19072 results for "Buy fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are the best FC seller..nEoY"

in 35.20 milliseconds.

• Germline WES data of parents whose children have germline CHEK2 mutations

  This data set includes bam files (aligned to hg38) from the germline of parents whose children have CHEK2 germline mutations.

  Dataset EGAD00001009516

• Gain of Function Mutations in RPA1

  Exome sequencing and amplicon-based single-cell sequencing dataset on the patients and family members that were analyzed in this study.

  Dataset EGAD00001008329

• postcovid19

  contain the raw data from scRNA, scATAC, genotyping.

  Dataset EGAD00001008122

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• WES data from optic atrophy study

  The dataset includes Fastq files from WES experiments performed on a proband presenting with syndromic optic atrophy and his healthy parents. Exons were captured by hybridization and sequenced on an Illumina platform

  Dataset EGAD00001005321

• cHCC-ICC WES

  The whole exome sequencing data of 291 tumor/normal samples from 121 cHCC-ICC cases.

  Dataset EGAD00001005183

• Whole exome sequencing of Finnish hereditary breast cancer families

  Dataset contains Whole Exome Sequencing(WES) data from 37 individuals as aligned bam-files. The reads have been aligned using bowtie2 to human genome hg19 build.

  Dataset EGAD00001002133

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• HIPO blastemal Wilms (nephroblastoma) CHIP sequencing samples

  HIPO blastemal Wilms (nephroblastoma) characterisation of tumor driving events caused by differential SIX1 binding of the SIX1 Q177R mutatns

  Dataset EGAD00001000992

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• EGAD00000000057

  WTCCC project samples from the Parkinson's disase cohort

  Dataset EGAD00000000057

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• The temporal mutational and immune tumour microenvironment remodelling of HER2-negative primary breast cancers

  WES and clonality characterization of different timepoints in HER2-negative primary breast cancers receiving neoadjuvant eribulin therapy.

  Study EGAS00001004953

• PacBio HiFi whole-genome sequencing of two microsatellite instability (MSI) gastric cancer

  We generated long-read whole-genome sequencing (WGS) data using PacBio HiFi from two human gastric cancer cell lines exhibiting microsatellite instability (MSI). The dataset contains aligned bam (hg38) files.

  Dataset EGAD50000002300

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• single cell transcriptomics fastq files from PBMC of long COVID patients

  This dataset consists of 8 patients' data fastq files. 4 in each LR1 and 4 in LR2. the dataset was generated using 10X genomics and novaseqX.

  Dataset EGAD50000001730

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Long-read RNA-seq from 5 patients with stereotyped subset CLL

  Oxford Nanopore Technologies based long-read RNA sequencing data from 5 patients with stereotyped subset CLL. The BAM files were aligned against hg19 reference genome.

  Dataset EGAD50000000755

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Methylation profiling of sarcoma and TFCP2-rearranged rhadomyosarcoma samples

  Methylation profiling of 345 sarcoma and TFCP2-rearranged rhadomyosarcoma samples, using the approach described "Genomic, transcriptomic, functional, and mechanistic characterization of rhabdomyosarcoma with FUS-TFCP2 or EWSR1-TFCP2 fusions"

  Dataset EGAD00010002451

• The University of Hong Kong Gastric Cancer XClone Study Single Cell CNV Data

  Single cell encapsulation and DNA libraries were prepared by Chromium™ Single Cell DNA Reagent Kits and Chromium™ Single Cell C and D Chip Kits.

  Dataset EGAD00001015383

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Clinical phenotype data

  Clinical data corresponding to the patients with ovarian cancer studied using scRNA-seq and bulk RNA-seq. Variables include molecular subtype, predicted immune phenotype, reviewing pathologist comment, final immune phenotype, histology characterization, and tumor stage.

  Dataset EGAD00001006973

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Deep Sequencing of somatic cancer mutations

  We enriched a panel of cancer associated genes using the Custom Sure Select Target Enrichment Kit. Identified mutations were validated with deep sequencing in order to assess mutated allele frequencies more accurately.

  Dataset EGAD00001001313

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the cheek patient

  Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the cheek patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004603

• Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the cervix patient

  Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the cervix patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004616

• Genome and transcriptome sequence data from a clear cell carcinoma of the left ovary patient

  Genome and transcriptome sequence data from a clear cell carcinoma of the left ovary patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004608

• Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient

  Genome and transcriptome sequence data from a melanoma of the right buccal mucosa patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003716

• Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient

  Genome and transcriptome sequence data from a squamous cell carcinoma of the anus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003723

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the rectosigmoid patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003725

• Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient

  Genome and transcriptome sequence data from a high grade serous carcinoma of the fallopian tube/ovary/peritoneum patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003702

• Genome sequence data from a metastatic squamous cell carcinoma of the oropharynx patient

  Genome sequence data from a metastatic squamous cell carcinoma of the oropharynx patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003691

• Genome and transcriptome sequence data from an adenocarcinoma of the distal esophagus patient

  Genome and transcriptome sequence data from an adenocarcinoma of the distal esophagus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003061

• Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the palate patient

  Genome and transcriptome sequence data from a metastatic adenoid cystic carcinoma of the palate patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003065

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the pancreas patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001003073