20305 results for "Fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are efficient and quick always..Z2Xg"

in 86.93 milliseconds.

• Mosaic Colorectal Metastasis

  A comparison of the somatic variation present in a primary colorectal tumour and three different liver metastases from the same patient.

  Dataset EGAD00001000948

• Recurrent somatic JAK-STAT mutations within a RUNX1-mutated pedigree

  Whole-exome sequencing of a RUNX1-mutated pedigree, including samples from mother, father and four offsprings. Recurrent somatic JAK-STAT mutations were found among the diseased individuals.

  Dataset EGAD00001002240

• DIME

  Shotgun sequencing data from subject as baseline and after 4 weeks of daily doses of low, medium or high CFU Eubacterium hallii L2-7. The strain contained in the drink "Ela" was also sequenced.

  Dataset EGAD00001004849

• Amplicon sequencing of adenoma to carcinoma paired samples from colon

  Colorectal cancer panel sequencing of 100 adenoma and carcinoma samples . Cancer Hot Spot panel sequencing of 7 samples from one poly.

  Dataset EGAD00001004848

• Somatic genetic basis of Wilms' tumour

  We investigated the somatic genetic basis of Wilms' tumour and found complex phylogenetic relations between tumours

  Dataset EGAD00001005135

• Targeted sequencing of patients with neurodegenerative diseases

  A targeted gene panel that covers coding, noncoding, and short tandem repeat regions improves the diagnosis of patients with neurodegenerative diseases

  Dataset EGAD00001005114

• Exome sequencing of 22 Pheochomocytoma/Paraganglioma (PPGL) tumors

  Exome sequencing of 22 Pheochomocytoma/Paraganglioma (PPGL) primary tumors, both malignant and non-malignant. Tumor material was from snap-frozen (SF) or formalin-fixed-paraffin-embedded (FFPE) .

  Dataset EGAD00001006129

• multi regional whole exome sequencing of gastric adenocarcinoma

  Multiregional whole-exome sequencing was done using 48 tumor samples (range: 4-10 tumor samples/patient) from 9 patients with adenocarcinomas of the stomach and gastroesophageal junction (GC)

  Dataset EGAD00001006251

• Somatic mutations called from whole-exome sequencing of PSCCE

  We performed whole-exome sequencing on 46 pairs of PSCCE and matched normal sample. Somatic mutations were called using MuTect2.

  Dataset EGAD00001006743

• Bulk tumor RNAseq of bladder cancer patients

  RNAseq fastq files from 611 bulk pre-treatment tumors from two indications: metastatic urothelial bladder cancer patients (IMvigor210) and metastatic renal cell carcinoma (IMmotion150)

  Dataset EGAD00001006960

• CBB post-mortem hippocampal short-RNA-seq

  Short RNA sequencing of post-mortem human hippocampi from the Calgary Brain Bank. The dataset includes patients with Alzheimer's disease (AD) and healthy control individuals (Ctrl).

  Dataset EGAD00001006886

• The Extracellular RNA Quality Control (exRNAQC) study (phase 1)

  mRNA capture sequencing and small RNA sequencing data (FASTQ files) of the exRNAQC study phase 1.

  Dataset EGAD00001007697

• Acquired RAD51C promoter methylation loss causes PARP inhibitor resistance in high grade serous ovarian carcinoma

  Analysis of RAD51C promoter methylation using targeted bisulfite sequencing (amplicon sequencing) in ovarian cancer pre-clinical models and patient samples.

  Dataset EGAD00001007799

• WES data from 5 DGCR8 schwannomas

  This dataset contains the exome sequencing data (BAMs, VCFs and CNVs) from 5 schwannoma tumors from the same patient.

  Dataset EGAD00001008200

• GCAT| WGS VCF Raw Genotypes V1

  This dataset contains raw genotypes ( SNVs, Indels and SVs), from 785 samples,without applying any filter, from the 808 WGS GCAT cohort.

  Dataset EGAD00001008210

• CBD-KEY-SUMMARIES: Other data

  Other raw and processed phenotype data generated by the COMBAT consortium.

  Dataset EGAD00001008009

• Long cell-free DNA molecules in maternal plasma (dataset1)

  Bam files consists PET cases and healthy cases

  Dataset EGAD00001008721

• Single-cell RNA sequencing

  Single-cell RNA sequencing on 10 antrum and 4 body gastric biopsies

  Dataset EGAD00001010166

• Gene expression associated with Klinefelter syndrome

  RNA-sequencing profiling of leucocytes from peripheral blood samples from 9 KS patients, 9 control males and 13 female controls

  Dataset EGAD00001010078

• Smart-seq2 single-cell RNA-seq of human liver non-parenchymal cells

  Smart-seq2 single-cell RNA-seq of human liver non-parenchymal cells from lean and obese individuals

  Dataset EGAD00001010301

• PrevANZ RNAseq dataset

  Whole blood samples collected at baseline and week 12 in PAXgene Blood RNA tubes. RNA sequencing on the Illumina NovaSeq 6000 System generated 150 base pair length paired end reads.

  Dataset EGAD00001011069

• The University of Hong Kong Intestinal Metaplasia Organoids Study WES Data

  Whole exome sequencing data generated from organoid cultures established from normal gastrointestinal organoids, long-term, spheroid and blood leukocyte DNA.

  Dataset EGAD00001015420

• SLAMF7 Regulates Synovial Macrophages in Rheumatoid Arthritis

  The purpose of this study was to characterize the role of SLAMF7 on human macrophages. RNA-sequencing was performed on myeloid populations from blood of healthy controls or rheumatoid arthritis patients, or synovial fluid of rheumatoid arthritis patients, based on high or low expression of SLAMF7. Then, monocyte-derived macrophages from healthy controls were left untreated, or stimulated with anti-SLAMF7 or recombinant SLAMF7 protein, and transcriptional profile was defined after SLAMF7 engagement.

  Study phs002771

• Identification of Structural Variants Relevant to Autism by Pacific Biosciences HiFi Whole-Genome Sequencing

  The purpose of this research study was to perform long-read whole-genome sequencing on a family with autism. This family had no known genetic cause based on clinical array and whole-exome sequencing analysis. Utilizing PacBio HiFi long-read whole-genome sequencing, we identified a relevant missense variant in the KCNC2 gene. This variant was likely to be a germline mosaic in the paternal germline.

  Study phs002698

• Gene Fusion Discovery through RNA Sequencing of Human Glioblastoma Stem Cell Lines

  We used massively parallel, paired-end sequencing of expressed transcripts (RNA-seq) to detect novel gene fusions in short-term cultures of glioma stem-like cells freshly isolated from nine patients carrying primary glioblastoma multiforme (GBM). The culture of primary GBM tumors under serum-free conditions selects cells that retain phenotypes and genotypes closely mirroring primary tumor profiles as compared to serum-cultured glioma cell lines that have largely lost their developmental identities.

  Study phs000505

• Breast Cancer Family Registry Early-onset Breast Cancer GWAS

  In order to enhance our understanding of the genetic etiology of breast cancer, this study analyzed 1,265,548 Hapmap3 single-nucleotide polymorphisms (SNP) among a discovery set of 3,523 EOBC incident cases and 2,702 age-matched population control women, all of whom were age 50 or younger at enrollment. Subjects were recruited from the eight sites, some of which oversampled cases with a personal or family history of breast cancer.

  Study phs001589

• Effect of inflammation on human hematopoietic stem cells in a xenograft model

  Transcriptional heterogeneity in cord blood HSCs was investigated by 10X single-cell Multiome (RNA+ATAC). To investigate the effect of inflammatory stress on human HSC, 10X single-cell Multiome profiling of cells from xenografted mice recovered from repeated inflammatory challenge was performed. To investigate transmission of inflammatory stress-related molecular programs from HSC to their progeny, 10X single-cell RNA sequencing was performed on committed progenitor and myeloid cells from the same mice.

  Study EGAS50000001624

• Single cell long read whole genome sequencing reveals somatic transposon activity in human brain

  The advent of single cell DNA sequencing revealed astonishing dynamics of genomic variability, but failed at characterizing smaller to mid size variants that on the germline level have a profound impact. In this work we discover novel dynamics in three brains utilizing single cell long-read sequencing. This provides key insights into the dynamic of the genomes of individual cells and further highlights brain specific activity of transposable elements.

  Study EGAS50000001156

• DO NOT USE - Whole genome sequencing of SI-NETs from five patients

  Small intestine neuroendocrine tumor (SI-NET), the most common cancer of the small bowel, often displays a curious multifocal phenotype with several intestinal tumors centered around a regional lymph node metastasis, yet the typical path of evolution of these lesions remains unclear. Here, we determined the complete genome sequences of 37 tumors from 5 patients with multifocal SI-NET, allowing elucidation of phylogenetic relationships between multiple intestinal tumors and metastases in individual patients.

  Study EGAS00001004435

• Broad utility of ultrasensitive analysis of ctDNA dynamics across solid tumors treated with immunotherapy

  Plasma ctDNA sequencing data from samples collected from a pan-cancer cohort of patients with advanced-stage disease treated with IO therapies. This study highlights the broader applicability of ultrasensitive ctDNA as a biomarker across cancer types and immunotherapy modalities. Here, we applied a whole-genome, tumor-informed approach to study ctDNA in 202 advanced-stage cancer patients treated at VHIO. This study captures the plasma sequencing data from the project.

  Study EGAS50000001271

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• Data distribution Statistics

  EGA Statistics Bibliography Growth Community Archive Distribution Catalogue Here, we show the amount of data distributed by the EGA. Data Distributed / Live EGA Data Distribution / Live SFTP Aspera HTSGET lineChartLive("svg#ega-dist-live", document.querySelector("#ega-figure-dist-live figcaption")); Data Distributed The below figure represents the cumulative EGA data distribution via the download clients(v2 and v3.x api versions) using HTTPS, FTP, and download boxes using ASPERA. You can see cumulative values by clicking "Cumulative". EGA Data Distribution //lineChart('#ega-data-distribution svg.stats', 'https://stats.ega-archive.org/distribution', // ['Amount of Distributed Data', ['Aspera', 'Download Clients', 'Total']]) curveChart('#ega-data-distribution', [ { domId: 'stats-aspera', label: 'Aspera', url: 'https://stats.ega-archive.org/distribution/aspera' }, { domId: 'stats-sftp' , label: 'SFTP', url: 'https://stats.ega-archive.org/distribution/sftp' }, //{ domId: 'stats-htsget', label: 'HTSGET', url: 'https://stats.ega-archive.org/distribution/htsget' }, { domId: 'stats-streamer' , label: 'Download Client', url: 'https://stats.ega-archive.org/distribution/streamer' }, { domId: 'stats-total' , label: 'Total', url: 'https://stats.ega-archive.org/distribution/total' } ] );

  Documentation about/statistics/distribution

• Leiden_melanomafamilies

  Around 10% of patients who present in melanoma clinics have a first degree relative with a previous diagnosis of melanoma. While around 3% have three or more relatives who have been diagnosed with the disease. In this project we will whole genome sequence patients from large Dutch familial melanoma pedigrees to identify mutations in genes that drive melanomagenesis. The identification of these genes will facilitate the management of familial melanoma patients and their families.

  Study EGAS00001000627

• The_genomic_architecture_of_mesothelioma_

  The genome-wide landscape of somatically acquired mutations in mesothelioma has not been deeply characterised to date, but advances in DNA sequencing technology now allow this to be addressed comprehensively. Harnessing massively parallel DNA sequencing platforms, we will identify somatically acquired point mutations in all coding regions of the genome from patients with mesothelioma. In addition, using paired-end sequencing, we will map copy number changes and genomic rearrangements from the same patients.

  Study EGAS00001000353

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Follicular lymphoma at diagnosis, treated in first line with immunochemotherapy

  We performed targeted NGS in Follicular lymphoma samples at diagnosis. Explored clinico-genetic correlations and assessed four clinical or clinicogenetic risk models (FLIPI, FLIPI-2, PRIMA-IP or m7-FLIPI-molecular score) in patients with symptomatic FL who received frontline immunochemotherapy. Out of 191 patients with FL grade 1-3a, 109 were successfully genotyped. Treatment consisted on rituximab (R) plus CVP/CHOP (72.5%) or R-bendamustine (R-B) (27.5%).

  Study EGAS00001006674

• WGS and RNA-Seq data from a GBM patient PT-AB0029

  WGS and RNA-Seq data from a GBM patient PT-AB0029

  Dataset EGAD00001004221

• WGS and RNA-Seq data from a GBM patient PT-AH1410

  WGS and RNA-Seq data from a GBM patient PT-AH1410

  Dataset EGAD00001004223

• WGS and RNA-Seq data from a GBM patient PT-AK7565

  WGS and RNA-Seq data from a GBM patient PT-AK7565

  Dataset EGAD00001004224

• WGS and RNA-Seq data from a GBM patient PT-BK0248

  WGS and RNA-Seq data from a GBM patient PT-BK0248

  Dataset EGAD00001004228

• WGS and RNA-Seq data from a GBM patient PT-BM772

  WGS and RNA-Seq data from a GBM patient PT-BM772

  Dataset EGAD00001004229

• WGS and RNA-Seq data from a GBM patient PT-FB6711

  WGS and RNA-Seq data from a GBM patient PT-FB6711

  Dataset EGAD00001004235

• Matched Pair Cell Line Tumour RNAseq

  In this study we will sequence the transcriptome of Verified Matched Pair Cancer Cell line tumour samples. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000630

• Myeloproliferative Neoplasms (MPN) Targeted Gene Screen

  Pulldown experiments will be performed on a number of patients with Myeloproliferative Neoplasms (MPN). The pulldown will be a bespoke design targeting known mutations, this pulldown will be sequenced and analysed to inform prevalence of mutations and to inform to the possibility of use as a diagnostic tool.

  Dataset EGAD00001000652

• Maastricht IBS 16S data

  Maastricht IBS cohort with biobank aims to identify subgroups of IBS according to phenotypical and genotypical characterization. This dataset represents 16S amlicon sequencing of the gut microbiome of case samples and matched controls. Fecal DNA was extracted using the Qiagen AllPrep kit with bead-beating step. Sequencing of bacterial 16S gene, domain V4, was performed using the Illumina MiSeq platform.

  Dataset EGAD00001007074

• Bone marrow microenvironment of 6 newly diagnosed myeloma patients using 10X Genomics scRNA- and TCR-sequencing

  10X Genomics scRNA- and TCR-sequencing (Chromium Next GEM Single Cell 5’ Reagent Kit v1.1) was performed on the plasma cell depleted mononuclear fraction of bone marrow aspirates from 6 patients with newly diagnosed multiple myeloma. Generated gene expression libraries were paired-end sequenced on the NovaSeq 6000 S2. Generated V(D)J libraries were paired-end sequenced on the NextSeq 550.

  Dataset EGAD00001009270

• Whole genome, exome and RNA sequencing of TFCP2-rearranged rhabdomyosarcoma

  Whole genome, exome and RNA sequencing of TFCP2-rearranged rhabdomyosarcoma, 86 samples of paired fastq files, sequenced on: Illumina HiSeq 2500 using Agilent SureSelect WGS, Illumina HiSeq 2500 using Illumina TruSeq RNA, Illumina HiSeq 2500 using Agilent SureSelect v5 WES (+UTRs), Illumina HiSeq 4000 using Agilent SureSelect WGS, Illumina HiSeq 4000 using Illumina TruSeq stranded mRNA Kit, Illumina HiSeq 4000 using Agilent SureSelect v5 WES stranded mRNA Kit, Illumina NovaSeq 6000 using Illumina TruSeq Stranded mRNA, Illumina NovaSeq 6000 using Illumina TruSeq Nano DNA, Illumina HiSeq X Ten using TruSeq Nano DNA.

  Dataset EGAD00001010108

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• Follow_up_for_second_tier_signals_from_the_arcOGEN_GWAS

  The arcOGEN UK nationwide consortium has been funded by the arc to undertake a genome-wide association scan in osteoarthritis. GWA genotyping has been carried out at the Sanger on the illumina 610k array. This replication study was desinged to follow-up second-tier signals from the arcOGEN GWS in 25 SNPs (1Sequenom iPLEX) with p<5x10^-6 on 6000 additional UK OA and control samples.

  Study EGAS00001001017

• The BC Cancer Agency's Personalized Onco-Genomics Project

  The BC Cancer Agency's Personalized Onco-Genomics (POG) Project involves molecular and clinical characterization of individual cancer patients to guide their treatment. The project aims to use whole genome and transcriptome data together with patient information to match treatments to cancer driver alterations and support clinical decision-making. Incorporating genomic data into decision-making should enable more rational development of treatment plans, facilitate enrollment into appropriate clinical trials and potentially identify less toxic and more effective therapeutic options.

  Study EGAS00001001159

• De novo metastatic prostate cancer cohort

  Fastq files from RNA sequencing of normal and tumor samples from 16 patients from the de novo metastatic prostate cancer cohort.

  Dataset EGAD50000002381

• Repertoire sequencies from three different protocols

  This dataset contains sequencing data from Bulk RNAseq, PCR-based RepSeq and SMRT sequencing to compare immunoglobulin repertoire profiling strategies using matched human B-cell samples

  Dataset EGAD50000002217

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Enzymatic methylation sequencing of intestinal metaplasia

  We perform genome-wide EM-seq of 14 patients with concurrent matched normal, dysplasia and early gastric samples from South Korea. The dataset contains cram files from 38 samples.

  Dataset EGAD50000001538

• Holistic ends analysis

  This dataset comprises fastq or bam files derived from sequencing data of dsDNA and ssDNA libraries from 138 plasma cfDNA samples.

  Dataset EGAD50000001737

• Single cell transcriptomes from vascularized human retinal organoids

  Both control and vascularized organoids were processed using the 10x Chromium 3' RNA method. Sequencing reads were aligned with STARsolo.

  Dataset EGAD50000001216

• Dataset of Clonal Evolution of PPM1D Mutations in the Spectrum of Myeloid Disorders

  This dataset contains genomic profiles of 7 PPM1D-mutated patients across the spectrum of myeloid disorders using single-cell analyses (Tapestri technology) on diagnostic and longitudinal samples.

  Dataset EGAD50000001229

• Short-read transcriptomic data

  Short-read transcriptomic data of unaffected control, expansion negative, and expansion positive FECD CECs

  Dataset EGAD50000000436

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• H3K27me3 Cut&Tag on beta cells

  H3K27me3 Cut&Tag datasets in human pancreatic islets and the EndoC-bH1 cell line

  Dataset EGAD50000000463

• H3Africa EPIGEN EWAS

  Data from 59 whole blood samples from pregnant mothers, unexposed and exposed to the Rwandan genocide, was generated using Infinium MethylationEPIC BeadChip Kit.

  Dataset EGAD00010002383

• H3Africa SIREN GWAS Stroke

  3421 Samples from Nigeria and Ghana, genotyped with the Illumina NestSeq 500

  Dataset EGAD00010002551

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• Long-read sequence data from two carriers of a predisposing structural variant

  This dataset contains PacBio long-read sequence data from two individuals with a chr9p.21 structural variant and two controls. Sequences were aligned againt the human reference genome HG38.

  Dataset EGAD50000002155

• Locally advanced rectal cancer samples

  Fastq files from exome sequencing of paired normal/tumor (pre and post-nCRT) samples from 7 patients with rectal tumors. All samples were sequenced on a 5500xl SOLiD sequencing platform (Thermo Fisher Scientific).

  Dataset EGAD00001004378

• Tumor-associated preferred end coordinates and somatic variants as signatures of circulating tumor DNA

  Plasma DNA libraries were constructed from 4 mL of plasma without library enrichment, namely without PCR amplification. Paired-end massively parallel sequencing was performed

  Dataset EGAD00001004561

• Cell lines with telomere fusion-induced rearrangements

  Whole-genome somatic rearrangement and point mutation analysis in cell lines with induced telomere fusions.

  Dataset EGAD00001001629

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• whole genome sequencing

  Whole-genome sequencing was performed by Illumina Inc (San Diego, CA). Libraries were constructed with ~300bp insert length and paired-end 100bp reads were sequenced on Illumina HiSeq2000.

  Dataset EGAD00001000782

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• BAM files of evolution T-ALL adults project

  WGS BAMs of 19 adult patients with T-acute lymphoblastic leukemia with primary, remission and relapse sample per patient. Total = 58 samples sequenced with HiSeq 4000 or NovaSeq 6000 (Illumina).

  Dataset EGAD00001006543

• WGS-TOF study

  Whole genome sequencing data (bam) of tetralogy of Fallot study, including data derived from iPSCs of two control and four patients with tetralogy of Fallot (two with DiGeorge syndrome (DG), two without DiGeorge syndrome (ND).

  Dataset EGAD00001008569

• Paired-end Whole Exome-seq analysis of TERT promoter duplication in GBM

  Dataset contains paired-end Whole Exome sequencing data from 5 tumor samples and 1 single normal blood sample from a single primary GBM patient.

  Dataset EGAD00001008768

• RNA sequencing of human lung fibroblasts

  Bulk RNA seq data from human lung fibroblasts isolated from fresh and cryopreserved lung tissue (18 samples, 3 donors)

  Dataset EGAD00001010252

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• Single-cell CITE-seq from MDS patients with SF3B1 mutations

  Single-cell CITE(cellular indexing of transcriptomes and epitopes)-seq from MDS (n = 2, MDS02 in 2 replicates). cDNA from 10x Genomics 3' V3.

  Dataset EGAD00001011281

• WGS of HSPC clones of healthy individual sequenced with Illumina NovaSeq 6000

  Dataset contains WGS sequecing data from clonally expanded hematopoietic stem cells from 7 individual pediatric cancer patients. Samples were taken before (DX - diagnosis) or Follow-up (DX2/REM/FU - Diagnosis 2, remission or follow-up, respectively). In addtion, cord blood clones (Designated CB) treated with X-ray radiation, Cisplatin, Maphosphamide, Vincristine and Doxorubicin and untreated cord blood hematopoietic stem/progenitor cells were have been whole-genome sequenced. (Abbreviations RAD, CISPL, MAPH, VINC, DOX and CTRL, respectively)

  Dataset EGAD00001007078

• RNA-seq data

  RNAseq FASTq files of 181 bulk pre-treatment and 14 post-treatment tumors from GO30140 Ph1b group A and F and 177 bulk pre-treatment tumors of IMbrave150 PhIII

  Dataset EGAD00001008128

• Adult B-precursor acute lymphoblastic leukemia transcriptomes

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of B-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Dataset EGAD00001008633

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Single-cell RNAseq data from 6 Invasive Lobular Carcinoma (ILC)

  Fastq files of single-cell RNAseq data from from Cancer Associated Fibroblasts (CAFs), cancer cells and immune cells isolated from 6 primary Invasive Lobular Carcinomas (ILCs)

  Dataset EGAD50000001121

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Multi-omics Profiling of Asian Breast Cancers

  186 tumor/normal matched samples from whole exome sequecing and 178 samples (168 tumors, 10 normals) from whole transcriptome sequencing

  Dataset EGAD00001003776

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• Targeted Sequencing of Tumor-Normal pairs from advanced Melanoma

  Aligned BAM files from NextSeq500 tageted panel sequencing of 84 samples from matched tumour-normal pairs of 42 melanoma patients. The dataset consists of 30 non-responders and 12 responders to ICB.

  Dataset EGAD00001005778

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• mtDNA in Huntington’s disease samples

  This dataset contains sequencing data from a large-scale study of mtDNA variations measured, using a sensitive mtDNA-targeted sequencing method called STAMP, in lymphoblast and blood samples of Huntington’s Disease patients.

  Dataset EGAD00001005723

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• ADAPTeR Study: scRNA/TCRseq data from ccRCC patients

  ADAPTeR study scRNA and scTCR data from TILs from two ccRCC patients treated with nivolumab

  Dataset EGAD00001008166