent genetic alteration and distinct histopathological and clinical features. These new molecular entities, designated “CNS neuroblastoma with FOXR2 activation (CNS NB-FOXR2)”, “CNS Ewing sarcoma family tumor with CIC alteration (CNS EFT-CIC)”, “CNS high grade neuroepithelial tumor with MN1 alteration (CNS HGNET-MN1)”, and “CNS high grade neuroepithelial tumor with BCOR alteration (CNS HGNET-BCOR)”, will enable meaningful clinical trials and the development of therapeutic strategies for patients affected by poorly differentiated CNS tumors.

  Study EGAS00001001632

• CRISPR_screen_M14__NCI_H3122

  Genome wide CRISPR screen was performed to find resistance to targeted drugs for melanoma and lung

  Study EGAS00001001060

• Transcriptome_analysis_of_LCM_samples_

  We aim to set up a RNA pipeline for LCM samples to study transcriptome landscape of tumor and normal tissues. RNA was extracted from Lazer capture micro-dissection tissues and cDNA libraries were prepared with SMARTseq2 protocol. Libraries are pooled to be sequenced.

  Study EGAS00001003862