17848 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 39.99 milliseconds.

• Illumina RNA sequencing data

  RNA sequence data for HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3 and MIHA. RNA-seq data of all the 5 samples were stored in compressed fastq format.

  Dataset EGAD00001004476

• SCNA-Seq of plasma DNA samples

  Low coverage whole genome sequencing for the identification of somatic copy number alterations (SCNA) and focal amplification mapping in plasma DNA of prostate cancer patients

  Dataset EGAD00001002149

• Ovarian cancer sequencing dataset

  Sequencing data from patients with Ovarian cancer. Data utilised in the 'Enhanced detection of circulating tumor DNA by fragment size analysis' manuscript (Mouliere et al, 2018)

  Dataset EGAD00001004939

• 666PG genomic rearrangements

  Genomic rearrangement calls generated using Delly in VCF format from the CPCGene 666PG study

  Dataset EGAD00001006146

• ATAC-seq of spermatogonia

  Raw sequencing reads of ATAC-seq of spermatogonia in FASTQ format, comprising 6 samples sequenced on the Illumina HiSeq 4000 platform.

  Dataset EGAD00001007759

• Cell line sequencing data

  SmMIP libraries using bulk cell line DNA and DNA mixes were generated in replicates and were sequenced on the NovaSeq SP platform (Illumina)

  Dataset EGAD00001007790

• PrevANZ RNAseq dataset

  Whole blood samples collected at baseline and week 12 in PAXgene Blood RNA tubes. RNA sequencing on the Illumina NovaSeq 6000 System generated 150 base pair length paired end reads.

  Dataset EGAD00001011069

• Genetic architecture of male infertility in India

  The dataset consists of whole exome and genome sequencing data from infertile males and his parent(s) and/or sibling(s)

  Dataset EGAD00001015606

• Spatially resolved cellular and molecular drivers of cardiac remodelling in healthy and failing human hearts: Adult DNA (2025-10-16)

  Human Cell Atlas - WGS Adult Heart . This dataset contains all the data available for this study on 2025-10-16.

  Dataset EGAD00001015751

• Cancer Research UK Manchester Institute/ Cancer Research UK National Biomarker Centre Data Access Committee

  Cancer Research UK Manchester Institute/Cancer Research UK National Biomarker Centre Data Access Committee is created to • Review and approve data access requests. • Ensure data security and compliance with institutional and legal obligations. • Maintain accurate records of access decisions For questions or further information, please contact: Chair of the Data Access Committee: Caroline Wilkinson Email: dac@cruk.manchester.ac.uk

  Dac EGAC50000000795

• lpWGS of solid and liquid samples from female patients with metastatic breast cancer

  low-pass Whole Genome Sequencing (lpWGS) to assess the representativeness of seven body liquids from female patients with metastatic breast cancer. 20 patients. 216 liquid samples, 745 solid samples, 20 matched normal samples. 0.5X coverage. Illumina single read sequencing. Fastq files are provided. lpWGS from Richard et al., Nature Communications, 2025.

  Dataset EGAD50000001851

• Targeted sequencing data on sequential liquid biopsy samples from CSPC patients

  Sequencing data from newly diagnosed high emtastatic burder prostate cancer patients receiving an AR pathway inhibitor (ARPI) or docetaxel. Targeted sequencing data of prostate cancer relevant genes using the PCF-SELECT capture panel. cfDNA from PreADT, baseline, on-treatment (Cycle1 to 6) taken on ARPI or Docetaxel were sequenced as well as patient-matched WBC DNA

  Dataset EGAD50000001960

• Single-cell whole-genome sequencing dataset of sorted CD3+, CD33+, and CD34+ cells from aplastic anemia

  This dataset contains raw single-cell whole-genome sequencing data generated from a single patient with aplastic anemia using the BioSkryb platform. Single cells were isolated based on surface marker expression (CD3+, CD33+, and CD34+) and subjected to whole-genome amplification followed by sequencing on an Illumina platform.

  Dataset EGAD50000002195

• Aligned Low pass whole genbome sequencing of cell free and tumour DNA from 5 patients with high grade serous ovarian cancer. Samples have been aligned to hg19 and bam files uploaded

  This is the aligned bam files of 5 patients, with sequential sampltes from patients comprising cfDNA and FFPE extracted tumour DNA

  Dataset EGAD50000001632

• RNAseq profiling of pediatric osteosarcoma

  Primary pediatric osteosarcoma samples were collected and profiled using RNAseq. When possible, germline and tumor samples were collected. For some patients, multiple tumor tissues were collected and sequenced. Some of the samples were used to derive PDTX models, which were also profiled with RNAseq. Paired end sequencing was performed on Illumina HiSeq instruments and FASTQ files reported.

  Dataset EGAD00001004538

• Transcriptome and Exome from longitudinal samples of human glioblastoma (newly added after 2015)

  We expanded our previous collection of longitudinal GBM patients (EGAS00001001041) by recruiting 21 additional patients. Tumor specimens were subjected to whole-exome sequencing (16 of 21 cases, with the matched normal/blood) and transcriptome sequencing (16 of 21 cases).

  Dataset EGAD00001002143

• 2 10X multiomics (RNA+DNA) gray matter brain controls donors

  Single cell multiomics from 2 donor controls, expression and chromatin accessibility. Samples belong to gray matter tissue from the brain.

  Dataset EGAD00001008457

• Dataset for LCPlus_WES

  WES/WGS sequencing data of 86 chromothriptic tumor and control runs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001009273

• DNA methylation-based classification of sinonasal tumors [DNA sequencing]

  This dataset contains raw exome sequencing data from nine sinonasal undifferentiated carcinoma FFPE samples and matched normal tissue that were assigned to a shared epigenetic class using DNA methylation-based classification. They were analyzed using the Twist Human Core Exome Plus Kit (Twist Bioscience) on a NovaSeq 6000 sequencer.

  Dataset EGAD00001009668

• Metagenomic data of patients with bipolar disorder or schizoprhenia spectrum disorder

  Metagenomic data of stool samples from 111 patients with either bipolar disorder or schizophrenia spectrum disorder. Data includes fq.gz files, mostly 1 forward and 1 reverse read per sample. Samples analysed in multiple lanes have 4 (paired) fastq files, which will have the same patient ID (example: 048_1 and 048_2, or 088_L1 and 088_L2. DNA was extracted from using the QIAamp Fast DNA Stool Mini Kit (Qiagen) following the manufacturer’s instructions. Shotgun metagenomic sequencing was carried out using llumina Novaseq 6000.

  Dataset EGAD50000001414

• Low-coverage Single-cell Whole Genome Sequencing Data from Paired Meningioma Samples

  This dataset comprises low-coverage (~0.5X) whole genome sequencing data from 179 single cells isolated from paired meningioma samples (88 cells from initial grade II and 91 cells from recurrent grade III tumor from the same patient). The single-cell libraries were constructed using Primary Template Amplification and ResolveDNA protocol, with libraries subsequently sequenced on NextSeq 1000 using 2x150bp paired-end reads targeting 8M reads per cell. This dataset includes the sequencing data in Fastq format.

  Dataset EGAD50000001254

• Small-RNA sequencing of pheochromocytoma and paraganglioma arising from germline SDHB mutations

  Single-end 75 basepair small-RNA sequencing of 90 SDHB-deficient non-metastatic and metastatic pheochromocytoma and paraganglioma. Samples were prepared using the NEXTFLEX® Small RNA-Seq Kit v3 (Bioo Scientific ). Samples were sequenced at the molecular genomics core (Peter MacCallum Cancer Centre) using 50bp single end sequencing on the Illumina NextSeq 500 (Illumina, USA). This dataset contains raw sequencing reads in FASTQ format.

  Dataset EGAD50000000501

• Transcriptomic changes in placenta associated with anesthesia, delivery mode and maternal diabetes

  Samples were from 34 mothers, 6 with gestational diabetes, 14 with type 1 diabetes and 14 without diabetes history with either vaginal (N=17) or cesarean section (n=17) delivery, comprising primary planned section (N=9) or secondary emergency section (N=8). Anesthesia methods during delivery included spinal (N=11), epidural (N=11), or local anesthesia (N=6), with unknown anesthesia information for six cases. Samples from each other were from the Villous and the Decidua part of the Placenta

  Dataset EGAD50000000701

• Dissecting Autoimmune Cellular and Molecular Networks in Vitiligo

  This study consists of suction blister biopsies of primary human skin samples, collected from healthy patients, or patients with vitiligo. Healthy patients had healthy skin sampled. Vitiligo patients had both unaffected (non-lesional) and affected (lesional) skin sampled. The generated data consists of scRNA-seq samples generated following the inDrops method (Klein et al., 2015; PMID: 26000487).

  Study phs002455

• Bulk RNA and ATACseq of 2 XLP patients and 5-6 HD

  The dataset contains five samples from P1, one pre-HSCT and four post-HSCT, one sample from P2 and 5-6 HD. RNAseq reads were processed using the LUMC BIOWDL RNAseq pipeline v5.0.0 (https://github.com/biowdl/RNA-seq). Genes with log2CPM≥1 in at least 10% of all samples were retained for downstream analysis. Differential gene expression analysis was performed using the dgeAnalysis R-Shiny application (https://github.com/LUMC/dgeAnalysis/tree/v1.4.4). ATACseq reads were processed using the LUMC BIOWDL Chipseq pipeline 1.0.0-dev (https://github.com/biowdl/ChIP-seq).

  Dataset EGAD50000002072

• Long-read whole-genome sequencing-based concurrent haplotype phasing and aneuploidy profiling of single cells

  This dataset contains long-read whole-genome sequencing (lrWGS) data from 14 samples. Five lrWGS data are from single-cell (sc, sc_2, sc_3), multi-cell (mc, 10 cells), and bulk samples of HG002. The remaining nine lrWGS data are from two preimplantation genetic testing (PGT) families, including four from blood bulk DNA of the parental pairs and five from trophectoderm biopsies of two embryos from one family and three embryos from another family. The data are provided in raw FASTQ format and were generated using the PromethION device from Oxford Nanopore Technologies.

  Dataset EGAD50000000787

• WGS data from NEN patient derived tumor organoids (PDTOs) and matched parental tumors - UMCU/NKI

  The dataset includes cram files from WGS of 6 NEN tumors or metastases and matched PDTOs. For all tumors, cram files from WGS of either matched normal tissue or matched blood from the corresponding patients are included. Analysis VCF files are also included in the dataset. The sequencing was done with a NovaSeq 6000 instrument.

  Dataset EGAD00001009989

• Swarm Learning to identify COVID-19, tuberculosis and leukemia patients based on blood transcriptomes

  Identification of patients with life-threatening diseases including leukemias or infections such as tuberculosis or COVID-19 is an important goal of modern precision medicine. However, there is an increasing divide between what is technically possible and what is allowed because of privacy legislation. We have recently illustrated that classical machine learning can identify leukemia patients based on their blood transcriptomes. To facilitate integration of any omics data from any data owner world-wide without violating privacy laws, we here introduce Swarm Learning (SL), a decentralized machine learning approach uniting edge computing, artificial intelligence (AI), blockchain and privacy protection without the need for a central coordinator thereby going beyond federated learning. To illustrate its feasibility, using more than 12,000 transcriptomes from peripheral blood mononuclear cells and more than 2,000 peripheral blood transcriptomes we demonstrate that SL of omics data distributed across different individual sites leads to disease classifiers that outperform those developed at individual sites. Yet, SL completely protects local privacy regulations by design. We propose this approach to noticeably accelerate the introduction of precision medicine.

  Dataset EGAD00001006231

• Methylome of memory B cells with autoproliferation in MS

  Methylome of resting/hi and autoproliferating/Dim memory B cells in Multiple sclerosis patients. In brief, non-proliferating (CFSEhi) and AP+ (CFSEdim) CD19+ CD27+ B cells from PBMCs of 6 natalizumab-treated female RRMS (NAT) patients were sorted following 7 days of autoproliferation. Methylome libraries for 12 samples were constructed by applying the post-bisulfite adaptor tagging (PBAT) method on lysed cells and sequencing was conducted on Illumina NovaSeq 6000. CpGs with minimum 10X coverage were used for differential methylation position (DMP) analysis.

  Dataset EGAD50000001269

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Khoe-San whole genome sequencing

  High-coverage (>30X) whole genome data (FASTQ) for 25 southern African Khoe-San individuals (from five populations). These are the same individuals as in Schlebusch et al. 2020 (EGAD00001006183), but different data.

  Dataset EGAD50000001559

• H3K27me3 Cut&Tag on beta cells

  H3K27me3 Cut&Tag datasets in human pancreatic islets and the EndoC-bH1 cell line

  Dataset EGAD50000000463

• ChIP-seq for GOF p53

  This dataset includes ChIP-seq data from two cell lines (HKCI-11 (GOFp53) and MIHA(WT p53)). All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005449

• Human Origins array data for 1510 individuals

  Genotype data typed on the Human Origins array for 1510 individuals published in "Dense sampling of ethnic groups within African countries reveals fine-scale genetic structure and extensive historical admixture."

  Dataset EGAD00001010015

• DAC for study "Single-nucleus brain transcriptomics reveals microglia dysfunction in Multiple System Atrophy"

  Dataset containing snRNA-seq samples from MSA or PD patients, and healthy controls. We aimed at identifying molecular processes at the single cell level that could identify common and/or disease-specific differences between healthy controls and patient groups. Frozen tissue samples from healthy controls, and multiple system atrophy or Parkinson's disease patients were excised and single nuclei were isolated following the 10x Genomics Chromium workflow.

  Dac EGAC50000000809

• ATAC-seq for 2 samples

  This dataset contains ATACseq data from ta primary sample and a patient derived model (PDX) of the novel FOXF1/FENDRR ALL subtype. All the 2 samples are in bam file type.

  Dataset EGAD50000001791

• BIONi010-C-8 / SAMEA4454011 WGS data

  The iPSC line BIONi010-C-8 / SAMEA4454011 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-8 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001028

• SIGi001-A-13 / SAMEA104386250 WGS data

  The iPSC line SIGi001-A-13 / SAMEA104386250 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-13 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001031

• BIONi010-C-3 / SAMEA4342740 WGS data

  The iPSC line BIONi010-C-3 / SAMEA4342740 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-3 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001034

• BIONi010-C-7 / SAMEA4454010 WGS data

  The iPSC line BIONi010-C-7 / SAMEA4454010 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-7 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001035

• BIONi010-C-6 / SAMEA4454009 WGS data

  The iPSC line BIONi010-C-6 / SAMEA4454009 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-6 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001037

• BIONi010-C-9 / SAMEA4454012 WGS data

  The iPSC line BIONi010-C-9 / SAMEA4454012 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-9 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001040

• SIGi001-A-3 / SAMEA4448571 WGS data

  The iPSC line SIGi001-A-3 / SAMEA4448571 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-3 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001041

• BIONi010-C-4 / SAMEA4452060 WGS data

  The iPSC line BIONi010-C-4 / SAMEA4452060 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-4 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001043

• EDi014-A / SAMEA4459369 WGS data

  The iPSC line EDi014-A / SAMEA4459369 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line EDi014-A is available for research use at www.EBiSC.org.

  Dataset EGAD50000001051

• EDi014-B / SAMEA4459371 WGS data

  The iPSC line EDi014-B / SAMEA4459371 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line EDi014-B is available for research use at www.EBiSC.org.

  Dataset EGAD50000001053

• RNA-seq

  RNA sequencing files that were used in our study. The cohort was composed of 39 cases of RNA sequencing data. RNA-seq library was prepared with rRNA depletion method, and the sequence was performed using DNBSEQ sequencer.

  Dataset EGAD50000000971

• SIGi001-A-9 / SAMEA4447499 WGS data

  The iPSC line SIGi001-A-9 / SAMEA4447499 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-9 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001095

• SIGi001-A-8 / SAMEA4448777 WGS data

  The iPSC line SIGi001-A-8 / SAMEA4448777 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-8 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001093

• SIGi001-A-5 / SAMEA4448708 WGS data

  The iPSC line SIGi001-A-5 / SAMEA4448708 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-5 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001092

• SIGi001-A-4 / SAMEA4448632 WGS data

  The iPSC line SIGi001-A-4 / SAMEA4448632 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-4 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001088

• SIGi001-A-6 / SAMEA4447426 WGS data

  The iPSC line SIGi001-A-6 / SAMEA4447426 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-6 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001078

• SIGi001-A-2 / SAMEA4451116 WGS data

  The iPSC line SIGi001-A-2 / SAMEA4451116 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-2 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001077

• SIGi001-A-12 / SAMEA104237570 WGS data

  The iPSC line SIGi001-A-12 / SAMEA104237570 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-12 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001076

• SIGi001-A-11 / SAMEA4451118 WGS data

  The iPSC line SIGi001-A-11 / SAMEA4451118 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-11 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001075

• SIGi001-A-10 / SAMEA4451117 WGS data

  The iPSC line SIGi001-A-10 / SAMEA4451117 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-10 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001074

• SIGi001-A-1 / SAMEA4451096 WGS data

  The iPSC line SIGi001-A-1 / SAMEA4451096 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-1 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001073

• BIONi010-C-2 / SAMEA4342705 WGS data

  The iPSC line BIONi010-C-2 / SAMEA4342705 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-2 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001068

• BIONi010-C-5 / SAMEA4452061 WGS data

  The iPSC line BIONi010-C-5 / SAMEA4452061 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line BIONi010-C-5 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001062

• SIGi001-A-7 / SAMEA4448730 WGS data

  The iPSC line SIGi001-A-7 / SAMEA4448730 has undergone whole genome sequencing. Whole genome sequencing was done using Illumina HiSeq X Five platform with a reference genome of GRCh38. Raw data as FASTQ files and analysed data as CRAM files are available for this sample, in this dataset. The iPSC line SIGi001-A-7 is available for research use at www.EBiSC.org.

  Dataset EGAD50000001060

• Paired-end Whole Exome-seq analysis of multi-centric lower grade glioma

  This dataset includes Nimblegen SeqCap EZ Exome v3 data for each lesion of three patients with multicentric glioma. For two patients, each lesion was sequenced along with whole blood. For a third patient, 3 pieces from the right lesion and 4 pieces from the left were sequenced along with whole blood. In each case BAM files that have been aligned with BWA mem alignment are available.

  Dataset EGAD00001003795

• Paired-WGS-two-families-with-GBA-variants-and-Parkinsons-disease

  We performed whole- genome sequencing, rare variant filtering, segregation analysis and functional validation of PD cosegregating rare genetic variation in two families (6 samples) segregating PD associated GBA variants c.115+1G>A (ClinVar ID: 93445, ) and p.L444P (ClinVar ID: 4288) respectively. The paired WGS sequencing was run on HiSeq X Ten and the library preparation kit was Illumina TruSeq DNA nano.

  Dataset EGAD00001006561

• 10X 3' V2 data of single immune cells in hepatocellular carcinoma

  The immune microenvironment of hepatocellular carcinoma (HCC) is poorly characterized. Combining two single-cell RNA sequencing technologies, we produced transcriptomes of CD45+ immune cells for HCC patients from five immune-relevant sites: tumor, adjacent liver, hepatic lymph node (LN), blood, and ascites. This is the droplet data of this study

  Dataset EGAD00001005961

• Exome sequencing of lung tissue conducted in SMC

  The data includes exome sequencing FASTQ files of 335 patients receiving immune checkpoint blockade therapy. The data only provides for WXS of tumor tissue.

  Dataset EGAD00001009101

• Epigenomic analysis of human dopaminergic neuron differentiation reveals LBX1, NHLH1 and NR2F1/2 as necessary for lineage specification

  Sample information: The 56 samples produced in this project come from the human iPSC line GM17602 (Coriell) where a tyrosine hydroxylase-T2A-mCherry reporter was inserted. A combination of epigenetic analysis (ATAC/ChIP) along transcriptomics.

  Dataset EGAD00001009288

• Intra-prostatic tumour evolution, steps in metastatic spread and histogenomic associations revealed by integration of multi-region whole genome sequencing with histopathological features

  We performed whole genome sequencing on 42 prostate cancer samples from the prostate, seminal vesicles and regional lymph nodes of five treatment-naive patients with locally advanced disease who underwent radical prostatectomy. Whole genome sequencing was performed as 150bp paired end reads on the Illumina NovaSeq 6000 platform.

  Dataset EGAD00001011174

• WXS Normal Samples Javelin head and neck 100

  We performed Whole Exome (WXS) and RNASeq sequencing on samples obtained from the phase 3 randomized, double-blinded, placebo-controlled study in patients with locally advanced squamous cell carcinoma of the head and neck JAVELIN Head and Neck 100 (NCT02952586). There are 471 WXS Tumor samples and 346 RNASeq tumor samples. All tumor samples have matching normal samples.

  Dataset EGAD00001011321

• Dataset for GIST-RNA

  Rare cancer sequencing data of 50 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008852

• Dataset for neuroendocrine_adrenal_tumor-EXON

  Rare cancer sequencing data of 164 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008891

• Dataset for other_cancer-EXON

  Rare cancer sequencing data of 137 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008896

• Liverpool Preterm Birth Biomarker Study

  Preterm birth is a multifactorial condition defined as birth less than 37 weeks of gestation. This study aimed to identify early pregnancy biomarkers from maternal genome-wide and transcriptome-wide data of women experiencing two types of spontaneous PTB (sPTB): spontaneous preterm birth (SPTB) and preterm premature rupture of membranes (PPROM). Whole blood samples were obtained from women with singleton pregnancies (N=567) recruited at the Liverpool Women’s Hospital at 16 and 20 weeks of gestation. Women with a previous history of sPTB pregnancies <34 weeks were categorised on their index pregnancy outcome as spontaneous preterm birth (SPTB) and preterm premature rupture of membranes (PPROM) or high-risk term control (HTERM, ≥37 weeks). Women with no history of SPTB/PPROM and delivered at term were LTERM (≥39 weeks of gestation). DNA was genotyped on the UK Biobank Axiom™ array (Applied Biosystems™, Thermo Fisher Scientific) and RNA who processed using the Clariom™ D Human assay (Thermo Fisher Scientific). Genome-wide association analysis, differential expression analysis and expression quantitative trait loci (eQTL) were completed.

  Study EGAS00001005076

• WGBS Discovery Samples

  The dataset contains valuable genomic data from a discovery cohort consisting of 29 individuals. This cohort is comprised of 8 healthy individuals (control), 8 patients with ST-segment elevation myocardial infarction (STEMI), 7 patients with non-ST-segment elevation myocardial infarction (NSTEMI), and 6 patients with unstable angina (UA). The genomic data was obtained by isolating cell-free circulating DNA (ccfDNA) and subjecting it to bisulfite conversion using a low-input BS-seq (PBAT) protocol. Sequencing was done on the Novaseq 6000 platform.

  Dataset EGAD00001010935

• Sensitive urothelial cancer detection via high volume urine DNA analysis

  Cystoscopy and imaging are the gold standard for urothelial cancer (UC) detection and surveillance, but cystoscopy is an uncomfortable procedure associated with adverse effects and a low diagnostic yield as only 10% of hematuria patients have UC. Urine tumor DNA (utDNA) is a non-invasive UC biomarker that has suffered from poor sensitivity for Ta stage tumors (<80%). We hypothesized that high urine volume analysis with a multi-gene panel could overcome these limitations, and developed a 100 mL utDNA laboratory platform (UroScout) that analyzes 25 commonly mutated UC genes and 8 copy number-altered loci for somatic alterations to detect UC.

  Study EGAS50000000630

• NIBIT-M4 Clinical Trial samples

  Patients (N=14) with unresectable stage III/IV melanoma received escalating doses of guadecitabine 30, 45, or 60 mg/m2/day subcutaneously on days 1 to 5 every 3 weeks, and ipilimumab 3 mg/kg intravenously on day 1 every 3 weeks, starting 1 week after guadecitabine, for four cycles. Patient-wise genome-wide DNA methylation, Whole Exome and RNA sequencing were then performed for samples obtained by surgical removal or fine-needle biopsy at baseline (W0), week 4 (W4) and week 12 (W12) after treatment. For Whole Exome Sequencing profiling, normal matched skin tissue was available only for the first eight patients.

  Study EGAS00001006736

• M116 CHIP Amplicon Sequencing

  Genomic DNA was obtained from M116 peripheral blood sample and was used for targeted deep sequencing (TDS) studies. Barcoded libraries were prepared according to the manufacturer’s instructions, using a probe-based panel (KAPA HyperCap, Roche®) targeting frequently mutated regions of 50 myeloid-related genes. Samples were run on a MiSeq (Illumina®) sequencer for paired-end 2x75 bp reads with a mean coverage of 1000X.

  Dataset EGAD50000001287

• Whole-genome sequencing of tumour, germline and plasma samples from a BRCA1-mutant breast cancer patient

  This data set contains the fastq files from whole-genome sequencing of temporally matched tumour (fresh frozen biopsies), blood germline and plasma samples collected from a BRCA1-mutant breast cancer patient to directly compare mutation signature analysis using gold-standard tumour-germline paired variant calling with a novel ctDNA-based method (MisMatchFinder).

  Dataset EGAD50000000811

• Genomic Profiling of Advanced Pancreatic Cancer to inform therapy - WGS mapped reads

  Genomics-Driven Precision Medicine for Advanced Pancreatic Cancer - Early Results from the COMPASS Trial - WGS mapped reads

  Dataset EGAD00001003585

• Highly differentiated, fusion-negative rhabdomyosarcoma.

  Sequencing was performed using OncoPanel v.2 (OPv2), an Agilent SureSelect custom designed bait set consisting of the coding regions of 504 genes, previously linked to human cancer. Sequencing wa sperformed on an Illumina HiSeq 2500. 14 highly differentiated, fusion-negative rhabdomyosarcoma tumor samples, and 8 non-matched normal skeletal muscle samples weer sequenced. BAM files are available for download.

  Dataset EGAD00001003746

• FFPE_normals_v2_gbm_wtsi_panel (2018-06-06)

  Targeted pulldown of approx 60 ffpe normal samples to use as normal controls . This dataset contains all the data available for this study on 2018-06-06.

  Dataset EGAD00001004152

• Balanced Brain Tumour Whole Genome Sequencing

  We propose to definitively characterise the somatic genetics of a number of pediatric malignant tumours including ependymoma, high grade glioma and central nervous system primitive neurectodermal tumours through generation of comprehensive catalogues of somatic mutations by high coverage genome sequencing.

  Dataset EGAD00001000369

• Paediatric IBD Mosaicism (2019-06-10)

  We want to investigate mosaic mutations as a cause of childhood IBD . This dataset contains all the data available for this study on 2019-06-10.

  Dataset EGAD00001005079

• SARS-CoV2 nasal epithelium

  Single cell RNA sequence generated from human primary nasal epithelium differentiated at air-liquid interface. This dataset comprises tissue from two donors, with cultures either unexposed or exposed to SARS-CoV2. Libraries were prepared using the 10X Genomics pipeline as per manufacturer's instructions.

  Dataset EGAD00001008159

• Dataset for MCPlus_WGS

  WES/WGS sequencing data of 44 chromothriptic tumor and control runs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001009277

• RNA Seq of 25 spheres derived from lymph nodes of lung cancer patients

  To further decipher the cell type composition within single spheres we performed RNA-Seq of 25 selected spheres of 4 different categories (including 8 signature-/balanced, 9 signature+/balanced, 1 signature-/aberrant, 7 signature+/aberrant). Samples were sequenced using Illumina NextSeq 2000.Fastq reads were processed using inhouse RNA-Seq workflow.

  Dataset EGAD00001011099

• SMARTer bulk RNA sequencing for highly purified CD271+ BMSCs from NBM and AML

  bulk RNAseq was conducted on highly purified CD45 - CD71 - CD235a - CD31 - CD271 + BMSCs isolated from a cohort of newly diagnosed 62 AML patients, uniformly treated within an intensive chemotherapy clinical trial and selected to represent the mutational landscape of AML

  Dataset EGAD00001011056

• (sn)RNA-seq dataset of Multi-modal analysis of pediatric pilocytic astrocytomas reveals tumor location-associated cellular and transcriptional heterogeneity

  Aim: to comprehensively characterize the cellular and transcriptional landscape of pediatric pilocytic astrocytomas across anatomical tumor locations

  Dataset EGAD00001015705

• Vulnerabilities of Midbrain Dopaminergic Neurons to Parkinson's Disease Revealed by Single-Cell Genomics

  We developed a novel protocol for the enrichment of midbrain DA neurons from frozen tissue. We subsequently performed single-nuclei RNA-sequencing on enriched samples from postmortem midbrain tissue from human, macaque, tree shrew, rat, and mouse. We identified vulnerable and resistant populations from these data and associated genetic enrichments and differential expression changes.

  Study phs002879

• Exome sequencing of matching primary tumor and venous tumor thrombus (VTT) renal cell carcinoma (RCC) samples

  We performed multiregion whole exome sequencing of a total of 37 samples from five consecutive patients (normal tissue, n=5; primary tumors, n=16; tumor thrombi, n=16) to &gt;35-fold target coverage. Matching primary tumor and venous tumor thrombus samples were analyzed. Four patients had a clear cell RCC, one patient had a poorly differentiated type II papillary RCC (RCC-VTT-04). The latter patient had a friable thrombus, the others were of solid consistency.

  Dataset EGAD00001004887

• Cell-free DNA and bone marrow samples from myelodysplastic syndromes

  We have assessed the molecular profile of a cohort of 70 patients with MDS by next-generation sequencing (NGS) using cfDNA and compared the results to paired bone marrow (BM) DNA.

  Dataset EGAD00001008567

• Clonal Decomposition and DNA Replication States Defined by Scaled Single-Cell Genome Sequencing

  Accurate measurement of clonal genotypes, mutational processes, and replication states from individual tumor-cell genomes will facilitate improved understanding of tumor evolution. We have developed DLP+, a scalable single-cell whole-genome sequencing platform implemented using commodity instruments, image-based object recognition, and open source computational methods. Using DLP+, we have generated a resource of 51,926 single-cell genomes and matched cell images from diverse cell types including cell lines, xenografts, and diagnostic samples with limited material. From this resource we have defined variation in mitotic mis-segregation rates across tissue types and genotypes. Analysis of matched genomic and image measurements revealed correlations between cellular morphology and genome ploidy states. Aggregation of cells sharing copy number profiles allowed for calculation of single-nucleotide resolution clonal genotypes and inference of clonal phylogenies and avoided the limitations of bulk deconvolution. Finally, joint analysis over the above features defined clone-specific chromosomal aneuploidy in polyclonal populations.

  Study EGAS00001003190

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• single-nuclei RNA-seq of primary pineal parenchymal tumors

  Raw fastq files for 10x Chromium snRNA-seq of pineal parenchymal tumors profiled in the study "A tumor-associated photoreceptor signature unifies distinct central nervous system malignancies".

  Dataset EGAD50000002101

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Epilepsy related sudden death (2019-08-21)

  These samples include exome sequences of samples from patients who suffered Sudden Unexplained Death in Epilepsy. They all are of European descent. . This dataset contains all the data available for this study on 2019-08-21.

  Dataset EGAD00001005276

• Target capture sequence for Primary-recurrent HCC study

  This dataset contains target capture sequence data from 255 samples, including 154 tumors and 101 normal samples. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001005450

• Exploring the extracellular transcriptome in seminal plasma for non-invasive prostate cancer diagnosis

  mRNA capture sequencing data of 57 seminal plasma samples.

  Dataset EGAD00001007688