17848 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 45.09 milliseconds.

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma cases. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dataset EGAD50000000546

• Next generation sequencing data of circulating tumor DNA and matched tumor tissues

  For each subject, genomic DNA from whole blood, circulating cell free DNA and tumor tissues (whenever possible) were performed targeting next generation sequencing on Illumina Miseq or Hiseq 4000 platforms. The sequencing results of whole blood were used to distinguish germline and somatic mutations. Specimens were collected from patients with different kinds of solid tumors, but most are lung cancer patients.

  Dataset EGAD00001003176

• Genomic Profiling of Advanced Pancreatic Cancer to inform therapy - RNA-Seq unmapped reads

  Genomics-Driven Precision Medicine for Advanced Pancreatic Cancer - Early Results from the COMPASS Trial - RNA-Seq unmapped reads

  Dataset EGAD00001003582

• Balanced Ependymoma

  We propose to definitively characterise the somatic genetics of a number of pediatric malignant tumours including ependymoma, high grade glioma and central nervous system primitive neurectodermal tumours through generation of comprehensive catalogues of somatic mutations by high coverage genome sequencing.

  Dataset EGAD00001000350

• Transcriptomic sequences of small intestinal Plasma cells from Celiac disease patients

  Transcriptomic sequences of small intestinal Plasma cell (PCs)s from Celiac disease patients. RNAseq data produced using Illumina paired-end (75bp) reads. Includes only raw data of sequences (fastq format). Samples from seven Celiac disease patients and four healthy controls. Samples from Celiac disease patients contain sub-groups of PCs that are either specific or not specific to autoantigen of the disease (TG2).

  Dataset EGAD00001004481

• Benchmarking CRISPR Whole-genome Drop-out Screen - B&S (2019-08-07)

  This study is a benchmarking exercise to explore potential source of variation between different CRISPR drop out libraries. . This dataset contains all the data available for this study on 2019-08-07.

  Dataset EGAD00001005233

• Whole exome sequencing of advanced gastric cancer

  To define the cellular characteristics of malignant ascites of advanced gastric cancer patients and search for therapeutic strategies, we obtained 5 malignant ascites and 1 cerebrospinal fluid from five patients with gastric cancer. We analyzed single-cell RNA-seq data of 180 cells from 4 malignant ascites and 1 cerebrospinal fluid metastasis using Fluidigm® C1™ System. Whole exome sequencing data was also generated from blood or tumor tissue.

  Dataset EGAD00001005740

• Single-nucleus Isoforms of Down Syndrome Brains (long-read)

  16 DS and Control brains samples were prepared using the 10X Genomics Single Cell 3' v3 kit. Pre-fragmented cDNA libraries were loaded onto a Pacific Biosciences Sequel II to sequence single-nucleus isoforms.

  Dataset EGAD00001008286

• BCG Molecular Subtyping

  Dataset for the paper: Non-muscle Invasive Bladder Cancer Molecular Subtypes Predict Differential Response to Intravesical Bacillus Calmette-Guérin

  Dataset EGAD00001010065

• Ribosomal profiling on Epstein-Barr virus transformed B-lymphoblastoid cell lines

  Epstein-Barr virus-transformed B-lymphoblastoid cell lines from six individuals (HG00114, HG00282, NA12005, NA12044, NA12717 and NA12751) of the GEUVADIS Project were selected for ribosomal profiling. For each EBV-LCL, 20 million cells were treated with 2 μg/ml harringtonine and 100 μg/ml cycloheximide. After lysing cells in lysis buffer supplemented with 100 μg/ml cycloheximide, ribosome complexes were purified by density purification. Small RNA molecules were isolated using the NucleoSpin miRNA Kit (Bioke, Leiden, Netherlands), followed by RNA PAGE gel separation. Universal linkers were added after dephosphorylation. After reverse transcription, the cDNA was circularized and, after ribosomal RNA depletion, barcoded and sequenced on Illumina NextSeq 500.

  Dac EGAC50000000209

• EM-seq data from plasma cfDNA samples of ALS patients, control and C9-carriers

  This dataset contains targeted EM-seq data from 61 plasma cfDNA samples spanning 20 sporadic ALS, 10 C9orf72-ALS, 10 asymptomatic C9orf72 expansion carriers, and 21 non-disease controls. Libraries were prepared with the NEBNext Enzymatic Methyl-seq (EM-seq) kit, captured using the Twist Human Methylome Panel (3.98 M CpGs; 123 Mb), and sequenced on Illumina NovaSeq 6000 (150 bp paired-end; ~45× on-target depth) with unmethylated lambda DNA spike-in and a 20% PhiX balance library. The dataset includes per-sample gzipped FASTQ files (R1/R2) and minimal metadata.

  Dataset EGAD50000001808

• Longitudinal Transcriptomic Profiling of Endothelial Progenitor Cells in Post-COVID-19 Patients: Insights at 3 and 6-Months Post-SARS-CoV-2 Infection

  Raw transcriptomic data from endothelial cells of post-COVID patients and healthy controls. Samples were collected from post-COVID patients at 3 months (n = 6) and 6 months (n = 6) post-infection, as well as from healthy control individuals (n = 5). All post-COVID patients were hospitalized during the first wave of the pandemic. Among them, half developed pulmonary embolism (TEP; n = 6), while the other half did not (no TEP; n = 6).

  Dataset EGAD50000001452

• 10X single cell RNA- and feature barcode sequencing of 38 AML samples

  This dataset contains fastq-files from single cell 3' RNA- and feature barcode sequencing of AML samples using 10X technology (Chromium Single Cell 3ʹ Reagent Kit v3). In total, the dataset contains data from 38 AML samples from either bone marrow or peripheral blood, representing the following genetic subtypes: NPM1-mutated, myelodysplasia related, TP53-mutated, CBFB::MYH11, RUNX1::RUNX1T1, AML without class-defining mutations, and AML meeting criteria of two subtypes. The data consists of sequenced gene expression libraries from 38 samples and feature barcoding libraries covering a panel of 10-14 surface proteins for 34 samples.

  Dataset EGAD50000001577

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• Single cell resolution of human CNV body map (2019-10-02)

  12 tissues from the warm autopsy are selected for this project. Using 10X Chromium technology we will generate ~1000 single cell/nulei genomic libraries per tissue. Each tissue will be whole genome sequenced (~2 lanes per 1000 cells) on hiseq X10. per single cell we will generate CNV profile and we investigate the level of genomic heterogenity with in tissue and across different tissues. . This dataset contains all the data available for this study on 2019-10-02.

  Dataset EGAD00001005372

• Whole Genome Sequences of 18th century African descended individuals from Charleston, South Carolina.

  This study presents Whole Genome Sequencing results from the Anson Street African Burial Ground Project, which is a community-based initiative aimed at understanding the histories of 37 Ancestors in Charleston, South Carolina. Here we report fastq files for all 37 Ancestors. DNA was extracted at the University of Tennessee-Knoxville following Dabney et al. 2013, and dual index libraries prepared using a modified NEBNext Ultra II kit with partial USER enzyme digestion. Libraries were then enriched for human genomic DNA (MyBaits) and sequenced on Illumina Platforms.

  Dataset EGAD00001009643

• Blood plasma and FFPE derived total RNA seq dataset from DLBCL and PMBCL patients

  Blood plasma samples (n=168) and matched diagnostic formalin-fixed paraffin-embedded (FFPE) tissue samples (n=69) of DLBCL patients, PMBCL patients and healthy controls were collected between 2016-2021. Plasma samples were collected at diagnosis, at interim evaluation, after treatment, and in case of refractory or relapsed disease. RNA was extracted from 200 µl plasma using the miRNeasy serum/plasma kit and from FFPE tissue using the miRNeasy FFPE kit. RNA was subsequently sequenced on a NovaSeq 6000 instrument using the SMARTer Stranded Total RNA-seq pico v3 library preparation kit.

  Dataset EGAD00001011679

• Bulk and Single-Nuclei RNA-seq with ATAC-seq of Breast Tumors Pre- and Post-Palbo ciclib/Endocrine Therapy

  This dataset comprises bulk and single-nuclei multiomic profiles from patients with ER+/HER2- early breast cancer enrolled in the NeoRHEA phase 2 trial. The bulk RNA-seq component includes 78 pre-treatment and 49 post-treatment tumor samples from 97 patients. The single-nuclei component includes matched pre- and post-treatment samples from 37 patients, totaling 63 samples analyzed by simultaneous snRNA-seq and snATAC-seq. Combined, the data contains bulk transcriptional profiles and single-nuclei gene expression/chromatin accessibility matrices for over 226,000 high-quality nuclei, encompassing tumor, immune, and stromal cells. Technologies used include Illumina NovaSeq 6000 for sequencing and the 10x Genomics Chromium platform (Multiome kit for single-nuclei, standard RNA library prep for bulk).

  Dataset EGAD50000002038

• GWAS on covid-19 severity and susceptibility in the province of Bergamo, Italy

  This is a case-control GWAS that involved the voluntary recruitment of inhabitants of the Bergamo province via an online questionnaire. We collected detailed clinical data and verified all information through personal interviews. Cases (severe COVID-19; G1) and controls (mild or asymptomatic COVID-19, G2; non-infected, G3) were matched by age, sex and risk factors

  Study EGAS00001007310

• A first-in-human clinical study of an allogenic iPSC-derived corneal endothelial cell substitute transplantation for bullous keratopathy

  iPSC-derived corneal endothelial cell substitutes recover pathological corneal edema. No adverse reactions are observed after one year follow-up. Gene mutations may appear despite whole genome sequencing of the master cell bank. This study contains WGS data.

  Study EGAS50000000672

• RNA-seq and ATAC-seq data for ex vivo expanded T cells

  This dataset contains bulk RNA-seq and ATAC-seq data generated from naïve CD8+ T cells isolated from PBMCs of three healthy donors and stimulated ex vivo under multiple conditions. The dataset comprises 30 samples in total, including 15 RNA-seq samples and 15 ATAC-seq samples. Paired-end sequencing was performed on the Illumina NovaSeq 6000 platform. Raw data are provided as gzipped paired FASTQ files.

  Dataset EGAD50000002471

• Transcriptome analysis of patient-derived Schwann cells isolated from human sural nerve biopsies

  This dataset contains the transcriptome analysis of human Schwann cell cultures obtained from sural nerve biopsies from six patients with polyneuropathies (N=3/patient, totalN=18) as well as the nerve fascicles from where they were isolated (N=1/patient, totalN=6). In addition, this dataset includes 8 samples out of commercial human Schwann cell cultures and one sample of a fibroblast culture, which serve as controls for further analysis.

  Dataset EGAD50000001021

• ICARUS-BREAST01 Dataset

  A phase II clinical trial (NCT04965766) of patritumab deruxtecan in 99 breast cancer patients. Whole-exome sequencing (WES) is available for 43 tumor samples and 43 blood samples collected at entry into the trial. RNA-squencing is available for 44 samples comprising 22 samples collected at entry into the trial and 22 samples collected during treatment (cycle 1 day 3, cycle 1 day 19, or cycle 2 day 3) from 22 patients.

  Dataset EGAD50000000773

• Expression array

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed.
This dataset contains expression array data for 32 patients of the screening cohort with 8 of them having paired normal tissue plus an additional relapse tumor/normal pair of one of those 8 patients and a patient only with normal tissue. Data was generated on a HumanHT-12 v4 Bead Array (Illumina) and is stored in IDAT file format.

  Dataset EGAD00010002596

• RNA-seq TPMs quantification for baseline tumor samples originating from IMpower150, and relevant clinical metadata

  This dataset includes full tumor transcriptomes from 558 advanced NSCLC tumors. These data originate from pre-treatment samples from a clinical trial for first-line non-small cell lung cancer (IMpower150). The patients in this trial were treated with the PD-L1 inhibitor atezolizumab +bevacizumab + chemotherapy or bevacizumab + chemotherapy or atezolizumab + chemotherapy.

  Dataset EGAD50000001814

• The spatial organization of intratumor heterogeneity and evolutionary trajectories of metastasis in hepatocellular carcinoma

  A dataset consisting of Multi-regional Whole Exome Sequencing (WES) and Whole Genome Sequencing (WGS) data for 54 samples from 9 patients with hepatocellular carcinoma. The dataset includes 45 tumor samples and 9 normal blood samples. Selected somatic variants were validated by Sequenom. Patients covered are: Patient 1, Patient 2, Patient 3, Patient 4, Patient 5, Patient 6, Patient 7, Patient 8, Patient 9 and Patient 10.

  Dataset EGAD00001003138

• Exome sequencing of control DNA samples from patients with BPLL

  DNA extracted from sorted CD3+ cells (16 patients) was used for exome capture with the SureSelect V5 Mb All Exon Kit following the standard protocols. Paired-end sequencing (2 x 100 bp) was performed using HiSeq2000 sequencing instruments.The files are in FASTQ format.

  Dataset EGAD00001004411

• Whole exome sequencing data for Molecular Characterization of ETMRs

  This dataset contains exome sequencing data from 21 samples. Sequencing of samples using whole-exome sequencing was per- formed by creating libraries using the IlluminaTruSeq exome enrich- ment kit following the manufacturer’s instructions after size selection. Size selection was performed by fractionation using a Covaris ultra- sonicator and subsequent selection was performed using a 1.5% gel Pippin Prep cassette (Sage Science). One lane per sample has been sequenced resulting in 42 Fastq files (paired end).

  Dataset EGAD00001006210

• Multiple myeloma follow-up Dataset

  77 samples collected from 35 multiple myeloma patients. Each patient provided one healthy sample and one primary tumor sample and, in some cases, also samples collected after the progression of the disease.

  Dataset EGAD00001010161

• Extensive patient-to-patient single nuclei transcriptome heterogeneity in pheochromocytomas and paragangliomas

  Pheochromocytomas (PC) and paragangliomas (PG) are rare neuroendocrine tumors of varied genetic makeup, associated with high cardiovascular morbidity and a variable risk of malignancy. We focused on PCPG tumors with germline SDHB and RET mutations, representing distinct prognostic groups with worse or better prognoses, respectively. We applied single-nuclei RNA sequencing (snRNA-seq) on tissue samples from 11 patients.

  Study EGAS00001006230

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Analysis File for 87 Argentinean individuals

  VCF for 87 Argentinean samples. Only SNPs (no indels) that passed the Affymetrix QC. Data from Luisi et al. 2020. Plos One. Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina. Reference Allele column does NOT contain reference allele from genome assembly.

  Dataset EGAD00001006227

• Whole-genome-seqeuncing IMFT

  Whole-genome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007804

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• Germline variants in patients with rare cancers - control samples WGS and WES

  The control samples (mostly blood) of 351 samples (paired WGS and WES sequencing) are in this dataset. The WGS was in nearly all cases at an Illumina HighSeq X Ten with the Illumina TruSeq Nano DNA Kit. The WES mostly on Illumina HighSeq 4000 with the Agilent SureSelect V5 plus UTRs Kit.

  Dataset EGAD00001010047

• A phase II trial of the aurora kinase A inhibitor alisertib for patients with castration resistant and neuroendocrine prostate cancer: efficacy and biomarker evaluation

  Neuroendocrine prostate cancer (NEPC) is an aggressive variant of prostate cancer that may develop de novo or as a mechanism of treatment resistance. N-myc is capable of driving NEPC progression. Alisertib inhibits the interaction between N-myc and its stabilizing factor Aurora-A, inhibiting N-myc signaling, and suppressing tumor growth. In this single arm, multi-institutional open label phase 2 clinical trial of alisertib, sixty men were treated with alisertib 50mg twice daily for 7 days every 21-days. Eligibility included metastatic prostate cancer and at least one: small cell neuroendocrine morphology; ≥50% neuroendocrine marker expression; new liver metastases without PSA progression; elevated serum neuroendocrine markers. The primary endpoint was six-month radiographic progression free survival. Pre-treatment biopsies were evaluated by whole exome and RNA-seq.

  Study phs001666

• Comparative transcriptomics reveal molecular convergence and divergence in parkinsonian disorders

  Elucidate the biological convergence and divergence across the parkinsonian spectrum. The study contains data processed at two different sites as well as Alzheimer's disease as an non-parkinsonian control. Specifically, Parkinson's disease (PD, N=448), dementia with Lewy bodies (DLB, N=80), multiple system atrophy (MSA, N=35), progressive supranuclear palsy (PSP, n=42), corticobasal degeneration (CBD, n=17), Alzheimer's disease (AD, N=72) and neurologically healthy controls (N=283). RNA-seq was carried out using ribosomal depletion.

  Study EGAS50000001815

• Targeted Sequencing of 173 genes

  Targeted sequencing of 173 genes in 2433 primary breast tumours. Data includes 2433 tumour samples, 523 adjacent normal (breast) samples and 127 blood samples. Libraries were prepared with Illumina's Nextera custom enrichment kit targetting all the exons of the most frequently mutated breast cancer genes. Libraries were multiplexed (48 libraries per lane) and sequenced on Illumina HiSeq 2000 (100bp paired-end reads). Somatic mutations were calling with a custom pipeline. We identified 40 mutation-driver (Mut-driver) genes, and determined associations between mutations, driver CNA profiles, clinical-pathological parameters and survival. We assessed the clonal states of Mut-driver mutations, and estimated levels of intra-tumour heterogeneity using mutant-allele fractions. The results emphasize the importance of genome-based stratification of breast cancer, and have important implications for designing therapeutic strategies. Referece: Pereira et al. (2016) The somatic mutation profiles of 2,433 breast cancers refines their genomic and transcriptomic landscapes. Nature Communications

  Dataset EGAD00001002115

• Progressive supranuclear palsy - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA-seq dataset from prefrontal cortex for a total of N=42 samples. Tissue samples correspond to donors with pathologically confirmed progressive supranuclear palsy. RNA-seq was carried out using ribosomal depletion. Dataset contains paired fastq files, sample metadata and downstream quantification files. Quantification was performed with salmon v1.3.0 with Gencode 35 (GRCh38.p13).

  Dataset EGAD50000002623

• Multiple system atrophy - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA-seq dataset from prefrontal cortex for a total of N=35 samples. Tissue samples correspond to donors with pathologically confirmed multiple system atrophy. RNA-seq was carried out using ribosomal depletion. Dataset contains paired fastq files, sample metadata and downstream quantification files. Quantification was performed with salmon v1.3.0 with Gencode 35 (GRCh38.p13). N=6 samples are overlapping with EGAS50000000301.

  Dataset EGAD50000002624

• Alzheimer's disease - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA-seq dataset from prefrontal cortex for a total of N=72 samples. Tissue samples correspond to donors with pathologically confirmed Alzheimer's disease. RNA-seq was carried out using ribosomal depletion. Dataset contains paired fastq files, sample metadata and downstream quantification files. Quantification was performed with salmon v1.3.0 with Gencode 35 (GRCh38.p13).

  Dataset EGAD50000002625

• Dementia with Lewy bodies - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA-seq dataset from prefrontal cortex for a total of N=80 samples. Tissue samples correspond to donors with pathologically confirmed dementia with Lewy bodies. RNA-seq was carried out using ribosomal depletion. Dataset contains paired fastq files, sample metadata and downstream quantification files. Quantification was performed with salmon v1.3.0 with Gencode 35 (GRCh38.p13).

  Dataset EGAD50000002626

• Parkinson's disease - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA-seq dataset from prefrontal cortex for a total of N=448 samples. Tissue samples correspond to donors with pathologically confirmed Parkinson's disease. RNA-seq was carried out using ribosomal depletion. Dataset contains paired fastq files, sample metadata and downstream quantification files. Quantification was performed with salmon v1.3.0 with Gencode 35 (GRCh38.p13). N=81 samples are overlapping with EGAS50000000301.

  Dataset EGAD50000002627

• Controls - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA-seq dataset from prefrontal cortex for a total of N=283 samples. Tissue samples correspond to health control donors. RNA-seq was carried out using ribosomal depletion. Dataset contains paired fastq files, sample metadata and downstream quantification files. Quantification was performed with salmon v1.3.0 with Gencode 35 (GRCh38.p13). N=21 samples are overlapping with EGAS50000000301.

  Dataset EGAD50000002628

• Corticobasal degeneration - bulk RNA seq of prefrontal cortex

  Dataset corresponding to the bulk RNA-seq dataset from prefrontal cortex for a total of N=17 samples. Tissue samples correspond to donors with pathologically confirmed corticobasal degeneration. RNA-seq was carried out using ribosomal depletion. Dataset contains paired fastq files, sample metadata and downstream quantification files. Quantification was performed with salmon v1.3.0 with Gencode 35 (GRCh38.p13).

  Dataset EGAD50000002629

• CCA ChIP-seq data (63 CCA, 8 normal, 19 cell-line)

  Fastq files for H3K27ac ChIP-seq (with matched input-DNA control) for 63 CCAs, 8 normal bile duct tissues, 16 CCA cell-lines (including replicates), and 3 normal cholangiocyte cell-lines (including replicates). Library prep was performed with the NEBNext ChIP-seq library preparation kit. Each library (including matching input DNA) was sequenced to an average depth of 20 to 30 million raw reads on Illumina HiSeq4000 sequencer, with paired-end sequencing (except for 3 normal bile tissues done with single-end sequencing).

  Dataset EGAD00001012103

• Rapid Acceleration of Diagnostics - Digital Health Technologies (RADx-DHT): NIH Digital Health Solutions for COVID-19: SAFER-COVID - Integration of Testing and Digital Health

  SAFER-COVID provides a set of self-management tools to consumers to track symptoms, test results, vaccine record, and environmental factors, such as exposure to others. Consumers may choose to integrate data from wearables and electronic health records (EHR) for self management. These data are used to enable multiple use cases such as return-to-work, activity risk assessment and self-management within SAFER-COVID.DOI: https://rapids.ll.mit.edu/10.57895/cmt5-gh78

  Study phs002540

• ATAC sequencing raw data files of human Treg cell subsets

  Assay for Transposase-Accessible Chromatin using sequencing (ATAC) sequencing of human CD38+, HLA-DR+, CD38+ HLA-DR+, and CD38- HLA-DR- regulatory T (Treg) cell subsets sorted from peripheral blood pooled from 4 healthy donors. After isolation and purification of Treg cell subsets with flow cytometry, samples were frozen and transferred to Active Motif for ATAC sequencing. The dataset contains one raw sequencing file (fastq) of accesible regions for each of the above-mentioned Treg cell subsets.

  Dataset EGAD50000000664

• GEL WGS Comparison

  These samples are to be analysed with the CGP Developed cancer panel and the results will be compared with WGS data from 4 different comercial providers.

  Dataset EGAD00001000872

• New Brain Tumor Entities Emerge from Molecular Classification of CNS-PNETs

  Primitive neuroectodermal tumors of the central nervous system (CNS-PNETs) are highly aggressive, poorly differentiated embryonal tumors occurring predominantly in young children but also affecting adolescents and adults. Herein we demonstrate that a significant proportion of institutionally diagnosed CNS-PNETs display molecular profiles indistinguishable from those of various other well defined CNS tumor entities, facilitating diagnosis and appropriate therapy for patients with these tumors. From the remaining fraction of CNS-PNETs we identify four new CNS tumor entities, each associated with a recurrent genetic alteration and distinct histopathological and clinical features. These new molecular entities, designated “CNS neuroblastoma with FOXR2 activation (CNS NB-FOXR2)”, “CNS Ewing sarcoma family tumor with CIC alteration (CNS EFT-CIC)”, “CNS high grade neuroepithelial tumor with MN1 alteration (CNS HGNET-MN1)”, and “CNS high grade neuroepithelial tumor with BCOR alteration (CNS HGNET-BCOR)”, will enable meaningful clinical trials and the development of therapeutic strategies for patients affected by poorly differentiated CNS tumors.

  Study EGAS00001001632

• Oxford Nanopore targeted RNA-based amplicon data of 12 classical HLA genes

  The dataset consists of Oxford Nanopore targeted RNA-based amplicon data of 12 classical HLA genes (HLA-A, -B, -C, -DRA, -DRB1, -DRB3, -DRB4, -DRB5, -DQA1, -DQB1, -DPA1, and DPB1) of 50 healthy individuals. The 12 classical genes were sequenced in two separate gene pools on R9.4 flowcells using MinION sequencer. Per individual, gene pool 1 contains HLA-A, -B, -C, -DRB1, -DRB3, -DRB4, -DRB5, and -DPB1 and gene pool 2 HLA-DRA, -DQA1, -DQB1, and -DPA1. The dataset includes 100 fastq files of Oxford Nanopore 2D reads (50 for gene pool 1 and 50 for gene pool 2).

  Dataset EGAD00001006814

• RNA-Seq data of hepatoma (Huh7 derived) and Ph5CH cells and primary hepatocytes

  The innate immune response of cells of hepatic origin (Huh7, Huh7.5, PH5CH and primary human hepatocytes (PHH), 66 samples) was analyzed by transcriptome analysis (RNAseq) upon supernatant delivery or transfection of synthetic dsRNA (poly(I:C)). Expression of TLR3 and RIG-I was reconstituted by lentiviral transduction in Huh7 and Huh7.5 cells. The sequencing is single RNA-Seq on an Illumina HiSeq 4000 with the Illumina TruSeq stranded mRNA kit.

  Dataset EGAD00001007083

• COVID-19 progression and resolution in common variable immunodeficiency patients

  116,958 single-cell transcriptomes from samples of peripheral blood mononuclear cells (PBMCs) from five CVID patients at three distinct stages of the SARS-CoV-2 infection: 1) baseline, before viral infection, 2) progression, during viral infection, and 3) convalescence, once the viral infection had been resolved and the patient was PCR negative. CVID patients were under regular immunoglobulin replacement therapy and displayed only mild symptoms during SARS-CoV-2 infection.

  Dataset EGAD00001009773

• Analysis of copy number variation landscape of glioma by shallow coverage whole genome sequencing

  We reported shallow coverage whole genome sequencing (WGS) is an economic method for identification of whole genome somatic copy number variation (SCNV). Combining with a Taqman low density array (TLDA) designed for molecular subtyping of glioma, it enabled classification of glioma into biological entities with different cellular origin and genomic alterations. Further, we also showed shallow-coverage WGS enabled systematic identification of clonal and subclonal SCNV in glioma genomes and the burden and pattern of SCNV can serve as an objective marker of tumor progression and predict risk and relapse.

  Study EGAS00001003690

• RNA-seq data from 121 tumor samples with muscle invasive bladder cancer.

  In this study, a total of 300 patients with MIBC receiving chemotherapy were included; 62 received NAC before cystectomy and 245 received first-line chemotherapy upon detection of locally-advanced (T4b) or metastatic disease. Treatment response, defined as pathological downstaging (< pTa,CIS,N0) after NAC or complete or partial response after first-line treatment (RECIST criteria). RNA-seq was performed using the QuantSeq kit FWD HT kit (Lexogen) using 500 ng input RNA from 121 tumor samples. Data provided here consist of 780 fastq files for RNA-seq.

  Study EGAS00001004505

• The Transcriptomic Landscape of Oncogenic PI3K Reveals Key Functions in Splicing and Gene Expression Regulation

  This study includes RNA-seq of paired tumor biopsies from PIK3CA-mutated breast cancer patients that underwent treatment with PI3Kα inhibitors.

  Study phs002840

• Dataset for "HPV integration induces gene fusions" (Illumina)

  Illumina whole-genome sequencing data for "HPV integration induces gene fusions" We performed short read whole-genome sequencing of five HPV+ head and neck cancer samples using Illumina. The reads are submitted in bam or fastq file format.

  Dataset EGAD50000001305

• High-grade serous ovarian carcinoma tumour whole genome sequencing variants

  Tumour somatic variants (in VCF format) called from paired tumour-germline whole genome sequencing (using IDT library preparation system followed by sequencing on Illumina NovaSeq platform) of three high-grade serous ovarian tumour samples. The dataset comprises three VCF variant files.

  Dataset EGAD50000001131

• Variants Derived From Kids Heart BioBank TOF Probands (Australia)

  Short variants identified in 245 TOF probands enrolled through the Kids Heart BioBank (Australia).

  Dataset EGAD50000000839

• Variants Derived From CONCOR Biobank TOF Probands (Netherlands)

  Short variants identified in 125 TOF probands enrolled through the CONCOR Biobank (Netherlands).

  Dataset EGAD50000000837

• Age-dependent association of clonal hematopoiesis with COVID-19 mortality in patients over 60 years

  Targeted sequencing with the Myeloid Solutions™ Panel (MYS) of SOPHiA Genetics for COVID-19 patientds (n=241 deceased, n=239 survivors).

  Dataset EGAD50000000001

• Hepatitis B virus integrations promote local and distant oncogenic driver alterations in hepatocarcinogenesis

  This study contain the WGS and WEX aligned bam files and RNA-seq fastq files for human liver tumors.

  Dataset EGAD00001006426

• Genome-wide data of Erasmus Rucphen Family (ERF) Study

  The data consists of 678189 genome-wide polymorphic variants of 3658 individuals from ERF/GRIP region in a variant call format (vcf) file. ERF has been genotyped with different genotyping platform: Illumina 318 k, 350 k, 610 k and Affymetrics 200 k.

  Dataset EGAD00001003571

• Colorectal organoids and tumoroids - pulldown (2018-08-13)

  Targeted capture of cancer gene panel bait set in single cell derived organoids from colon tissue and colorectal cancer from 1 patient. . This dataset contains all the data available for this study on 2018-08-13.

  Dataset EGAD00001004292

• ChIPseq of neuroblastoma

  This dataset contains 4 samples (2x input and 2x H3K27ac ChIPseq) in the IC-pPDXC-63 cell line.

  Dataset EGAD00001006557

• BRIDGE SPEED April 2016

  Whole genome sequencing CRAM files for four samples from the BRIDGE Consortium (SPEED project) with pathogenic variants in a gene associated with a movement disorder.

  Dataset EGAD00001002070

• Targeted sequencing of breast cancer susceptibility genes for 1,995 Japanese breast cancer patients

  This dataset consists of 106 bam files. Each sample from 10-20 consecutive patient extractions were combined into one DNA pool, generating a total of 106 DNA pools. We sequenced 11 genes implicated in hereditary breast cancer using the SureSelect Custom kit.

  Dataset EGAD00001006368

• Genome-wide data for 11 Roma individuals

  This dataset includes genome-wide autosomal array data for 11 Iberian Roma individuals used in the Merchero project.

  Dataset EGAD00001007773

• miRNA and mRNA transcriptome data

  This dataset contains 278 miRNA and 20 mRNA transcriptomes generated as part of the study "miR-374a-5p regulates inflammatory genes and monocyte function in inflammatory bowel disease."

  Dataset EGAD00001008683

• SmartSeq2 index cultures

  SmartSeq2 read out of index cultured cell sorted with the classification and erythroid-myeloid panel developed in main Figure 6.

  Dataset EGAD00001008187

• Somatic copy-number alterations in plasma circulating tumor DNA from advanced EGFR-mutated lung adenocarcinoma patients

  This is the raw data obtained from shallow whole-genome sequencing of plasma DNA (plasma-seq) for calling of somatic copy number alterations as well as focal amplifications from patients with lung cancer.

  Dataset EGAD00001007505

• Whole-exome sequencing of IMFT tumor samples f

  Whole-exome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007803

• WGS of NPC268_Tumor and NPC268_Cell_line

  This dataset contains WGS data in the form of BAM files for NPC268 - "Tumor" derived from snap-frozen tissue while "Cell line" derived from late passage NPC268 cell line. Extracted DNA was sent for 100x and 60x WGS with Novogene via Apical Scientific Sdn Bhd.

  Dataset EGAD00001010292

• Oncoprint GSCCs

  This dataset contains DNA sequencing data from 7 GSCCs (data for BT569 is not available). We performed focused exome sequencing (43 most mutated genes in GBM), combined with OneSeq analysis (Agilent) on the GSCCs and identified both shared and GSCC-specific mutations. For CME038, whole genome sequencing was performed.

  Dataset EGAD00001011276

• Single-nucleus RNA sequencing (snRNA-seq) of seven human diffuse midline glioma (DMG) patient tumour samples.

  This dataset comprises 7 paired (14 total) FASTQ files of single-nucleus RNA sequencing (snRNA-seq) data generated from seven human diffuse midline glioma (DMG) patient tumour samples. snRNA-seq libraries were generated using the 10X Chromium Controller and Chromium Next GEM Single Cell 3’ kit version 3.1 in line with the manufacturer’s instructions. Generated libraries were sequenced on an Illumina NextSeq 2000 (P3 XLEAP-SBS chemistry) at targeted 20,000 reads per nucleus.

  Dataset EGAD50000002514

• Sequencing data for ICGC Oesophageal Adenocarcinoma tissue samples - 100

  Samples from the "100" project that are in the ICGC PanCancer project.

  Dataset EGAD00001001071

• Next Generation Sequencing Characterization of Hematopoietic Stem and Progenitors Cells in Human Systemic Lupus Eryhtematosus

  This dataset contains RNA-sequencing of Bone marrow-derived CD34+ cells from Healthy Controls (n=2) and SLE patients (n=8). SLE patients are divided into two categories based on severity: patients with moderate/mild disease (n=3) and patients with severe disease (n=5). Libraries were generated using the Illumina TruSeq Sample Preparation kit v2. Single-end 75-bp mRNA sequencing was performed on Illumina NextSeq 500. The raw fastq files are uploaded.

  Dataset EGAD00001005052

• PBMC gene expression profiles in diet treated celiac disease upon oral gluten challenge

  This dataset contains PBMC genome-wide RNAseq reads from 21 samples and one expression matrix file after alignment and aggregation of the 21 samples. The samples are case-control drawn on day 6 from long-term GFD treated CD patients after 3 day oral gluten challenge, on day 0 from patient controls on long-term GFD treatment, and on day 6 from 4 week GFD treated healthy controls after 3 day oral gluten challenge.

  Dataset EGAD00001006655

• Next Generation Sequencing Characterization of Hematopoietic Stem and Progenitors Cells in Human Systemic Lupus Eryhtematosus (2)

  This dataset contains RNA-sequencing of Bone marrow-derived CD34+ cells from Healthy Controls (n=2) and SLE patients (n=10). SLE patients are divided into two categories based on severity: patients with moderate/mild disease (n=4) and patients with severe disease (n=6). Libraries were generated using the Illumina TruSeq Sample Preparation kit v2. Single-end 75-bp mRNA sequencing was performed on Illumina NextSeq 500. The raw fastq files are uploaded.

  Dataset EGAD00001009744

• CITEseq data

  Single-cell whole transcriptome and antibody expression for bone marrow samples from Cohorts A and B. CITEseq protocol was followed. 37 and 77 surface markers were measured in each cohort, respectively (see Supplementary Table 1). For details on cell sorting prior scRNAseq see the methods section of the manuscript.

  Dataset EGAD00001010187

• The Epigenomic Atlas of Early Human Craniofacial Development

  Parallel profiling of six distinct histone modifications via ChIP-Seq in craniofacial tissue samples from individual human embryos was performed. Epigenomic marks imputed with ChromImpute and a 25-state chromatin state model of uniformly processed epigenomic data was produced through ChromHMM. Samples were obtained from the MRC-Wellcome Trust Human Developmental Biology Resource (HDBR) tissue bank. HDBR provided karyotypically and developmentally normal pharyngeal arch or craniofacial tissue from embryos between 4.5 and 10 post-conception weeks. This repository contains raw data (fastq) files from ChIP-seq and RNA-seq experiments associated with this project. Processed ChIP-seq data and imputed data for additional histone marks are available at GEO (Series GSE97752).

  Study phs002008

• Integrative genomic profiling of large-cell neuroendocrine carcinomas reveals distinct subtypes of high-grade neuroendocrine lung tumors

  Large-cell neuroendocrine lung carcinomas (LCNEC) have similarities with other lung cancers, but their precise relationship has remained unclear. We conducted comprehensive genomic (n=60) and transcriptomic (n=69) analyses of 75 LCNECs and identified two molecular subgroups: “type I LCNECs” with bi-allelic TP53 and STK11/KEAP1 alterations (37%), and “type II LCNECs” enriched for bi-allelic inactivation of TP53 and RB1 (42%). Despite sharing genomic alterations with adenocarcinomas and squamous cell carcinomas, no transcriptional relationship was found; instead LCNECs form distinct transcriptional subgroups with closest similarity to SCLC. While type I LCNECs and SCLCs exhibit a neuroendocrine profile with ASCL1high/DLL3high/NOTCHlow, type II LCNECs bear TP53 and RB1 alterations and differ from most SCLC tumors with reduced neuroendocrine markers, a pattern of ASCL1low/DLL3low/NOTCHhigh and upregulation of immune-related pathways. In conclusion, LCNECs are comprised of two molecularly defined subgroups, and distinguishing them from SCLC may allow for stratified targeted treatments for high-grade neuroendocrine lung tumors.

  Study EGAS00001000708

• scRNA-seq of patient-derived PDAC organoids

  We derived PDAC organoids from primary tumors of 18 patients, together with two matched samples from liver metastases. By single-cell RNA sequencing, we show that PDAC organoids consist of ductal cells with patient-specific expression of several gene groups, including genes which encode cell surface proteins. We report ‘classical’ and ‘basal-like’ cells coexisting within single primary tumors or metastases, with greater intratumor subtype heterogeneity linked to higher tumor grade. Single-cell transcriptome analysis of PDAC organoids and primary PDAC identified distinct tumor cell states shared across patients, including a cycling progenitor cell state and a differentiated secretory state. We show that these cell states are connected by a differentiation hierarchy, with ‘classical’ subtype cells concentrated at the endpoint of this hierarchy.

  Study EGAS00001004661

• EBV-AID project

  Whole genome sequencing of EBV-transformed B cells in order to determine whether EBV induction of activation-induced cytidine deaminase (AID) produces genome-wide mutations and/or chromosomal rearrangements.

  Dataset EGAD00001001458

• WGS short read and 10X linked read sequencing of HR Deficient breast cancers

  A set of tumor/normal paired sequencing experiments, performed in short read WGS and 10X linked read whole genomes. BAM files aligned to hg19 are provided. Sample Alias number and Subject ID reflects patient of origin. T/N distinction discriminates between tumor and normal (peripheral blood) tissue.

  Dataset EGAD00001010326

• Arcagen – thoracic malignancies

  Arcagen is an EORTC/SPECTA pan-European project that aims to recruit 1000 rare cancer patients from different tumour domains of EURACAN. This study collected samples from advanced or metastatic rare cancer from patients older than 12, and analysed them using Foundation Medicine next-generation sequencing (NGS) panels (FoundationOne CDx for FFPE samples or FoundationOne Liquid CDx for blood samples). Here we are submitting the dataset that contain NGS files from rare thoracic malignancies (n=102)

  Dataset EGAD50000000168

• Single cell RNA sequencing of colorectal cancer with diverse tissue dissociation protocols or fresh vs. frozen cell preparations.

  To evaluate 3 different tissue dissociation protocols or fresh vs. frozen cell preparations, we performed single-cell RNA sequencing on cancer or distant normal tissue dissociates from 2 colorectal cancer patients. Total 18,409 cells from 10 sample preparations were analyzed (5 primary colorectal cancer and 5 matched normal mucosa). The results suggest highly consistent cellular proportions were recovered with different sample preparation methods.

  Dataset EGAD00001005191

• Comprehensive single-cell genome analysis at nucleotide resolution using the PTA Analysis Toolbox

  Whole genome sequencing data of 57 single (PTA), clonally expanded and bulk human cells. Cells were obtained from bone marrow samples of patients with Fanconi Anemia (PMCFANCNN) or pediatric AML (PBNNNNN), from a clonal intestinal organoid line (STE0072/D-ORGWTNISL), from human cord blood (PMCCB15) and from a human lymphoblastoid cell line (PMCAHH1). WGS libraries were sequenced to ~15-30x genomic coverage (paired-end) on an Illumina Novaseq.

  Dataset EGAD00001011126

• Single cell sequencing on whole bone marrow of NBM and AML

  To generate a cellular taxonomy of the human NBM and AML, representing both rare hematopoietic stem/progenitor cells (HSPCs) and stromal niche populations, allowing assessment of their cellular diversity and predicted intercellular signaling, we performed single cell RNA sequencing (scRNAseq) on viably frozen bone marrow (BM) aspirates from four healthy donors and 6 NPM1+ AML patients at diagnosis

  Dataset EGAD00001011057

• COVID-19 Challenge Project Single Cell Profiling

  Single-cell profiling of sero-negative and sero-positive humans that were inoculated with SARS-CoV-2. The cellular response during SARS-CoV-2 is profiled using single-cell transcriptomics, CITE-seq and single cell immune profiling, by sampling PBMCs and nasal swabs before and at multiple time points during SARS-CoV-2 infection. This one-of-a-kind cellular map will give unique temporal resolution of how nasal and immune cells respond to SARS-CoV-2 exposure and infection.

  Dataset EGAD00001012227