17425 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 54.35 milliseconds.

• SIGi001-A-6 / SAMEA4447426 WGS data

  The iPSC line SIGi001-A-6 / SAMEA4447426 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-6 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001078

• SIGi001-A-4 / SAMEA4448632 WGS data

  The iPSC line SIGi001-A-4 / SAMEA4448632 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-4 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001088

• SIGi001-A-5 / SAMEA4448708 WGS data

  The iPSC line SIGi001-A-5 / SAMEA4448708 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-5 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001092

• SIGi001-A-8 / SAMEA4448777 WGS data

  The iPSC line SIGi001-A-8 / SAMEA4448777 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-8 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001093

• SIGi001-A-9 / SAMEA4447499 WGS data

  The iPSC line SIGi001-A-9 / SAMEA4447499 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-9 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001095

• DAC for study "Single-nucleus brain transcriptomics reveals microglia dysfunction in Multiple System Atrophy"

  Dataset containing snRNA-seq samples from MSA or PD patients, and healthy controls. We aimed at identifying molecular processes at the single cell level that could identify common and/or disease-specific differences between healthy controls and patient groups. Frozen tissue samples from healthy controls, and multiple system atrophy or Parkinson's disease patients were excised and single nuclei were isolated following the 10x Genomics Chromium workflow.

  Dac EGAC50000000809

• 10X 3' V2 data of single immune cells in hepatocellular carcinoma

  The immune microenvironment of hepatocellular carcinoma (HCC) is poorly characterized. Combining two single-cell RNA sequencing technologies, we produced transcriptomes of CD45+ immune cells for HCC patients from five immune-relevant sites: tumor, adjacent liver, hepatic lymph node (LN), blood, and ascites. This is the droplet data of this study

  Dataset EGAD00001005961

• GELATO clinical trial whole exome sequencing data (primary tumors and local recurrences)

  Paired-end whole exome sequencing of 10 lobular breast cancer primary tumors, 3 local recurrences and matched normal samples obtained from 10 unique patients from the GELATO clinical trial. The included raw sequencing data in fastq format was generated using Illumina NovaSeq 6000 from archived FFPE material (tumor data) and fresh frozen material (matched normal data).

  Dataset EGAD00001009836

• Paired-WGS-two-families-with-GBA-variants-and-Parkinsons-disease

  We performed whole- genome sequencing, rare variant filtering, segregation analysis and functional validation of PD cosegregating rare genetic variation in two families (6 samples) segregating PD associated GBA variants c.115+1G>A (ClinVar ID: 93445, ) and p.L444P (ClinVar ID: 4288) respectively. The paired WGS sequencing was run on HiSeq X Ten and the library preparation kit was Illumina TruSeq DNA nano.

  Dataset EGAD00001006561

• Epigenomic analysis of human dopaminergic neuron differentiation reveals LBX1, NHLH1 and NR2F1/2 as necessary for lineage specification

  Sample information: The 56 samples produced in this project come from the human iPSC line GM17602 (Coriell) where a tyrosine hydroxylase-T2A-mCherry reporter was inserted. A combination of epigenetic analysis (ATAC/ChIP) along transcriptomics.

  Dataset EGAD00001009288

• Exome sequencing of lung tissue conducted in SMC

  The data includes exome sequencing FASTQ files of 335 patients receiving immune checkpoint blockade therapy. The data only provides for WXS of tumor tissue.

  Dataset EGAD00001009101

• Paired-end Whole Exome-seq analysis of multi-centric lower grade glioma

  This dataset includes Nimblegen SeqCap EZ Exome v3 data for each lesion of three patients with multicentric glioma. For two patients, each lesion was sequenced along with whole blood. For a third patient, 3 pieces from the right lesion and 4 pieces from the left were sequenced along with whole blood. In each case BAM files that have been aligned with BWA mem alignment are available.

  Dataset EGAD00001003795

• Intra-prostatic tumour evolution, steps in metastatic spread and histogenomic associations revealed by integration of multi-region whole genome sequencing with histopathological features

  We performed whole genome sequencing on 42 prostate cancer samples from the prostate, seminal vesicles and regional lymph nodes of five treatment-naive patients with locally advanced disease who underwent radical prostatectomy. Whole genome sequencing was performed as 150bp paired end reads on the Illumina NovaSeq 6000 platform.

  Dataset EGAD00001011174

• WXS Normal Samples Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011321

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Nanopore Telomere Sequencing of II.3, II.4, and III.4

  This datasets contains the putative telomeric sequences isolated by TARPON in ubam format after using a Duplex Capture Based Enrichment Protocol for patients II.2, II.4, and III.4.

  Dataset EGAD50000002363

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Exploring the extracellular transcriptome in seminal plasma for non-invasive prostate cancer diagnosis

  mRNA capture sequencing data of 57 seminal plasma samples.

  Dataset EGAD00001007688

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• Epilepsy related sudden death (2019-08-21)

  These samples include exome sequences of samples from patients who suffered Sudden Unexplained Death in Epilepsy. They all are of European descent. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005276

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• Single cell RNA sequencing of synovial B cells in early Rheumatoid Arthritis

  This dataset includes 3432 paired single cell sequencing fastq files derived from synovial B cells of 5 early Rheumatoid Arthritis patients. Libraries were prepared using the SmartSeq2 protocol. All wells contained ERCC spike-ins. Libraries were sequenced on an Illumina NovaSeq instrument with 2x100bp paired-end reads yielding a median of 2.5M reads/well. Sample aliases ending on 368 and 384 represent empty control wells. Sample aliases starting with P11417_4 and P13157_1 belong to ACPA- patient A7, sample aliases starting with P11417_5 and P11417_6 belong to ACPA+ patient A1, sample aliases starting with P13157_2 belong to ACPA- patient A3, sample aliases starting with P13157_3 and P13157_6 belong to ACPA+ patient A2, sample aliases starting with P13157_4 and P13157_5 belong to ACPA- patient A4.

  Dataset EGAD00001009076

• Whole-genome sequencing of tumour, germline and plasma samples from a BRCA1-mutant breast cancer patient

  This data set contains the fastq files from whole-genome sequencing of temporally matched tumour (fresh frozen biopsies), blood germline and plasma samples collected from a BRCA1-mutant breast cancer patient to directly compare mutation signature analysis using gold-standard tumour-germline paired variant calling with a novel ctDNA-based method (MisMatchFinder).

  Dataset EGAD50000000811

• M116 CHIP Amplicon Sequencing

  Genomic DNA was obtained from M116 peripheral blood sample and was used for targeted deep sequencing (TDS) studies. Barcoded libraries were prepared according to the manufacturer’s instructions, using a probe-based panel (KAPA HyperCap, Roche®) targeting frequently mutated regions of 50 myeloid-related genes. Samples were run on a MiSeq (Illumina®) sequencer for paired-end 2x75 bp reads with a mean coverage of 1000X.

  Dataset EGAD50000001287

• SARS-CoV2 nasal epithelium

  Single cell RNA sequence generated from human primary nasal epithelium differentiated at air-liquid interface. This dataset comprises tissue from two donors, with cultures either unexposed or exposed to SARS-CoV2. Libraries were prepared using the 10X Genomics pipeline as per manufacturer's instructions.

  Dataset EGAD00001008159

• RNA Seq of 25 spheres derived from lymph nodes of lung cancer patients

  To further decipher the cell type composition within single spheres we performed RNA-Seq of 25 selected spheres of 4 different categories (including 8 signature-/balanced, 9 signature+/balanced, 1 signature-/aberrant, 7 signature+/aberrant). Samples were sequenced using Illumina NextSeq 2000.Fastq reads were processed using inhouse RNA-Seq workflow.

  Dataset EGAD00001011099

• SMARTer bulk RNA sequencing for highly purified CD271+ BMSCs from NBM and AML

  bulk RNAseq was conducted on highly purified CD45 - CD71 - CD235a - CD31 - CD271 + BMSCs isolated from a cohort of newly diagnosed 62 AML patients, uniformly treated within an intensive chemotherapy clinical trial and selected to represent the mutational landscape of AML

  Dataset EGAD00001011056

• Highly differentiated, fusion-negative rhabdomyosarcoma.

  Sequencing was performed using OncoPanel v.2 (OPv2), an Agilent SureSelect custom designed bait set consisting of the coding regions of 504 genes, previously linked to human cancer. Sequencing wa sperformed on an Illumina HiSeq 2500. 14 highly differentiated, fusion-negative rhabdomyosarcoma tumor samples, and 8 non-matched normal skeletal muscle samples weer sequenced. BAM files are available for download.

  Dataset EGAD00001003746

• (sn)RNA-seq dataset of Multi-modal analysis of pediatric pilocytic astrocytomas reveals tumor location-associated cellular and transcriptional heterogeneity

  Aim: to comprehensively characterize the cellular and transcriptional landscape of pediatric pilocytic astrocytomas across anatomical tumor locations

  Dataset EGAD00001015705

• Single-cell somatic copy number variants in brain using different amplification methods and reference genomes

  This dataset contains 224 paired fastq files (112 single cells) from the following samples: brains from two Multiple System Atrophy patients and one control, and non-brain controls (fibroblasts, NA12878)

  Dataset EGAD50000000030

• CHIC_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in glucose, lactate or with DCA. Samples were collected 7 hours after the treatments and processed for bulk CHIC-seq.

  Dataset EGAD50000000090

• MDS PacBio LRTS IsoSeq

  This dataset contains long read transcriptome sequencing of 25 myelodysplastic sndrome (MDS) patients with or without mutation in SF3B1. The BAM files are unaligned CCS reads.

  Dataset EGAD50000000077

• DKFZ-St.Jude Medulloblastoma - 6 TB control exomes

  6 control exomes, TB cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006664

• mRNA capture sequencing and RT-qPCR for the detection of pathognomonic, novel and secondary fusion transcripts in formalin-fixed paraffin-embedded tissue: a sarcoma showcase

  mRNA capture sequencing data (FASTQ files) of 28 FFPE sarcoma tumors

  Dataset EGAD00001007696

• Next Generation Sequencing in an IBD Pedigree Exome Data

  We perform whole exome sequencing on samples from a large IBD pedigree. The selected samples are from more distantly related family members (healthy and with IBD) and a set of matched population (Ashkenazy Jewish ancestry) samples.

  Dataset EGAD00001000422

• Ewing's Sarcoma Whole Genome Sequencing

  54 WGS Ewing's sarcoma samples sequenced at The Hospital for Sick Children Toronto (Adam Shlien's lab) and published on Science 2018. Reference Anderson et al. "Rearrangement bursts generate canonical gene fusions in bone and soft tissue tumors"

  Dataset EGAD00001004589

• RNA-seq

  Stranded RNA-seq libraries were performed for 150 ng of mRNA using the TruSeq library kit (Illumina, San Diego, CA, USA). Libraries were sequenced on a NextSeq 2000 (Illumina) in a 2x50bp length.

  Dataset EGAD00001010841

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• Whole genome sequence of Primary-recurrent HCC study

  This dataset contains whole genome sequence data from 24 samples, including 16 tumors and 8 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005451

• Segmental Cherry Angioma case

  Cherry angiomas are common benign blood vessel growths on the skin. In this study we characterise mutational profile of a cherry angioma and adjacent skin biopsied from a patient with multiple lesions with segmental presentation.

  Dataset EGAD00001015641

• The Dutch Microbiome Project Batch 2

  The Dutch Microbiome Project (DMP) data includes shotgun metagenomic sequencing of faecal samples 8,208 Dutch individuals. Paired-end sequencing was performed using Illumina HiSeq 2000 platform. Data is archived in two batches to facilitate easier data access and upload to EGA. Batch 2 of DMP includes ~400 samples.

  Dataset EGAD00001007501

• HIPO016 - glioblastoma tumour methylation microarray profiling

  Methylation microarray profiling (Illumina Human Methylation 450k and EPIC platforms) of 60 adult glioblastomas. Tumours were subtyped using the approach from Sturm et al. (https://doi.org/10.1016/j.ccr.2012.08.024): 12 IDH, 18 MES, 12 RTK I, 18 RTK II. DNA was prepared, assayed on the microarrays, and raw data computationally processed as described in Capper et al., "DNA methylation-based classification of central nervous system tumours": https://www.nature.com/articles/nature26000

  Dataset EGAD00010001797

• SNP array

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed.
This dataset contains SNP array data for tumor/normal pairs for a subset of 36 patients from the screening cohort plus an additional relapse tumor of one of those 36 patients. Data was generated on a OmniExpress-24 v1.1 Bead Array (Illumina) and is stored in IDAT file format.

  Dataset EGAD00010002597

• TIRE-seq_PDN

  TIRE-seq is a novel RNA sequencing method that integrates mRNA purification directly into library preparation, eliminating separate RNA extraction. The technique demonstrated utility across three biological applications, including capturing transcriptional changes in human T cells, identifying genes driving murine dendritic cell differentiation, and analyzing the dose-response effects of temozolomide on patient-derived neurospheres. With its simplified approach and high sequencing efficiency, TIRE-seq offers a cost-effective solution for large-scale gene expression studies.

  Dataset EGAD50000001261

• Emirati Phased Diploid Trio-Assemblies (27 Individuals, 54 Assemblies)

  This dataset comprises 27 phased diploid genome assemblies (i.e., 54 haplotypes) from Emirati family trios, provided in FASTA format. Sequencing used PacBio HiFi reads generated on the Revio platform at ≥25× coverage for each parent and offspring. Assemblies were produced with hifiasm (trio mode), then scaffolded with NTLink and reference-guided merging via RagTag against CHM13v2. The collection offers haplotype-resolved references suitable for downstream variant discovery and pangenome analyses.

  Dataset EGAD50000001755

• RNA-seq TPMs quantification for baseline tumor samples originating from IMpower150, and relevant clinical metadata

  This dataset includes full tumor transcriptomes from 558 advanced NSCLC tumors. These data originate from pre-treatment samples from a clinical trial for first-line non-small cell lung cancer (IMpower150). The patients in this trial were treated with the PD-L1 inhibitor atezolizumab +bevacizumab + chemotherapy or bevacizumab + chemotherapy or atezolizumab + chemotherapy.

  Dataset EGAD50000001814

• Transcriptomic and chromatin accessibility profiling in T cells for the MTOR genetics paper.

  This submission contains raw ATAC and RNA sequencing data from human primary CD4+ and CD8+ T cells, either stimulated or unstimulated with anti-CD3/CD28 Dynabeads, from three healthy donors. It includes 24 paired-end FASTQ files consisting of 12 poly(A)-enriched RNA-seq samples and 12 ATAC-seq samples sequenced on the Illumina NextSeq 500 platform.

  Dataset EGAD50000001307

• Whole Genome Methylation in CLL

  We have extensively characterized the DNA methylome of chronic lymphocytic leukemia (CLL) with mutated and unmutated IGHV as well as several mature B cell subpopulations using whole-genome bisulfite sequencing and high-density microarrays.

  Study EGAS00001000272

• Molecular Profiling Reveals Unique Immune and Metabolic Features of Melanoma Brain Metastases. Cancer Discovery doi: 10.1158/2159-8290. PMID: 30787016 PMCID: PMC6497554

  The BAM files for WES and RNA seq used in the article "Molecular Profiling Reveals Unique Immune and Metabolic Features of Melanoma Brain Metastases." on cancer Discovery 2019. PMID: 30787016 PMCID: PMC6497554. Authors : Grant M Fischer, ..., Michael A Davies.

  Dataset EGAD00001005046

• Megabase scale methylation phasing using Nanopore long reads and NanoMethPhase

  This paper describes the work by Akbari V,. et al. on detection of allele specific methylation using oxford nanopore sequencing data. They have developed set of tools, SNVoter and NanoMethPhase, and workflow which enable the detection of allele specific methylation even in samples with sparse coverage of nanopore sequencing data.

  Dataset EGAD00001007920

• Whole genome bisulfite sequencing data of human monocyte sample 43_Hm01_BIMo_Ct from healthy male donor.

  Human monocytes from a healthy male blood donor were obtained after written informed consent and anonymised. Library preparation was performed essentially as described in the “Whole‐genome Bisulfite Sequencing for Methylation Analysis (WGBS)” protocol as released by Illumina. The library was sequenced on an Illumina HiSeq2500 using 101 bp paired-end sequencing. Read mapping was done with BWA.

  Dataset EGAD00001001390

• Transcriptome profiling of prostate tissue samples from early onset prostate cancer patients and normal controls by RNA-seq

  The dataset contains RNA-seq data of 96 EOPC patients and 9 controls. For some patients multiple tissue samples were sequenced ("multi-area" samples). The RNA extraction and sequencing protocol was earlier described in Weischenfeldt et al, Cancer Cell, 2013.

  Dataset EGAD00001004791

• Prognostic and immunomodulatory consequences of ERV expression in ovarian cancer

  The dataset contains transcriptional data obtained using total RNA sequencing on a Illumina machin. 59 samples are from the Hammersmith Hospital (HH) cohort of human primary ovarian tumours and 20 samples are from ovarian cancer cell lines Kuramochi (3 replicates) and Ovsaho (2 replicates) treated with 1 uM DNMTi guadecitabine or vehicle, at an early (day 5) or late (day 8) timepoint.

  Dataset EGAD00001006589

• RNA-sequencing and targeted DNA-sequecing of human thyroid tumors and normal samples

  RNA-sequencing data: 5 normal thyroid tissues, 14 papillary thyroid carcinomas, 2 lymph node metastases, 19 poorly differentiated thyroid carcinomas and 17 anaplastic thyroid carcinomas; Targeted DNA-sequencing of the 165 genes included in the “Solid and Haematological tumors” panel (BRIGHTCore, Brussels, Belgium): 2 normal thyroid tissues, 2 poorly differentiated thyroid carcinomas and 7 anaplastic thyroid carcinomas; 2 FASTQ files for each sample (paired).

  Dataset EGAD00001011678

• RNASeq Whole Transcriptome Expression Profiles of NFE2 and PF4 as Translational Biomarkers for BET Inhibition-Induced Thrombocytopenia in Preclinical and Clinical Studies

  Longitudinal blood samples for exploratory biomarker analysis were collected from 51 out of 83 patients enrolled in CA011-001 (NCT02419417) study of BMS-986152, totaling 425 samples collected on three different dosing schedules (A, B, and C). Whole transcriptome expression profiling was performed on the collected blood samples using RNASeq, with Illumina TruSeq library preparation and paired sequencing. Gene expression data was quantified as transcripts per million (TPM).

  Dataset EGAD50000001659

• Genomic and Transcriptomic Profile of Paired Primary-Metastasis Colorectal Tumors

  Samples encompass primary colorectal tumors, adjacent normal colonic mucosa and metastasis of 12 patients, collected by Medical Pathologists from surgically removed specimens. Normal mucosa samples were taken more than 2 cm away from the tumor. Tissues were embedded in optimal cutting temperature (OCT) medium, snapshot frozen in liquid nitrogen within 40 minutes of collection and preserved at -80ºC. Samples were collected between June 2010 and October 2017 as part of a prospective biobanking project.

  Dataset EGAD00001007686

• Oral microbiota composition assessed with 16S rRNA sequencing from adults aged over 65 years old.

  This is a oral microbiota amplicon dataset derived from adult participants aged over 65 years old. It consists a total number of 491 samples, stored in 982 paired-end FASTQ files with sequence lengths of 200 nucleotides generated with a Illumina MiSeq. Of those 491 samples, 347 were used in analysis, the remaining 144 samples are control samples.

  Dataset EGAD00001007705

• Single-cell RNA-seq data of bronchoalveolar lavage fluid and extramedullary relapse of a multiple myeloma patient with sarcoidosis-like reactions after anti-BCMA CAR T-cell therapy

  We performed single-cell RNA-sequencing (scRNA-seq) of cells in the bronchoalveolar lavage (BAL) fluid at 3-month follow-up of a multiple myeloma patient experiencing sarcoidosis-like pulmonary reactions after anti-BCMA CAR T-cell therapy (Sample alias: A8_3, A9_3; technical replicates). In addition we performed scRNA-seq of a extramedullary relapse lesion at 6-month follow-up (Sample alias: B10_3).

  Dataset EGAD00001008649

• FFPE, buffycoat and cell free DNA from N. German esophagus cancer patients - 2021

  28 patients. Cell-free DNA and leukocyte DNA, both from before any neoadjuvant treatment. Tumor FFPE tissue (plus metastasic tissue for some patients) from after any neoadjuvant treatment. Some cfDNA from follow-up time points (e.g. after neodj. treatment or in the clinical course). IDT xgen Pan-Cancer panel for hybridisation capture. Illumina TruSeq library prep for cfDNA and leukocyte DNA, Illumina DNA Prep for FFPE DNA. n=150 libraries in total.

  Dataset EGAD00001010081

• Evolutionary Genome Analysis of Transformation into Small Cell Carcinomas from Lung Adenocarcinomas

  This dataset includes the high-throughput sequencing data from a study entitled "Clonal History and Genetic Predictors of Transformation into Small Cell Carcinomas from Lung Adenocarcinomas". Whole-genome sequencing libraries were generated by PCR-free methods, and sequencing run was made in HiSeq X or HiSeq 2500 machines. PCR duplicates-marked, indel-realigned, and base-recalibrarted BAM files are provided in our dataset.

  Dataset EGAD00001003315

• Vulnerabilities of Midbrain Dopaminergic Neurons to Parkinson's Disease Revealed by Single-Cell Genomics

  We developed a novel protocol for the enrichment of midbrain DA neurons from frozen tissue. We subsequently performed single-nuclei RNA-sequencing on enriched samples from postmortem midbrain tissue from human, macaque, tree shrew, rat, and mouse. We identified vulnerable and resistant populations from these data and associated genetic enrichments and differential expression changes.

  Study phs002879

• Cell-free DNA and bone marrow samples from myelodysplastic syndromes

  We have assessed the molecular profile of a cohort of 70 patients with MDS by next-generation sequencing (NGS) using cfDNA and compared the results to paired bone marrow (BM) DNA.

  Dataset EGAD00001008567

• Exome sequencing of matching primary tumor and venous tumor thrombus (VTT) renal cell carcinoma (RCC) samples

  We performed multiregion whole exome sequencing of a total of 37 samples from five consecutive patients (normal tissue, n=5; primary tumors, n=16; tumor thrombi, n=16) to >35-fold target coverage. Matching primary tumor and venous tumor thrombus samples were analyzed. Four patients had a clear cell RCC, one patient had a poorly differentiated type II papillary RCC (RCC-VTT-04). The latter patient had a friable thrombus, the others were of solid consistency.

  Dataset EGAD00001004887

• CCA RNA-seq data (60 CCA, 6 normal, 16 cell-line)

  Fastq files for RNA-seq for 60 CCAs, 6 normal bile duct tissues, 14 CCA cell-lines (including replicates), and 2 normal cholangiocyte cell-lines (including replicates). RNA was extracted using the Qiagen RNeasy Mini kit. Illumina Tru-Seq Stranded Total RNA kit (Illumina, San Diego, California, USA) was used to prepare RNA libraries from 1 µg of total RNA. Paired-end 150 bp sequencing was performed using Illumina HiSeq4000 sequencer with the paired-end 150 bp read option.

  Dataset EGAD00001011998

• Swarm Learning to identify COVID-19, tuberculosis and leukemia patients based on blood transcriptomes

  Identification of patients with life-threatening diseases including leukemias or infections such as tuberculosis or COVID-19 is an important goal of modern precision medicine. However, there is an increasing divide between what is technically possible and what is allowed because of privacy legislation. We have recently illustrated that classical machine learning can identify leukemia patients based on their blood transcriptomes. To facilitate integration of any omics data from any data owner world-wide without violating privacy laws, we here introduce Swarm Learning (SL), a decentralized machine learning approach uniting edge computing, artificial intelligence (AI), blockchain and privacy protection without the need for a central coordinator thereby going beyond federated learning. To illustrate its feasibility, using more than 12,000 transcriptomes from peripheral blood mononuclear cells and more than 2,000 peripheral blood transcriptomes we demonstrate that SL of omics data distributed across different individual sites leads to disease classifiers that outperform those developed at individual sites. Yet, SL completely protects local privacy regulations by design. We propose this approach to noticeably accelerate the introduction of precision medicine.

  Dataset EGAD00001006231

• Liverpool Preterm Birth Biomarker Study

  Preterm birth is a multifactorial condition defined as birth less than 37 weeks of gestation. This study aimed to identify early pregnancy biomarkers from maternal genome-wide and transcriptome-wide data of women experiencing two types of spontaneous PTB (sPTB): spontaneous preterm birth (SPTB) and preterm premature rupture of membranes (PPROM). Whole blood samples were obtained from women with singleton pregnancies (N=567) recruited at the Liverpool Women’s Hospital at 16 and 20 weeks of gestation. Women with a previous history of sPTB pregnancies <34 weeks were categorised on their index pregnancy outcome as spontaneous preterm birth (SPTB) and preterm premature rupture of membranes (PPROM) or high-risk term control (HTERM, ≥37 weeks). Women with no history of SPTB/PPROM and delivered at term were LTERM (≥39 weeks of gestation). DNA was genotyped on the UK Biobank Axiom™ array (Applied Biosystems™, Thermo Fisher Scientific) and RNA who processed using the Clariom™ D Human assay (Thermo Fisher Scientific). Genome-wide association analysis, differential expression analysis and expression quantitative trait loci (eQTL) were completed.

  Study EGAS00001005076

• Single-Nuclei RNA Sequencing and Spatial Transcriptomics of Human Heart Right Atrial Appendage and Pericardial Fluid in Cardiovascular Disease

  This dataset includes single-nuclei RNA sequencing (snRNA-seq) and spatial transcriptomics data from biopsies of the right atrial appendage and pericardial fluid, collected during open-heart surgeries. The samples represent various clinical contexts, including control, ischemic heart disease, heart failure, and myocardial infarction. For each biopsy, nuclei were isolated, and RNA sequencing libraries were prepared using the 10x Genomics Chromium v3 platform. Additionally, spatial transcriptomics was performed on the heart samples. The dataset provides raw sequencing data, which includes fastq files generated from these libraries, offering valuable insights into the cellular composition of heart tissues and associated fluids across different disease states.

  Dataset EGAD50000000927

• Genomic and Transcriptomic sequencing of neuroblastoma cell lines

  Genomic and Transcriptomic sequencing of neuroblastoma HSR and ecDNA cell lines. Data represents five 96-well plates that were processed with G&T sequencing, resulting in genomic and transcriptomic data from the same single cells. Dataset contains 95 bam files containing the DNA sequencing data and 95 bam files containing the RNA sequencing data of CHP212 cells, 380 bam files (190 DNA and 190 RNA) for TR14 cells, 188 bam files (94 DNA and 94 RNA) for Kelly cells and 192 bam files (96 DNA and 96 RNA) for IMR5/75 cells.

  Dataset EGAD50000000729

• Oxford Nanopore long-read sequencing data of high-grade serous ovarian cancer

  This dataset comprises whole-genome Oxford Nanopore long-read sequencing data from six high-grade serous ovarian cancer (HGSOC) patients, including cryopreserved, pre-treatment tumor tissues and matched peripheral blood samples (12 samples in total). High-molecular-weight DNA was prepared using the SQK-LSK114 Ligation Sequencing Kit and sequenced on FLO-PRO114M flow cells (R10.4.1). Basecalling was conducted using the super-accurate (SUP) model, enabling simultaneous detection of 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC). The dataset includes BAM files containing base modification information for downstream genomic and epigenomic analyses.

  Dataset EGAD50000001509

• Raw molecular data for "Subclonal immune evasion in non-small cell lung cancer"

  Whole exome, RNA sequencing and TCR sequencing of organoid samples derived from TRACERx patients. The dataset also includes whole exome sequencing from the tumour samples from which the organoids were generated, as well as whole exome sequencing from PDX derived from said tumours.

  Dataset EGAD00001015537

• B cell single cell sequencing (RNA + VDJ) - Autoproliferation

  10X 3' (RNA) and 10X 5' (VDJ) samples of B cells (non-proliferating/hi and autoproliferating/Dim) for healthy donor and Multiple sclerosis patients used in the paper.

  Dataset EGAD50000001237

• Methylome and transcriptome of memory B cells - Autoproliferation

  Methylome and the corresponding transcriptome of autoproliferating/Dim B cells and resting/hi B cells in Multiple sclerosis patients

  Dataset EGAD50000001236

• Dataset for "HPV integration induces gene fusions" (pacBio)

  pacBio whole-genome sequencing data for "HPV integration induces gene fusions" We performed long read whole-genome sequencing on four HPV+ head and neck cancer samples using pacBio HiFi. The sequence reads were submitted in fastq format.

  Dataset EGAD50000001304

• bulk RNAseq from metastatic uveal melanoma tumour biopsies

  Tumour biopsies were obtained from uveal melanoma patients (n = 35) pre and 16 days post treatment with tebentafusp. Biopsies, which were either snap frozen or put in RNA later, were analysed by bulk RNA sequencing (50 million reads per sample) using the Illumina NovaSeq system.

  Dac EGAC50000000519

• Two scRNA-seq datasets from control and irradiated organoids.

  Dataset includes two scRNA-seq samples from control and irradiated organoids. Files included in the dataset are Fastq files. Sample libraries produced with Chromium X were sequenced on an Illumina NovaSeq 6000 sequencer.

  Dataset EGAD50000001933

• HOVON152 Trial Targetted Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002093

• 10x Genomics scRNA-seq for 3 samples

  This dataset contains 10x Genomics single-cell RNA-seq data from two primary leukemia samples and their corresponding patient-derived xenograft (PDX) models. All the 3 samples are in bam file type.

  Dataset EGAD50000001788

• DKFZ-St.Jude Medulloblastoma - 3 XI046 SF controls, WGS data

  3 control whole genomes, SF cohort, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006662

• EPC (eccrine porocarcinoma) WES samples

  Whole-exome sequencing (WES) in a well-characterized sample of 14 matched EP tumour/healthy surrounding tissue samples. The sequencing was done with paired EXOME sequencing on Illumina HiSeq 4000 using Agilent SureSelect XT HS + Human All Exon V7.

  Dataset EGAD00001006395

• plasma dna fragmentations

  Data were generated by next-generation sequencing (Illumina) in a fastq format. This dataset involved sequencing data from pregnant women and patients with hepatocellular carcinoma (HCC). For HCC samples, the paired buffy coat and tumor DNA tissue samples were also sequenced.

  Dataset EGAD00001006054

• Data for the genome‐wide association study of cutaneous leishmaniasis in Brazil

  DNAs were genotyped on Illumina Infinium HumanCoreExome Beadchips (Illumina Inc., San Diego, CA, USA) with probes for 551,004 single nucleotide variants (SNVs): 282,373 informative across ancestries; 268,631 exome-focused. Human genome build 37 (hg19) was used.

  Dataset EGAD00001006681

• Fibromyalgia versus small fiber neuropathy: Diverse keratinocyte transcriptome signature dataset

  We provide a diverse keratinocyte transcriptome signature between SFN and FMS patients, which may hint towards distinct pathomechanisms of small fiber sensitization and lay the basis for advanced diagnostics in both entities

  Dataset EGAD00001006918

• 6_RNAseq_NOVA1_KO_vs_wt

  iPSC-derived motor neurons from 5 NOVA1 knock out and 5 NOVA1 wt lines in the CVB background.

  Dataset EGAD00001008427

• Martin_Ravenscroft-AUS1

  Whole genome sequencing data on D19-0702 (AUS1), presented in Martin et al. 2020 (AUS1). WGS (Illumina HiSeq) was performed at Kinghorn Centre for Clinical Genetics, Garvan Institute of Medical Research. Data was analyzed using the Seave bioinformatic analysis pipeline (https://www.seave.bio).

  Dataset EGAD00001006276

• Whole-exome sequencing of IMFT tumor samples f

  Whole-exome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007803

• Proteogenomic Landscape of Curable Prostate Cancer

  Aligned RNA-seq sequences in this dataset are from the Proteogenomic Landscape of Curable Prostate Cancer study

  Dataset EGAD00001004875

• ATAC-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole genome sequence data for ATAC-seq (114 samples) The final quality filtered set included 73 individuals with ATAC-seq.

  Dataset EGAD00001005002

• DKFZ-St.Jude Medulloblastoma - 9 SJMB tumor/control pairs, exome

  9 tumor/control exomes, SJMB samples, sequenced on Illumina machines from the paper "Germline Elongator mutations in Sonic Hedgehog medulloblastoma" (Waszak et al. 2020 Nature).

  Dataset EGAD00001006663

• RNA-Seq files for SJHGG study

  RNA-Seq files accompanying the paper titled "Somatic Histone H3 Mutations in Diffuse Intrinsic Pontine Gliomas and Non-Brainstem Paediatric Glioblastomas".

  Dataset EGAD00001003905

• Exome sequencing of patients with acute promyelocytic leukemia

  The dataset consists in 64 fastq files from 23 patients with acute promyelocytic leukemia. Exome sequencing was conducted on several stages (Diagnosis, Remission, Relapse) for each patient. For 5 patients, only Diagnosis and Relapse samples are available.

  Dataset EGAD00001004043

• Whole Exome Data of RFWD3 Fanconi anemia patient

  Dataset contains one sample derived from gDNA of human fibroblasts. Files are in FASTQ format and were generated using the Agilent SureSelect Human All Exon 50Mb Kit and followed by Next Generation Sequencing on a HighSeq2000 instrument (Illumina).

  Dataset EGAD00001003311

• SLC9A3R1 variant associated with age-related hearing loss

  The dataset contains one BAM file that includes a SLC9A3R1 variant identified in two Italian patients affected by age-related hearing loss. Data have been produced by targeted re-sequencing, using Ion Torrent PGM platform.

  Dataset EGAD00001004171

• Exome and transcriptome sequencing of CDS and ES tumor samples

  This dataset contains WES and RNASeq data of 31 CDS and ES tumor and control samples. Sequencing was performed on Illumina NovaSeq 6000. The sequencing was performed paired in bulk.

  Dataset EGAD00001015608