20305 results for "Fc coins Buyfc26coins.com is EA Sports official for FC 26 coins They are efficient and quick always..Z2Xg"

in 185.37 milliseconds.

• Genetic landscape of Extranodal NK/T-cell lymphoma

  Whole-exome sequence (WES) data of tumor-normal pairs from 40 ENKTCL patients and RNA sequence (RNA-seq) data of tumors from 20 ENKTCL patients.

  Dataset EGAD00001009852

• Clear cell sarcoma dataset

  This deposit consists of DNA and RNA sequencing data from 67 CCS samples. 55 samples had tumor DNA sequencing data. 6 had matched normal sequencing data. 34 samples had tumor RNA sequencing data.

  Dataset EGAD00001008611

• ATAC-seq

  ATAC-seq data. Dataset includes FASTQ files, BAM files, and analysis files with the ATAC-seq peaks determined using MACS2.

  Dataset EGAD00001008962

• Patient-derived GBM cultures TMZ+BMP4 treated

  Batch RNA sequencing of passages 5-7 of three patient-derived monolayer glioblastoma cultures in which TMZ and BMP4 synergize. 3 biological replicates, either untreated, only temozolomide, only BMP4 or temozolomide + BMP4

  Dataset EGAD00001010163

• exercise cfChIP-seq

  cfChIP-seq using an H3K4me3-specific antibody of 9 plasma samples collected after marathon run. cfChIP-seq was performed as described in Sadeh et al. 2021. dataset contains paired-end fastq files and BAM files of raw sequencing data.

  Dataset EGAD00001010284

• MS Risk Gene RNAseq

  MS Risk Gene RNAseq datasets of immune cell subsets (CD4, CD8, B cell, monocyte) from healthy controls and untreated MS cases.

  Dataset EGAD00001010879

• Identification of Long Non-coding RNA Biomarker of Human Lupus Nephritis Disease Activity - Dataset

  Total RNA paired-end sequencing was performed on whole blood samples from 74 Lupus nephritis (LN) patients and 20 healthy controls using Illumina NovaSeq 6000.

  Dataset EGAD00001010932

• Targeted and shallow whole genome sequencing identifies therapeutic opportunities in p53abn endometrial cancers

  Shallow whole genome sequencing of 196 formalin-fixed paraffin-embedded p53abn endometrial cancers.

  Dataset EGAD00001015241

• RNA sequencing data from the lungNENomics project

  Raw RNA-seq data from the lungNENomics cohort, comprising 319 pairs of FASTQ files from 179 individuals. This dataset also includes a gene count matrix, gene TPM matrix and gene expression VST matrix from 244 samples.

  Dataset EGAD00001015524

• snRNAseq of a hepatoblastoma patient with atypical tetrasomy 18

  snRNAseq was performed on 2 samples from a hepatoblastoma patient with atypical tetrasomy 18. 1 hepatoblastoma sample (resected tumor) and 1 non-tumor liver sample were sequenced.

  Dataset EGAD00001015506

• Genome Instability in Mammary Cells of Pathogenic BRCA1/2 Mutation Carriers

  It remains unknown if inherited germline mutations in the BRCA1 or BRCA2 gene increase the risk of breast and ovarian cancer by elevating mutation rate in mammary cells. Here we show, using a single-cell whole genome sequencing approach, that mammary luminal epithelial cells isolated from tissues obtained from preventive mastectomy surgeries in women with a pathogenic BRCA1/2 germline mutation, exhibit a statistically significant, increased mutation frequency as compared to age-matched controls without genetic risk of breast cancer.

  Study phs002411

• The Genetics of Lung Cancer Susceptibility in Smokers

  Over 85% of all patients diagnosed with lung cancer report a history of tobacco use, though only 10% of tobacco smokers eventually develop lung cancer. Epidemiologic studies have shown that family members of patients with lung cancer have a higher risk of developing lung cancer than controls. In an effort to identify variants associated with tobacco induced lung cancer, we have sequenced germline DNA from affected and unaffected members of families with strong histories of tobacco related lung cancer.

  Study phs000728

• Targeted exome sequencing identify compound heterozygous TYK2 mutations in patients with primary immunodeficiency who developed EBV-associated lymphoma

  In this study, we evaluated 2 siblings with primary immunodeficiency who developed EBV-associated lymphoma. Immunophenotyping of PBMCs revealed that both patients had significant T cell lymphopenia characterized by low na?ve CD4+ T cell counts. To identify the causative genetic mutations in the patients, we performed targeted exome sequencing using the Illumina MiSeq on the patients and their parents. The results showed a novel compound heterozygous mutations in the gene encoding tyrosine kinase 2 (TYK2) in the patients.

  Study JGAS000098

• BE_screens_of_WRN_gene_in_MSI_models

  We will take advantage of a base-editing screening strategy to engineer mutations in the WRN gene by deep mutagenesis. Two MSI-H cell lines sensitive to WRNi will be genetically modified to express doxycycline-inducible ABE and CBE base editors through a knock-in strategy. Moreover, we will design a pooled library of ~4000 gRNAs targeting the WRN gene plus appropriate controls gRNAs. Library-transduced cells will be selected with WRNi to identify WRN mutations able to interfere with the activity of WRNi.

  Study EGAS00001006872

• A CCG expansion in ABCD3 causes oculopharyngodistal myopathy in individuals of European ancestry

  In this study we describe the identification of CCG expansions in ABCD3 in affected individuals across eight unrelated OPDM families of European ancestry. In two large Australian OPDM families, using a combination of linkage studies, short-read WGS and targeted ONT sequencing, we identified CCG expansions in the 5’UTR of ABCD3. Independently, the ABCD3 CCG expansion was identified through the 100,000 Genomics England Genome Project in three individuals from two unrelated UK families diagnosed with OPDM.

  Study EGAS50000000298

• Transcriptome analysis of human iPSC-derived microglia in a novel human 3D cortical tissue model

  scRNA-seq analysis of human iPSC-derived microglia in a novel, human in vitro 3D cortical tissue model. Samples include three distinct conditions (each as biological duplicates): wild-type microglia extracted from cultures after 1 month (WT_1mo) and 3 months (WT_3mo) of culturing, as well as knock-in microglia extracted from cultures carrying three familial AD mutations in the APP gene (Swedish, Iberian, Arctic; introduced by CRISPR/Cas9-mediated knock-in) after 3 months of culturing (KI_3mo).

  Study EGAS50000000469

• Whole Exome Sequencing analysis of three tumor biopsies from a LUAD patient

  Whole Exome Sequencing (WES) analysis was performed on three distinct tumor biopsies collected at different time points, along with their matched germline non-tumor sample, from the same LUAD patient. DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MD) according to the manufacturer’s instructions and quantified using the Qubit Fluorometer assay (Life Technologies, Carlsbad, CA). To minimize FFPE-related sequencing artifacts (e.g., C:G > T:A transitions), the extracted DNA was treated with the DNA repair enzyme Uracil-DNA-Glycosylase (UDG) following the manufacturer’s protocol (New England Biolabs, Ipswich, MA). Whole-exome capture was performed with the Twist Human Core Exome + RefSeq + Mito-Panel kit (Twist Bioscience), in accordance with the manufacturer’s guidelines. Sequencing generated paired-end 100-bp reads on the Illumina NovaSeq 6000 platform. The resulting reads were aligned to the reference human genome (GRCh38) using the Burrows-Wheeler Aligner (BWA, v0.7.12).

  Dataset EGAD50000001198

• Poland Lesser Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 32 samples (14 female, 18 male of Lesser Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000166

• Poland Lodz Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 41 samples (20 female, 21 male of Lodz Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000165

• Poland Mazovia Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 43 samples (16 female, 27 male of Mazovia Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000164

• Poland Silesian Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 47 samples (23 female, 24 male of Silesian Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000163

• Poland Holy Cross Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 6 samples (6 female of Holy Cross Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000162

• Poland Greater Poland Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 37 samples (19 female, 18 male of Greater Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000161

• Poland Pomeranian Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 25 samples (14 female, 11 male of Pomeranian Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000160

• Poland Kuyavian-Pomeranian Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 22 samples (11 female, 11 male of Kuyavian-Pomeranian Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000158

• Poland Lublin Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 24 samples (14 female, 10 male of Lublin Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000155

• Poland Subcarpathian Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 22 samples (11 female, 11 male of Subcarpathian Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000157

• Poland Lower Silesian Voivodeship - WGS

  This project used NGS (next generation sequencing), using Illumina NOVASEQ 6000 and Illumina DRAGEN aligner. The dataset includes BAM and BAM.BAI files from Whole Genome Sequencing of 30 samples (15 female, 15 male of Lower Silesian Voivodeship, Poland from POPULOUS collection). Library Construction Protocol: Illumina DNA PCR-Free Prep, Tagmentation. Reference Genome: GRCh37.

  Dataset EGAD50000000156

• Investigating genetic susceptibility to rheumatic heart disease in Oceania

  This case-control study investigated susceptibility to rheumatic heart disease in over 3,000 individuals recruited across eight Oceanian countries. Cases were patients with rheumatic heart disease and controls were members of the general population. In addition to the Illumina HumanCore-24 BeadChip genotyping, a subset of 128 samples were analysed using the higher density Illumina HumanOmniExpressExome BeadChip of which 64 were also analysed using low coverage sequencing with the Illumina HiSeq 4000 platform.

  Study EGAS00001001881

• AML_targeted_resequencing_study

  Genomic libraries will be generated from whole genome amplified genomic DNA derived from 3,000 myeloid neoplasms. Targeted capture will be performed by multiplexing 16 barcoded samples in each library. Pools of 96 DNA samples will be subjected to 1-2 lanes of HiSeq 75bp sequencing. Reads will be mapped to the current build of the human reference genome to facilitate the generation of a comprehensive catalog of somatic mutations associated with 116 known myeloid and cancer driver genes.

  Study EGAS00001000275

• Mutations conferring differential treatment response in breast cancer

  Poor prognosis primary breast cancer patients usually receive cytotoxic chemotherapy as a component of treatment, but despite this aggressive therapy recurrences remain common. Improved understanding of chemoresistance pathways would allow better stratification of chemotherapy using predictive markers, and may allow therapeutic inhibition of resistance mechanisms in order to chemosensitise tumours. We aimed to identify molecular pathways that define chemoresponse using the novel approach of examining the selection exerted by neoadjuvant chemotherapy on sub-clonal somatic mutational profiles of cancer cells.

  Study EGAS00001003626

• Cold Ischemia Study

  This study aimed to evaluate the impact of cold ischemia time on the expression of cancer-related genes, particularly those involved in hypoxia, apoptosis, and epithelial-to-mesenchymal transition (EMT). We performed RNA sequencing on 54 normal colon mucosa samples from nine patients undergoing colorectal cancer surgeries, freezing samples at predefined intervals ranging from 0 to 60 minutes. A total of 44 differentially expressed genes (DEGs) (p < 0.05) were identified when comparing samples frozen immediately (T0) with those frozen after 60 minutes (T5).

  Study EGAS00001008233

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002972

• Genome and transcriptome sequence data from a rectal adenocarcinoma patient

  Genome and transcriptome sequence data from a rectal adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002973

• Genome and transcriptome sequence data from a metastatic cholangiocarcinoma patient

  Genome and transcriptome sequence data from a metastatic cholangiocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002976

• Genome and transcriptome sequence data from a cholangiocarcinoma patient

  Genome and transcriptome sequence data from a cholangiocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002991

• Genome and transcriptome sequence data from a leiomyosarcoma patient

  Genome and transcriptome sequence data from a leiomyosarcoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001002996

• WGS and RNA-Seq data from a GBM patient PT-AB6372

  WGS and RNA-Seq data from a GBM patient PT-AB6372

  Dataset EGAD00001004222

• WGS and RNA-Seq data from a GBM patient PT-AL4257

  WGS and RNA-Seq data from a GBM patient PT-AL4257

  Dataset EGAD00001004225

• WGS and RNA-Seq data from a GBM patient PT-AR5365

  WGS and RNA-Seq data from a GBM patient PT-AR5365

  Dataset EGAD00001004227

• WGS and RNA-Seq data from a GBM patient PT-CA2271

  WGS and RNA-Seq data from a GBM patient PT-CA2271

  Dataset EGAD00001004230

• WGS and RNA-Seq data from a GBM patient PT-CM1209

  WGS and RNA-Seq data from a GBM patient PT-CM1209

  Dataset EGAD00001004231

• WGS and RNA-Seq data from a GBM patient PT-DF5919

  WGS and RNA-Seq data from a GBM patient PT-DF5919

  Dataset EGAD00001004232

• WGS and RNA-Seq data from a GBM patient PT-DS9789

  WGS and RNA-Seq data from a GBM patient PT-DS9789

  Dataset EGAD00001004233

• WGS and RNA-Seq data from a GBM patient PT-EV3071

  WGS and RNA-Seq data from a GBM patient PT-EV3071

  Dataset EGAD00001004234

• Single-cell T-cell receptor sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell T-cell receptor sequencing (scTCR-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007014

• WGS and RNA-Seq data from a GBM patient PT-WR7927

  WGS and RNA-Seq data from a GBM patient PT-WR7927

  Dataset EGAD00001008531

• WGS and RNA-Seq data from a GBM patient PT-GI2070

  WGS and RNA-Seq data from a GBM patient PT-GI2070

  Dataset EGAD00001008520

• WGS and RNA-Seq data from a GBM patient PT-JR9883

  WGS and RNA-Seq data from a GBM patient PT-JR9883

  Dataset EGAD00001008521

• WGS and RNA-Seq data from a GBM patient PT-LC6372

  WGS and RNA-Seq data from a GBM patient PT-LC6372

  Dataset EGAD00001008522

• WGS and RNA-Seq data from a GBM patient PT-ML9537

  WGS and RNA-Seq data from a GBM patient PT-ML9537

  Dataset EGAD00001008523

• WGS and RNA-Seq data from a GBM patient PT-RV2286

  WGS and RNA-Seq data from a GBM patient PT-RV2286

  Dataset EGAD00001008527

• WGS and RNA-Seq data from a GBM patient PT-WT4796

  WGS and RNA-Seq data from a GBM patient PT-WT4796

  Dataset EGAD00001008532

• WGS and RNA-Seq data from a GBM patient PT-DM9089

  WGS and RNA-Seq data from a GBM patient PT-DM9089

  Dataset EGAD00001008518

• WGS and RNA-Seq data from a GBM patient PT-BM8772

  WGS and RNA-Seq data from a GBM patient PT-BM8772

  Dataset EGAD00001008516

• WGS and RNA-Seq data from a GBM patient PT-CM3220

  WGS and RNA-Seq data from a GBM patient PT-CM3220

  Dataset EGAD00001008517

• WGS and RNA-Seq data from a GBM patient PT-GE7528

  WGS and RNA-Seq data from a GBM patient PT-GE7528

  Dataset EGAD00001008519

• WGS and RNA-Seq data from a GBM patient PT-PR5617

  WGS and RNA-Seq data from a GBM patient PT-PR5617

  Dataset EGAD00001008525

• RNA-seq of high-grade serous ovarian cancer in long-term survivors (MOCOG study)

  RNA-seq dataset of high-grade serous ovarian cancer (HGSC) tumours from long-term survivors performed as part of the Multidisciplinary Ovarian Cancer Outcomes Group (MOCOG) study. The dataset includes fastq files from 56 HGSC tumours (53 primary tumours and 3 recurrent tumours) from 53 long-term survivor patients. Libraries were generated using the Illumina Stranded mRNA Prep and 150 bp paired-end sequencing was performed to a minimum of 100 million reads on Illumina NovaSeq 6000 instruments.

  Dataset EGAD00001008537

• Genome and transcriptome sequence data from a myoepithelioma patient

  Genome and transcriptome sequence data from a myoepithelioma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010938

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010940

• Genome and transcriptome sequence data from a leiomyosarcoma patient

  Genome and transcriptome sequence data from a leiomyosarcoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010939

• Genome and transcriptome sequence data from a melanoma patient

  Genome and transcriptome sequence data from a melanoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010943

• Genome and transcriptome sequence data from a pancreatic cancer patient

  Genome and transcriptome sequence data from a pancreatic cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010945

• Genome and transcriptome sequence data from a cervical cancer patient

  Genome and transcriptome sequence data from a cervical cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010947

• Genome and transcriptome sequence data from a pancreatic cancer patient

  Genome and transcriptome sequence data from a pancreatic cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010948

• Genome and transcriptome sequence data from a endometrial adenocarcinoma patient

  Genome and transcriptome sequence data from a endometrial adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010949

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010951

• Genome and transcriptome sequence data from a uveal melanoma patient

  Genome and transcriptome sequence data from a uveal melanoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010956

• Genome and transcriptome sequence data from a leiomyosarcoma patient

  Genome and transcriptome sequence data from a leiomyosarcoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010957

• Genome and transcriptome sequence data from a metastatic melanoma patient

  Genome and transcriptome sequence data from a metastatic melanoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010958

• Genome and transcriptome sequence data from a metastatic adenocarcinoma patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010960

• Genome and transcriptome sequence data from a pancreas adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreas adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010963

• hereditary BrEAst Case CONtrol study (BEACCON)

  The BEACCON study aimed to address the lack of power of previous studies to identify novel BC predisposition genes by performing extensive sequencing in 12,000 women (11,511 analysed following exclusions) and further enhancing power by using an ‘extreme phenotype’ design with enrichment of familial non-BRCA1 and BRCA2 cases, compared with a control population of older women with ongoing confirmation of cancer-free status at June 2019. Three-quarters of the 1303 candidate genes screened were selected based on empiric evidence from local (69 multi-case BC families) or international whole exome sequencing studies, and the remainder were included to provide detailed coverage of functional pathways with established associations with BC.

  Dataset EGAD00001007025

• ChIIP-seq and RNA-seq

  epigenome profiling in tumor tissues and paired normal tissues of LUAD patients and transcriptome profiling in tumor tissues of LUAD patients.

  Dataset EGAD00001007066

• The Dutch Microbiome Project Batch 1

  The Dutch Microbiome Project (DMP) data includes shotgun metagenomic sequencing of faecal samples 8,208 Dutch individuals. Paired-end sequencing was performed using Illumina HiSeq 2000 platform. Data is archived in two batches to facilitate easier data access and upload to EGA. Batch 1 of DMP includes 4396 samples.

  Dataset EGAD00001007027

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• RNA Dataset

  The RNA dataset includes 5 samples analyzed with the Oncomine Comprehensive Assay (OCA) panel. After library preparation, sequencing was performed on the Ion Torrent S5 System, generating FASTQ files. The analysis captures gene fusions and splice variants relevant to oncogenic processes. (idem)

  Dataset EGAD50000002502

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• This dataset contains the cram files from the whole Exome sequencing

  Exome Sequencing of Healthy and M. Heamophilum Infected Participants

  Dataset EGAD50000001565

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• Single-cell RNA/ATAC multiome profiling of hepatoblastoma resection samples

  10x Genomics Chromium Next GEM Single Cell Multiome ATAC + Gene Expression data of hepatoblastoma tissue samples. BAM files containing sequencing data of resection material of PT13 and PT17.

  Dataset EGAD50000001750

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Low pass whole genome sequencing of CACRC

  Genome-wide copy number profiling was performed using low-pass whole genome sequencing on archival non-dysplastic mucosa (n=9), low-grade dysplasia (LGD; n=30), high-grade dysplasia (HGD; n=13), mixed LGD/HGD (n=7) and CA-CRC (n=19).

  Dataset EGAD00001004270

• Somatic point mutation data from microsatellite unstable colorectal cancers

  The dataset contains the somatic point mutation data from the exome-targeted region of 36 exome or whole genome sequenced microsatellite unstable colorectal cancers and the somatic point mutation data from 93 additional MiSeq sequenced microsatellite unstable colorectal cancers.

  Dataset EGAD00001004281

• Whole exome sequencing of 76 individuals with familial atrial fibrillation

  Whole exome sequencing of 76 individuals with familial atrial fibrillation. BAM files have been aligned with BWA meme algorithm. Fastq files were filtered and trimmed using cutadapt. Samples have been sequnced on an Illumina 2500 machine.

  Dataset EGAD00001004333

• Whole genome sequencing of adult T-cell leukemia/lymphoma.

  Whole genome sequencing of 48 tumor/normal pairs obtained from adult T-cell leukemia/lymphoma. This data set includes 11 full-pass WGS and 37 low-pass WGS data.

  Dataset EGAD00001001412

• WGS on patients 5-7, study of metastatic prostate cancer

  Data from the study of subclonal metastatic expansion in prostate cancer. Whole genome shotgun sequencing of six samples, tumour and whole blood, from the three additional patients whose somatic variants were examined in depth.

  Dataset EGAD00001001344

• Exome sequencing reads of paediatric glioblastoma

  Whole exome sequencing of paediatric glioblastoma with mutations reported in the manuscript: Mutations in ACVR1, FGFR1 and TP53 associate with tumor location in histone H3 K27M pediatric midline high-grade astrocytoma

  Dataset EGAD00001000792