14977 results for "cancer studies using rna-seq"

in 34.40 milliseconds.

• Transcriptome Profiling of human AT2 cells in COPD

  RNA-seq of FACS sorted AT2 cells from ex-smokers with (n=6) and without (n=3) COPD at different disease stages. Fastq files are provided.

  Dataset EGAD00001011115

• The dataset for Detection of brain cancer using genome-wide cell-free DNA fragmentomes

  The dataset for “Detection of brain cancer using genome-wide cell-free DNA fragmentomes” includes 310 bam files from whole genome next-generation sequencing on the Illumina Novaseq 6000. The dataset analyzed include plasma cfDNA samples from patients with cancer, patients with neurological conditions, and healthy individuals.

  Dataset EGAD50000001445

• Testing_the_feasibility_of_genome_scale_sequencing_in_routinely_collected_FFPE_cancer_specimens_versus_matched_fresh_frozen_samples

  Testing the feasibility of genome-scale sequencing in routinely collected formalin-fixed paraffin-embedded (FFPE) cancer specimens versus matched fresh-frozen samples using whole exome and targeted exome capture prior to Illumina sequencing.

  Study EGAS00001000173

• A Single-Cell and Spatial Atlas of Early Human Olfactory Development

  The human nasal region is a complex structure derived from neural crest and placodal lineages, but its development remains poorly understood due to limited fetal tissue access and its intricate architecture. To address this, we created a single-nucleus and spatial transcriptomic atlas of the human fetal nasal region using tissue from 10 fetuses between 7 and 12 post-conceptional weeks. Single-nucleus RNA sequencing (snRNA-seq) revealed 34 distinct cell types, including epithelial, cartilaginous, immune, neuronal, glial, muscular, and vascular cells. By integrating snRNA-seq with multiplexed error-robust fluorescence in situ hybridization (MERFISH), we tracked dynamic changes in cell composition and gene expression over time in the olfactory epithelium (OE) and surrounding nasal regions. We identified novel markers of olfactory sensory neuron development and key pathways regulating epithelial patterning and OE morphogenesis. Notably, we observed early molecular signatures consistent with the "one neuron-one receptor" model, with spatially organized expression of 171 olfactory receptor genes. Together, this study presents the first integrated molecular and spatial framework of early human nasal development. It offers an unprecedented molecular blueprint of olfactory system formation and serves as a foundational resource for embryologists and developmental biologists studying sensory neurogenesis, epithelial patterning, and congenital disorders.

  Dataset EGAD50000001712

• PDAC organoid genomic heterogeneity

  The establishment of patient-derived pancreatic cancer organoid culture in recent years creates an exciting opportunity for researchers to perform a wide range of in vitro studies on a model that closely recapitulates the tumor. Among the outstanding questions in pancreatic cancer biology are the causes and consequences of genomic heterogeneity observed in the disease. However, to use pancreatic cancer organoids as a model to study genomic variations, we need to first understand the degree of genomic heterogeneity and its stability within organoids. Here, we used single-cell whole-genome sequencing to investigate the genomic heterogeneity of two independent pancreatic cancer organoids, as well as their genomic stability with extended culture. Clonal populations with similar copy number profiles were observed within the organoids, and the proportion of these clones was shifted with extended culture, suggesting the growth advantage of some clones. However, sub-clonal genomic heterogeneity was also observed within each clonal population, indicating the genomic instability of the pancreatic cancer cells themselves. Furthermore, our transcriptomic analysis also revealed a positive correlation between copy number alterations and gene expression regulation, suggesting the “gene dosage” effect of these copy number alterations that translates to gene expression regulation.

  Study EGAS00001006782

• Nivolumab plus chemotherapy or ipilimumab in gastroesophageal cancer: CheckMate 649 biomarker analyses

  First-line nivolumab-plus-chemotherapy demonstrated superior overall survival (OS) versus chemotherapy for advanced gastroesophageal adenocarcinoma (CheckMate 649). Nivolumab-plus-ipilimumab provided durable responses and higher survival rates versus chemotherapy; however, the prespecified OS significance boundary was not met. To identify biomarkers predictive of differential efficacy outcomes, exploratory analyses were performed using whole-exome sequencing and RNA sequencing. Nivolumab-based therapies demonstrated improved efficacy versus chemotherapy in hypermutated and, to a lesser degree, Epstein Bar Virus-positive tumors compared with chromosomally unstable and genomically stable tumors. Within the KRAS-altered subgroup, only patients treated with nivolumab-plus-chemotherapy demonstrated improved OS benefit versus chemotherapy. Low stroma gene expression signature scores were associated with OS benefit with nivolumab-based regimens; high regulatory T-cell signatures were associated with OS benefit only with nivolumab-plus-ipilimumab. Our analyses suggest that distinct and overlapping pathways contribute to the efficacy of nivolumab-based regimens in gastroesophageal adenocarcinoma.

  Study EGAS50000000747

• Childhood Cancer Model Atlas

  we establish a single-site collection of 243 cell lines, including 207 paediatric cancer cell lines representing 14 distinct extracranial and brain childhood tumour types. We subjected 164 paediatric cancer cell lines to multi-omic analyses across three dimensions (DNA-sequencing, RNA-sequencing, DNA methylation) to classify them based on clinically relevant molecular subtypes.

  Study EGAS00001006320

• RNA sequencing of BCP-LBL patients samples

  In order to perform comprehensive transcriptomics and gene fusion analyses of a cohort of BCP-LBL patients, we performed RNA sequencing of 49 tissue samples from BCP-LBL patients. Because the material was available as FFPE, and had a relative low quality, we used a capture-based approach, where NGS libraries obtained from total RNA were captured in 4-plex, using a whole exome capture panel.

  Dataset EGAD50000000419

• RNAseq profiles from the CheckMate-142 clinical trial

  The dataset contains RNAseq profiles of 57 patients from the CheckMate-142 clinical trial. The Allprep DNA/RNA FFPE kit was used to simultaneously purify genomic DNA and RNA from formalin-fixed, paraffin embedded (FFPE) tissue sections. Baseline tumor tissue samples were processed using the Illumina TruSeq RNA Access in-solution hybrid capture panel and underwent subsequent NGS on the Illumina NovaSeq platform. Fastq files are included.

  Dataset EGAD50000000609

• Total RNA sequencing of 32 chronic lymphocytic leukemia (CLL) patients

  Peripheral blood mononuclear cells (PBMC) of CLL patients were isolated by density-gradient centrifugation over Linfosep (Biomedics, Madrid, Spain). B cells were purified with a CD19+ magnetic-bead system (MidiMACS, Miltenyi Biotec, Bergish Gladbash, Germany) according to the manufacturers’ instructions. Mean B-cell purity was >99% and the mean percentage of CD5+/CD19+ cells after purification was >98%, as measured by flow cytometry. Total RNA was extracted from purified cells in a single step using TriPure Isolation Reagent (Roche Applied Science, Vilvoorde, Belgium).Whole transcriptome sequencing libraries were prepared using the TruSeq Stranded Total RNA Sample Preparation Kit (Illumina). Libraries underwent 2 × 76 bp paired-end sequencing on a HiSeq 2500 instrument (Illumina). The median number of paired-end reads was 60.5 million (range, 49.7-79.7 million).

  Dataset EGAD00001004047

• Identification of High-Risk PHF19 Expressing Cells in Myeloma Single-Cell Multiomics

  The aim of this study is to identify novel subsets of cells that are associated with progression and response to treatment. In this project, we study the tumor fraction from 49 myeloma patients across stages of progression. Samples were collected from 10 smoldering multiple myeloma (SMM), 22 newly diagnosed multiple myeloma (NDMM), and 17 relapsed refractory multiple myeloma (RRMM) patients. These samples were then sorted using magnetic-activated cell sorting (MACS) for CD138+ cells that represent the tumor fraction of each sample. The CD138+ fraction then underwent whole genome sequencing (WGS), where possible, and single-cell multiomics. Single-cell multiomics can now measure scRNA-seq and scATAC-seq simultaneously, which we use in this project. Using single-cell multiomics, we will study subclonal changes in gene expression, chromatin accessibility, and identify novel regulatory relationships within myeloma tumors. Furthermore, we will apply state of the art single-cell and single-cell multiomic techniques to better identify the more high-risk components of myeloma.

  Study phs003220

• Childhood Cancer Data Initiative (CCDI): Pediatric In Vivo Testing Program - Neuroblastoma

  The goal of NCI's Pediatric In Vivo Testing Consortium (PIVOT) is to advance the development of effective treatments for pediatric cancers through preclinical in vivo testing of novel therapeutic agents. To design impactful experiments that can be rapidly translated to the clinic, PIVOT investigators require comprehensive genomic characterization of the patient-derived xenograft (PDX) models used across the consortium. This robust experimental design enhances collaboration with industry partners by providing proof-of-concept data for drugs in development. As part of this effort, neuroblastoma PDX models are being molecularly characterized to identify promising therapeutic candidates. The molecular profiling includes whole exome sequencing (WES), RNA-seq, MethylEPIC array, CytoSNP array, and DNA fingerprinting for quality control. Additionally, demographic and clinical data (e.g., diagnosis, disease site, disease status) are shared. These characterized PDX models, matched with patient tumors, guide model selection for preclinical drug testing.

  Study phs003163

• A Functional Network of Gastric-Cancer-Associated Splicing Events Controlled by Dysregulated Splicing Factors

  Except for a few genes known to have oncogenic spliceforms in gastric cancer, the full scope of aberrant splicing in gastric oncogenesis remains unclear. In this study, we elucidated the alternative splicing events associated with gastric carcinogenesis and identified upstream regulators governing these events. We performed RNA-seq on 19 matched tumor/normal pairs and a panel of gastric cancer cell lines, and identified 361 tumor associated (TA) alternative splicing events (ASEs), which included known oncogenic ASEs in genes such as INSR, FGFR2, CD44 and KRAS. We further identified 8 splicing factors dysregulated in gastric tumors, the expression of which are correlated to the splice ratio of the TA ASEs. We thereby constructed a dysregulated splicing network in gastric cancer, consisting of alternative splicing changes correlated to their potential regulators. This network featured three potential regulatory modules centered around the splicing factors ESRP2, MBNL1 and PTPB1. Knockdown of each splicing factor led to the expected changes in splicing of approximately half of the ASEs assayed. Thus, dysregulation of the splicing factors indeed was the cause of many of the TA ASEs. Pathway enrichment analysis showed that genes affected by tumor associated splicing were pre-dominantly involved in cytoskeletal organization. Concordant with this, knockdown of the splicing factors regulating the TA ASEs led to the expected changes in trans-well migration activity. Thus, we have established for the first time a comprehensive splicing network that likely drives gastric tumor progression, based on which novel therapeutic targets can be identified for further evaluation.

  Study EGAS00001002256

• RNA-Sequencing of cervical cancers

  Question: Can we identify cervical cancer patients who are at risk for distant metastatic (DM) recurrence following treatment with radiotherapy, concurrent weekly cisplatin and brachytherapy (RTCT). Findings: An immune-based 55 gene risk score was developed using a cohort of 81 patients treated with RTCT that was strongly predictive of DM and cause-specific survival (CSS). The risk score was validated in two independent patient cohorts. A high immune metastatic risk score was associated with a high tumor mutational burden and a ‘cold’, immune-excluded tumor microenvironment at diagnosis. Meaning: The immune gene expression risk score may help to identify patients at risk of DM and potential targets for mitigating this risk.

  Study EGAS50000000087

• RNA sequencing of undifferentiated sarcomas

  Undifferentiated sarcomas (USARCs) of adults are diverse, rare, and aggressive soft tissue cancers. Recent sequencing efforts have confirmed that USARCs exhibit one of the highest burdens of structural aberrations across human cancer. Here, we sought to unravel the molecular basis of the structural complexity in USARCs by integrating DNA sequencing, ploidy analysis, gene expression, and methylation profiling. We identified whole genome duplication as a prevalent and pernicious force in USARC tumorigenesis. Using mathematical deconvolution strategies to unravel the complex copy-number profiles and mutational timing models we infer distinct evolutionary pathways of these rare cancers. In addition, 15% of tumors exhibited raised mutational burdens that correlated with gene expression signatures of immune infiltration, and good prognosis.

  Study EGAS00001003291

• Single nuclei ATAC-Seq data from the human ganglionic eminences

  Data generated through single nuclei ATAC sequencing on whole ganglionic eminences from 3 human fetuses (two of 16 and one of 17 gestational weeks). Tissue was acquired from the MRC-Wellcome Trust Human Developmental Biology Resource with ethical approval. snATAC-Seq libraries were prepared from ~8,000 nuclei per sample using Chromium Next GEM Single Cell ATAC (v1.1) reagents (10X Genomics). Quality control of libraries was performed using the Agilent 5200 Fragment Analyzer before sequencing on an Illumina NovaSeq 6000 to a depth of at least 617 million read pairs per library. Raw sequencing data were converted into FASTQ files. For a full description of data generation, please see Cameron et al, Schizophrenia Bulletin 2024, https://doi.org/10.1093/schbul/sbae083. Please note that 10X generated BAM files, rather than FASTQ files, have been uploded. FASTQ files can be regenerated using the 10X Genomics bamtofastq tool. https://support.10xgenomics.com/docs/bamtofastq

  Dataset EGAD50000000601

• Genomic Characterization of Head and Neck Squamous Cell Carcinoma Cell Lines

  Head and neck squamous cell carcinoma (HNSCC) is the sixth leading cancer by incidence worldwide(1). Various chemical carcinogens (tobacco, alcohol and betel nut), human papillomavirus (HPV) infection, and genetic predisposition contribute to the etiology of HNSCC, and to the complex genetic alterations in tumor subsets that differ in prognosis and response to therapies (2). Recently, a comprehensive landscape of genomic and transcriptomic alterations in HNSCC tumors has emerged from The Cancer Genome Atlas (TCGA) Network (3). TCGA revealed novel and previously recognized gene and chromosomal region copy number alterations (CNAs), mutations, and expression clusters, and defined their frequency, co-occurrence, and relationship to common and rare subtypes of HPV(-) and (+) tumors that vary in prognosis. To identify cell line models for determining the functional role and therapeutic importance of these alterations, we are performing whole exome and RNA sequencing and bioinformatic analysis of an expanded panel of 15 HPV(-) and 11 HPV(+) HNSCC cell lines and primary oral keratinocytes. We find that the recurrent genomic alterations in cell lines are remarkably consistent with those found in more aggressive tumors, from which cell lines have traditionally been most readily adapted to culture (4). Genome-wide correlation of CN (copy number) with expression identified a suite of potential drivers or modifier genes that differ by HPV status, and are of potential biologic and therapeutic relevance. Further, our findings elucidate and validate genomic alterations underpinning numerous discoveries made with these widely-used and recently derived HNSCC lines, and provide a roadmap for their potential use as models for future studies of tumor subtypes with worse prognosis. References Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87-108. Van Waes C, Musbahi O. Genomics and advances towards precision medicine for head and neck squamous cell carcinoma. Laryngoscope Investig Otolaryngol. 2017;2(5):310-9. Cancer Genome Atlas N. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature. 2015;517(7536):576-82. White JS, Weissfeld JL, Ragin CC, Rossie KM, Martin CL, Shuster M, et al. The influence of clinical and demographic risk factors on the establishment of head and neck squamous cell carcinoma cell lines. Oral Oncol. 2007;43(7):701-12.

  Study phs001581

• Liquid biopsy to identify taxane resistance in castration-resistant prostate cancer patients

  Taxanes are life-prolonging treatments for patients with advanced prostate cancer. However, treatment resistance and lethal disease invariably develops. We here used liquid biopsies to identify and characterize resistance to cabazitaxel using a targeted sequencing panel (PCF-SELECT).

  Study EGAS50000001292

• Evaluation of somatic mutations in urine samples as a non-invasive method for the detection and molecular classification of endometrial cancer

  Purpose: Current diagnostic methods for endometrial cancer lack specificity, leading to many women undergoing invasive procedures. The aim of this study was to evaluate somatic mutations in urine to accurately discriminate endometrial cancer patients from controls. Experimental Design: Overall, 72 samples were analyzed using next-generation sequencing with molecular identifiers targeting 47 genes. We evaluated urine supernatant samples from women with endometrial cancer (n=19) and age-matched controls (n=20). Cell pellets from urine and plasma samples from seven cases were sequenced; further, we also evaluated paired tumor samples from all cases. Finally, immunohistochemical markers for molecular profiling were evaluated in all tumor samples. Results: Overall, we were able to identify mutations in DNA from urine supernatant samples in 100% of endometrial cancers. In contrast, only one control (5%) showed variants at a variant allele frequency (VAF)≥2% in the urine supernatant samples. The molecular classification obtained by using tumor samples and urine samples showed good agreement. Analyses in paired samples revealed a higher number of mutations and VAFs in urine supernatants than in urine cell pellets and blood samples. Conclusions: Evaluation of somatic mutations using urine samples may offer a user-friendly and reliable tool for endometrial cancer detection and molecular classification. The diagnostic performance for endometrial cancer detection was very high, and cases could be molecularly classified using these noninvasive and self-collected samples. Additional multi-center evaluations using larger sample sizes are needed to validate the results and understand the potential of urine samples for the early detection and prognosis of endometrial cancer.

  Study EGAS00001007396

• (h)MeDIP-Seq of high-risk prostate cancer

  high-throughput sequencing of methylated and hydroxymethylated DNA from tumor and non-tumor tissue of patients with high-risk prostate cancer

  Dataset EGAD00001002010

• Targeting AXL Kinase Uniquely Sensitizes Therapy-Insensitive Leukemic Stem and Progenitor Cells to Venetoclax Treatment in Acute Myeloid Leukemia

  The abundance of genetic abnormalities and phenotypic heterogeneities in AML pose significant challenges to developing improved treatments. Here we demonstrated that a key GAS6/AXL axis is highly activated in AML patient cells, particularly in leukemic stem cells. We developed a potent, selective AXL inhibitor that has excellent pharmaceutical properties and efficacy against preclinical patient-derived xenotransplantation models of AML. Importantly, inhibition of AXL sensitized AML stem/progenitor cells to venetoclax treatment, with strong synergistic effects in vitro and in vivo. Mechanistically, single-cell RNA-sequencing and functional validation studies uncovered that AXL inhibition or in combination with venetoclax potentially targets intrinsic metabolic vulnerabilities of AML stem/progenitor cells, which shows a distinct transcriptomic profile and inhibits mitochondrial oxidative phosphorylation. These findings have direct translational impact on the treatment of AML and other cancers with high AXL activity.

  Study EGAS00001004663

• Dataset for GIST-EXON

  Rare cancer sequencing data of 64 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008875

• MATISSE bulk RNA-sequencing data

  Tumor availability: Bulk RNA sequencing was performed on tumor biopsies of 48 patients at baseline and 45 patients across time points (baseline n=48, week 1 n=38, week 2 n=34, week 4 n=37), including lymph node metastasis that were sequenced in addition to the primary tumor. Tumor RNA was extracted from formalin-fixed paraffin-embedded (FFPE) primary tumor and lymph node metastasis sections containing at least 10% viable tumor cells present in the sample, except for on-treatment samples with a complete pathological response in which we isolated samples with at least 10% immune-infiltration with no viable tumor cells. A pathologist (LS) scored the tumor percentage and indicated the most tumor-dense region on a hematoxylin and eosin (H&E) stain slide for subsequent RNA isolation. According to the manufacturer's protocol, five to 10 FFPE slides (10 µm) were used for RNA isolation using the AllPrep DNA/RNA FFPE isolation kit (Qiagen, 80234) and the QIAcube. Genetic Diagnostics and Sequencing Services (CeGaT) performed RNA sequencing in Germany. Data processing: Demultiplexing of the sequencing reads was performed with Illumina bcl2fastq (v2.20). Adapters of the reads (Pico v2 SMART adapter, first three nucleotides of the second sequencing read) were trimmed with Skewer (v0.2.2), without quality trimming. RNA-sequencing data was aligned to GRCh38 (Ensembl v109) using STAR (v2.7.9) in 2-pass mode with default settings. Gene counts were generated with the HTSeq (v2.0.2). FastQC (v0.12.1) and MultiQC (v1.14) were used for assessing data quality, on FASTQ files and intermediate processing steps.

  Dataset EGAD50000001470

• The_Genomic_Advances_in_Sepsis__GAinS__RNA_seq

  Sepsis is defined as life-threatening organ dysfunction caused by a dysregulated host response to infection. This cohort comprises a subset of patients enrolled in the Genomic Advances in Sepsis (GAinS) study, an established biobank of adult sepsis patients. Patients with sepsis due to community acquired pneumonia or faecal peritonitis were recruited from 34 hospitals across the UK from 2005-2018, with samples for functional genomics and detailed clinical information collected on the first, third and/or fifth day following ICU admission. RNA was extracted from leukocytes isolated at the bedside using LeukoLOCK kits. We have previously identified sepsis response signatures (SRSs), transcriptomic endotypes that are associated with differential early mortality (Davenport et al, Lancet Respir Med, 2016; Burnham et al, AJRCCM, 2017) and response to treatment in a clinical trial (Antcliffe et al, AJRCCM, 2018). We generated RNA sequencing data on 903 samples, including 134 samples repeated from our previously released microarray data. Libraries were prepared using NEB Ultra II Library Prep kits (Illumina) and sequenced on a NovaSeq 6000. Reads were aligned to the reference genome (GRCh38) using STAR and gene counts quantified using featureCounts (annotation Ensembl v99). Counts were TMM-normalised and log-transformed. Following QC, processed data were available on 864 samples from 667 unique patients.

  Study EGAS00001003772

• Baylor College of Medicine Advancing Sequencing in Childhood Cancer Care (BASIC3) Clinical Exome Sequencing Study - Clinical Sequencing Exploratory Research Consortium

  The BASIC3 (Baylor College of Medicine Advancing Sequencing in Childhood Cancer Care) study is a National Genome Human Research Institute (NHGRI) and National Cancer Institute-funded Clinical Sequencing Exploratory Research (CSER) consortium project that focuses on prospective implementation of clinical whole exome sequencing in the pediatric oncology clinic. The primary study objective are to integrate information from CLIA-certified germline and tumor exome sequencing into the care of newly diagnosed solid tumor patients at Texas Children's Cancer Center, and to perform parallel evaluation of the impact of tumor and germline exomes on families and physicians. Blood and frozen tumor (if available) samples are collected from children undergoing surgery or biopsy of newly diagnosed solid tumors and subjected to exome sequencing in a CLIA-certified laboratory. Germline and tumor (if applicable) exome sequencing reports are generated and submitted into the electronic health record and returned to each patient/family by their primary oncologist. If specific (optional) consent is obtained, research sequencing studies (including transcriptome sequencing) are performed in addition to the clinical exome sequencing.

  Study phs001026

• Single cell RNAseq of PBMC from bladder cancer patients

  This dataset contains single cell RNA sequencing data of PBMC samples from 10 bladder cancer patients. cDNAs and single cell RNA libraries were prepared following manufacturer’s user guide (10x Genomics). Each library was sequenced in HiSeq4000 (Illumina) to achieve ~300 million reads following manufacturer’s sequencing specification.

  Dataset EGAD00001005481

• RNA sequencing of Korean ER positive breast cancer females aged under 35 years old.

  Corresponding data set is composed of RNA sequencing of Korean ER positive breast cancer under 35 years old. This set provides 50 alignment files of 50 tumor samples. This is a part of total project data set.

  Dataset EGAD00001003243

• Dataset contains all Single cell RNAseq data of human neurons from the study Bouwen et al Nat Comm 2025

  These documents contain the patch seq data presented in the Bouwen et al Nat Comm 2025. Human brain samples were gathered during surgery, neurons were isolated using patch clamp glass pipette. Isolated cells were processed using Smartseq2 pipeline, and sequenced using an Illumina 2500. Files are formatted in fastq format. There are a total of 12 patient samples, each with 2 replication runs.

  Dataset EGAD50000001979

• CITE-seq of early breast cancer

  CITE-seq of early breast cancer samples.

  Dataset EGAD00001007058

• smRNA-Seq assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  smRNA-Seq assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001226

• Fastq data for smRNA-Seq assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for smRNA-Seq assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001401

• Whole exome sequencing of SarBC-01- and UroBC-01-related samples.

  This dataset contains raw FASTQ files from DNA of SarBC-01-related samples (SarBC-01 patient Germline, SarBC-01 patient Urothelial tumor, SarBC-01 patient Sarcomatoid tumor, SarBC-01 Passage 6 organoids, SarBC-01 Passage 20 organoids) and UroBC-01 related samples (UroBC-01 patient Germline, UroBC-01 patient Urothelial tumor, UroBC-01 Passage 19 organoids, UroBC-01 Passage 6 organoids). DNA was extracted from FFPE tissue, using RecoverAll RNA/DNA extraction kit (Invitrogen, Carlsbad, CA, USA, AM1975) followed by incubation with Uracil-DNA Glycosylase, and fresh or flash frozen tissue, using Quick-DNA/RNA Miniprep kit (Zymo Research, Irvine, CA, USA, D7001). Twist Human Core Exome + RefSeq + Mito-Panel kit (Twist Bioscience, 102031) was used for the whole exome capturing. Sequencing was performed on Illumina NovaSeq 6000 using paired-end 100-bp reads.

  Dataset EGAD00001011157

• University of Pennsylvania CAR T Cell Responding and Non-responding Patients

  The adoptive transfer of autologous T cells genetically modified to express a CD19-specific, 4-1BB/CD3zeta-signaling chimeric antigen receptor (CAR; CTL019) has shown remarkable activity in patients with B acute lymphoblastic leukemia. Similar therapy can induce long-term remissions for relapsed/refractory chronic lymphocytic leukemia (CLL) patients, but in only a small subset of subjects. The determinants of response and resistance to CTL019 therapy of CLL are not fully understood. We employed next generation sequencing of RNA (RNA-seq) to identify predictive indicators of response to CTL019 treatment. We performed RNA-seq on leukapheresis and manufactured infusion product T cells from patients with heavily pre-treated and high-risk disease. To characterize potency, we also performed RNA-seq on the cellular infusion product after CAR-specific stimulation. Our findings indicate that durable remission in CLL is associated with gene expression signatures of early memory T cell differentiation (e.g., STAT3), while T cells from poorly- or non-responding patients exhibited elevated expression of key regulators of late memory as well as effector T cell differentiation, apoptosis, aerobic glycolysis, hypoxia and exhaustion. These gene expression signatures, along with additional immunological biomarkers, may be used to identify which patients are most likely to respond to cellular therapies and suggest manufacturing modifications that might potentiate the generation of maximally efficacious infusion products. In a follow-up study, we report multiplex CRISPR-Cas9 gene editing on T cells in humans to test the hypothesis that disrupting genes encoding the endogenous T cell receptor (TCR), TCRα (TRAC) and TCRβ (TRBC), as well as PD-1 (PDCD1) would enhance the efficacy of autologous T cells engineered to express a transgenic NY-ESO TCR. We used single cell RNA-seq to comprehensively characterize the transcriptomic phenotype of this T cell product and its evolution over time in a patient with sarcoma. Notably, this patient's transferred T cells that persisted in vivo demonstrated increases in expression of genes associated with a central memory state (IL7R, TCF7). These findings may guide future trials involving administration of genetically redirected, genome -edited T cells.In this follow-up study, we investigated whether CRISPR-Cas9-mediated disruption of PDCD1 and/or CTLA-4 could restore CART dysfunction in healthy donors and/or CLL patients. We show that depletion of CTLA-4 rescues the function of T cells from leukemia patients that previously failed CART cell treatment. We performed single-cell RNA sequencing and characterized the transcriptomic landscape of CTLA-4 KO CART19 cells that showed higher proliferation and anti-tumor efficacy by permitting unopposed CD28 signaling and maintenance of CAR expression on the T cell surface under stress-test conditions of chronic antigen exposure. Our findings reveal that selective disruption of CTLA-4 invigorates dysfunctional patient T cells, providing a strategy for increasing patient responses to CART cell therapy.

  Study phs001707

• GATA1 scD&D-seq integrated with Multiome

  Ex vivo differentiation experiments were performed using human CD34+ hematopoietic stem and progenitor cells along the erythropoietic trajectory at multiple timepoints (differentiation days 0, 5, 8, 18, and 24). Simultaneous profiling of transcriptome, chromatin accessibility, and GATA1 binding were performed by integrating D&D-seq with 10X Multiome.

  Dataset EGAD50000002299

• Human tumor scMultiome

  We profile 10 high-grade gliomas patient brain tumor samples by single-cell multiome ATAC + gene expression, using the 10X Chromium technology. 3 sets of fastq are provided for each samples: R1 and R2 for gene expression, R1 and R2 for ATAC-seq as well as index1 and index2 for ATAC-seq.

  Dataset EGAD00001008349

• RNA-seq consisting of FASTQ paired-end reads from cancer samples

  Efforts to precisely identify tumor human leukocyte antigen presented peptides (HLAp) capable of mediating T cell based tumor rejection still face important challenges. Recent reports suggest that non-canonical cancer HLAp could be immunogenic but their identification requires highly sensitive and accurate mass-spectrometry (MS)-based proteogenomics approaches. Here, we present a MS-based analytical pipeline that can precisely characterize the non-canonical HLAp repertoire, incorporating whole exome sequencing, bulk and single cell transcriptomics, ribosome profiling, and a combination of two MS/MS search tools. This approach results in the accurate identification of hundreds of shared and tumor-specific non-canonical HLAp. Albeit often at low levels and in distinct subpopulations of cells, numerous non-canonical HLAp are shared across tumors. This analytical platform holds great promise for the discovery of novel cancer antigens for cancer immunotherapy.

  Study EGAS00001003724

• Single-cell RNA-seq data of bronchoalveolar lavage (BAL) fluid in late severe COVID-19

  We performed single-cell RNA-sequencing of cells in the bronchoalveolar lavage (BAL) fluid of late severe COVID-19. This study provides detailed insights into the alveolar macrophage response to SARS-CoV-2 infection and reveals a profibrotic macrophage response in severe COVID-19 patients.

  Dataset EGAD00001008161

• Whole-genome and transcriptome sequencing files obtained in monozygotic twins discordant for Mayer-Rokitansky-Küster-Hauser syndrome

  Raw, unfiltered, paired-end fastq files obtained through whole-genome and RNA-sequencing, respectively. RNA-seq of affected individuals in three twin pairs. WGS of blood in five twin pairs as well as uterine rudiment tissue of selected affected individuals.

  Dataset EGAD00001008992

• Whole exome and RNA sequencing data from the OXIRI phase 1b clinical trial in Asian pancreatic ductal adenocarcinoma (PDAC) patients

  This dataset contains 8 samples, each of which has paired-end WXS fastq files for Tumour and Normal samples, as well as RNA-Seq fastq file.

  Dataset EGAD00001008632

• RNA-seq of PBX1 knock-down or overexpressing cell lines

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed. This dataset contains 44 samples derived from RNA-sequencing data of bile duct and CCA cell lines. Data was generated on Illumina NovaSeq 6000 device in paired-end mode and is stored in compressed FASTQ file format.

  Dataset EGAD00001011325

• Dataset for Stromal-induced epithelial-mesenchymal transition induces drug resistance in acute lymphoblastic leukemia

  RNA-seq was performed to compare gene expression profiles between 11 patient adherent ALL samples and nonadherent ALL samples.

  Dataset EGAD00001009056

• 20210729_EGA_BrainMet Saunus et al J Path (2015)

  Exome sequencing on HiSeq platform of 36 brain metastases with matched normal samples, 32 having matched RNA seq. Published Saunus et al J Path, (2015); https://doi.org/10.1002/path.4583

  Dataset EGAD00001007973

• Omic Studies in Children's Respiratory and Environmental Workgroup (CREW) Cohorts

  Children's Respiratory Research Workgroup (CREW) is an NIH-funded project consisting of multiple individual U.S. cohorts and three scientific centers working together to identify phenotypes and causes of childhood asthma. CREW will include data from a large number of children and their families, with broad diversity in terms of ethnicity, family characteristics, neighborhoods and geographic locations. One of the primary goals of CREW is to put together sets of data and samples of participating cohorts to identify phenotypes of childhood asthma (i.e. specific subtypes of asthma that can be distinguished by clinical features such as natural history, triggers, exacerbation frequency, concurrent allergies, lung function, sex, etc). Omics studies will include genotyping, methylation, and RNA sequencing. By integrating the DNA genotyping with the expression, immunologic and clinical data, we will identify eQTL, inflammation QTL, and lung function QTL, as well as QTL associated with other biomarkers. Analyses will identify genetic, epigenetic, transcriptional and protein/metabolite profiles that are associated with specific exposures or phenotypes. As we obtain mechanistic insights about personal and early life risk factors, we will connect asthma phenotypes with underlying causes and pathogenic mechanisms to define endotypes of childhood asthma.

  Study phs004036

• DNA WGS Long Read Sequence (PromethION) for manuscript titled: "Performance of Somatic Structural Variant Calling in Lung Cancer using Oxford Nanopore Sequencing Technology"

  DNA WGS Long Read Sequence (PromethION) for manuscript titled: "Performance of Somatic Structural Variant Calling in Lung Cancer using Oxford Nanopore Sequencing Technology"

  Dataset EGAD00001015400

• The dataset for Early detection of ovarian cancer using cell-free DNA fragmentomes and protein biomarkers

  The dataset for “Early detection of ovarian cancer using cell-free DNA fragmentomes and protein biomarkers” includes 409 cram files from whole genome next-generation sequencing on the Illumina HiSeq2500. The samples analyzed include plasma samples from healthy individuals and patients with cancer.

  Dataset EGAD50000000695

• Differential Gene Expression in Cryptorchid Testes

  Differential Gene Expression in Cryptorchid Testes Study uses whole-genome RNA profiling of testicular biopsies to determine a potential causative role of isolated congenital cryptorchidism in azoospermia and/or infertility in the context of our previously published GeneChip data. Cryptorchid patients, aged 7 months to 5 years and otherwise healthy, were enrolled in this prospective study. During surgery, testicular tissue biopsies were obtained for histological examination and RNA-sequencing (RNA-seq). Fifteen patients were selected based on the histological results and were divided into two groups. Seven were classified as belonging to the high infertility risk (HIR) and eight to the low infertility risk (LIR) group. Cryptorchid boys in the high infertility risk group lacked transformation of gonocytes into Ad spermatogonia due to impaired mini puberty. This group of patients will be infertile despite successful surgery.

  Study phs001275

• Dataset for leiomyosarcoma-RNA

  Rare cancer sequencing data of 87 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008849

• Dataset for head_and_neck_cancer-RNA

  Rare cancer sequencing data of 92 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008861

• Automated system for scoring hematoxylin and eosin-stained ovarian cancer sections by identifying single cells uncovered that stromal cell ratio is a significant predictor for overall survival and progression-free survival.

  Concerted efforts in genomic studies have revealed profound insights in prognostic ovarian cancer subtypes. On the other hand, abundant histology slides have been generated to date, yet their uses remain very limited and largely qualitative. Our goal is to develop automated histology analysis as an alternative subtyping technology for ovarian cancer that is cost-efficient and do not rely on DNA quality. We develop an automated system for scoring hematoxylin and eosin-stained (H&E) primary tumour sections of 91 late-stage ovarian cancer to identify single cells including cancer and stromal cells. We demonstrated high accuracy of our system based on expert pathologists’ scores (cancer=97.1%, stromal=89.1%) as well as compared to immunohistochemistry scoring (correlation=0.87). Quantitative stromal cell ratio is significantly associated with poor overall survival after controlling for clinical parameters including debulking status and age (multivariate analysis p=0.0021, HR=2.54, CI=1.40-4.60) and progression-free survival (multivariate analysis p=0.022, HR=1.75, CI=1.09–2.82). We demonstrate how automated image analysis enables objective quantification of microenvironmental composition of ovarian tumours. Our analysis reveals a strong effect of the tumour microenvironment on ovarian cancer progression and highlights the potential of therapeutic interventions that target the stromal compartment or cancer-stroma signalling in the stroma-high, late-stage ovarian cancer subset.

  Study EGAS00001001694

• Human Brain Small Extracellular Vesicles Contain Selectively-Packaged, Full-Length mRNA

  sEVs were isolated from postmortem human brain tissue. RNA was extracted from the source brain tissue and the sEVs and prepared for RNA sequencing. cDNA was sequenced on the Illumina HiSeq using a 2x150 paired-end read configuration.

  Dataset EGAD50000000042

• Transcriptomic profiling of human small intestine macrophage and DC subsets

  Using low input SMART-seq protocol, the whole transcriptome of human small intestine macrophage subtypes is characterized.

  Dataset EGAD00001003581

• Targeted sequencing of breast cancer susceptibility genes for 1,995 Japanese breast cancer patients

  In this study, we investigated pathogenic germline variants in 11 genes implicated in hereditary breast cancer, including BRCA1, BRCA2, TP53, PTEN, CDH1, STK11, NF1, PALB2, ATM, CHEK2, NBN1, in a total of 1,995 unselected Japanese women with breast cancer using targeted-capture sequencing of pooled DNA (n = 106).

  Study EGAS00001004630

• The polarity and specificity of antiviral T lymphocyte responses determine susceptibility to SARS-CoV-2 infection in cancer patients and healthy individuals

  We monitored patient's anti SARS-CoV-2 immune responses using an in vitro cross presentation assay. The goal of this study was to identify immune correlates of clinical protection against SARS-CoV-2 infection. Briefly, peripheral blood mononuclear cells of patient were divided into a monocyte and lymphocyte. Monocyte were differentiated into monocyte derived dendritic (mo-DC)cells using GM-CSF and Interferon alpha. Mo-DC were then loaded with SARS-CoV-2 culture lysates , or VeroE86 lysates. SARS-CoV-2 loaded mo-DC were then used to stimulates their autologous lymphocytes and T cell cytokine secretion was monitored in the supernatant. We discriminated patients producing IL-2 and patients producing IL-5. RNA sequencing was performed for 18 patients, to identify gene profile associated with IL-2 or IL-5 production.

  Dataset EGAD00001008538

• Personalized Breast Cancer Vaccines Based on Genome Sequencing

  This study is from a phase I clinical trial of neoantigen DNA vaccines in triple negative breast cancer patients with persistent disease following neoadjuvant chemotherapy. The exome and RNA sequences used to identify somatic mutations, predict neoantigens, and design vaccines is within.

  Study phs002787

• Application of organoid culture system of human gastrointestinal and thoracic cancer in genome medicine

  In order to establish preclinical models, we have established a kind of lung cancer tumoroids derived from a mucus-producing solid pulmonary adenocarcinoma patient. We performed whole exome sequencing and RNA sequencing to analyze genetic background of the tumoroids.

  Study JGAS000664

• Application of organoid culture system of human gastrointestinal and thoracic cancer in genome medicine

  In order to establish preclinical models, we have established a kind of lung cancer tumoroids derived from a mucus-producing solid pulmonary adenocarcinoma patient. We performed whole exome sequencing and RNA sequencing to analyze genetic background of the tumoroids.

  Study JGAS000653

• NHLBI TOPMed: HyperGEN - Genetics of Left Ventricular (LV) Hypertrophy

  The Hypertension Genetic Epidemiology Network Study (HyperGEN) - Genetics of Left Ventricular (LV) Hypertrophy is a familial study aimed to understand genetic risk factors for LV hypertrophy by conducting genetic studies of continuous traits from echocardiography exams. The originating HyperGEN study aimed to understand genetic risk factors for hypertension. Data from detailed clinical exams as well as genotyping data for linkage studies, candidate gene studies and GWAS have been collected and is shared between HyperGEN and the ancillary HyperGEN - Genetics of LV Hypertrophy study.

  Study phs001293

• Poikiloderma_syndrome_RNAseq

  We will sequence the RNA of lymphoblast samples, transformed with EBV, which have poikiloderma syndrome with mutations in c16orf57. The aim of the experiment is to characterise RNA structural effects in this disease.

  Study EGAS00001000250

• A Tumour Organoid Biobank for Mapping Cancer Cell Vulnerabilities - RNA

  RNA sequencing data from cancer patient-derived organoids. Part of a study to include genomic and transcriptomic sequencing data, along with CRISPR screening data from cancer patient-derived organoids and matched tumour tissues. Some organoids were developed as part of the Human Cancer Models Initiative (HCMI) in collaboration with Cancer Research UK (CRUK). The study includes organoids derived from colorectal, oesophageal, ovarian, pancreatic, and stomach cancer samples.

  Dataset EGAD00001015470

• Genomic Analysis of Paired Endometrial Cancer Primaries and Metastases

  Formation of metastases is the major cause of cancer related deaths. Recent studies have sequenced primary endometrial carcinomas yielding data for a single entity in the progression from the birth of a progenitor tumor cell to metastatic disease. However, the progression of these tumors to metastases has not been characterized. We performed whole-exome sequencing of 98 tumor biopsies including complex atypical hyperplasias, primary tumors and paired abdominopelvic metastases to survey the evolutionary landscape of endometrial cancer. We expanded and reanalyzed TCGA-data, identifying novel recurrent alterations in primary tumors, including mutations in the estrogen receptor cofactor NRIP1 in 12% of patients. We found that likely driver events tended to be shared by primary and metastatic tissue-samples, with notable exceptions such as ARID1A mutations. Phylogenetic analyses in cases with multiple metastases indicated these metastases typically arose from one lineage of the primary tumor. These data indicate extensive genetic heterogeneity within endometrial cancers and relative homogeneity across metastatic sites.

  Study phs001127

• PCA Atlas Chromium scRNA-seq and demultiplexing support (FASTQs, BAMs, capture-level VCFs and mapping tables)

  This dataset contains Chromium single-cell RNA-seq data and demultiplexing support for the PCA Atlas study EGAS00001008332. Included data objects: - 16 Chromium scRNA-seq FASTQ runs (EGAR accessions) for captures PCa1–PCa16. - 16 aligned BAM analyses (one Cell Ranger possorted_genome_bam.bam per capture). - 16 capture-level genotype VCF analyses derived from the Axiom UK Biobank array, used as demultiplexing panels. - demux_map.csv (EGAZ00001945520): donor–capture–sample mapping for genotype-based demultiplexing. - chromium.csv (EGAZ00001945537): run-level mapping linking captures, EGA samples, runs (EGAR), experiments (EGAX) and BAM analyses. Together these objects provide a complete view of the Chromium scRNA-seq data and the genotype-based demultiplexing support needed to reproduce donor assignment and downstream analyses.See also https://zenodo.org/records/17372603

  Dataset EGAD00001015795

• The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) Genetics of Genetic Epidemiology of Metabolic Syndrome in an Island Population

  The major objective of this study was to conduct a systematic genetic study of metabolic traits involved in metabolic syndrome through collection and analysis of epidemiological, demographic, environmental, and relevant biological and clinical data from a relatively isolated island population of the eastern Adriatic coast of Croatia. The population was chosen for the following reasons: 1) in spite of practicing a largely traditional life style and dietary habits, high rates of obesity, arterial hypertension, dyslipidemia and related metabolic abnormalities were found in previous studies; 2) the population was established by a relatively small number of founders, predominantly of Slavic descent from the mainland during 15th to 18th century AD, a genetically homogeneous population living in a homogeneous environment; 3) sharing a common European ancestry, a relevant population for study in the context of the general US population; 4) Croatian collaborators have been conducting anthropological and genetic studies in these communities for over three decades. There were two major aims of the study: 1) to recruit ~1200 adult participants and collect blood samples together with demographic, anthropometric, environmental and clinical data from the island of Hvar; to perform biochemical tests to measure glucose, insulin, uric acid and lipid levels; 2) conduct a genome-wide association analysis of metabolic traits and phenotypes using genome-wide SNP arrays (Affymetrix Genome-Wide Human SNP Array 5.0).

  Study phs000737

• GENETIC HISTORY OF ITALY

  Recent scientific literature has highlighted the relevance of population genetic studies both for disease association-mapping in admixed populations and for understanding the history of human migrations. Deeper insight into the history of Italian population is critical for understanding the peopling of Europe. Because of its crucial position at the centre of the Mediterranean basin, the Italian peninsula has experienced a complex history of colonization and migration, whose genetic signatures are still present in contemporary Italians. In this study, we investigated genomic variation in the Italian population using 2.5 million single nucleotide polymorphisms (SNPs) in a sample of more than 300 unrelated Italian subjects with well-defined geographical origins. We combined several analytical approaches to interpret genome-wide data on 1,272 individuals from European, Middle Eastern, and North African populations. We detected three major ancestral components contributing different proportions across the Italian peninsula, and signatures of continuous gene flow within Italy, which has produced remarkable genetic variability among contemporary Italians. In addition, we have extracted novel details about the Italian population’s ancestry: we identified genetic signatures of major historical events in Europe and the Mediterranean basin from the Neolithic (e.g., peopling of Sardinia) to recent times (e.g., ‘barbarian invasion’ of Northern and Central Italy). These results are valuable for further genetic, epidemiological and forensic studies in Italy and in Europe.

  Study EGAS00001001458

• Targeted_replication_of_LVOTO_genes

  Non-syndromic cases of congenital heart defects (CHD) exhibit variable modes of inheritance (Mendelian and non-Mendelian). Several studies have identified strong candidates in humans by taking a candidate gene approach as well as by using whole exome next generation sequencing (NGS). So far these studies could only explain a minor fraction of the observed phenotype in humans, most of them in syndromic cases and no single study has focused on the subset of cases with left ventricular outflow tract obstruction (LVOTO). To discover novel disease-causing genes a large cohort of patients with LVOTO, approximately 100 cases, 25 families and 100 trios have been exome sequenced. This study based on NGS sequencing data yielded several known and novel compelling candidate genes, such as MYH6, NR2F2 and MYH11, but also novel ones, such as ITGB4. To evaluate the significance of our findings in a replication cohort we assembled another 1614 cases with an LVOTO phenotype from our collaborators in Toronto, Berlin and Amsterdam. Targeted resequencing in this additional cohort will help to find additional cases with mutations in the identified candidate genes to strengthen genotype-phenotype association. We will use control data from the INTERVAL project for case/control analyses The pulldowns will be performed as 24-plex ISC with 192 or greater indexes, and the sequencing will be performed with 192 samples per lane, requiring 9 lanes of sequencing.

  Study EGAS00001001238

• Cerebral organoid model reveals excessive proliferation of human caudal late interneuron progenitors in Tuberous Sclerosis Complex

  Although the intricate and prolonged development of the human brain critically distinguishes it from other mammals, our current understanding of neurodevelopmental diseases is largely based on work using animal models. Recent studies revealed that neural progenitors in the human brain are profoundly different from those found in rodent animal models. Moreover, post-mortem studies revealed extensive migration of interneurons into the late-gestational and post-natal human prefrontal cortex that does not occur in rodents. Here, we use cerebral organoids to show that overproduction of mid-gestational human interneurons causes Tuberous Sclerosis Complex (TSC), a severe neuro-developmental disorder associated with mutations in TSC1 and TSC2. We identify a previously uncharacterized population of caudal late interneuron progenitors, the CLIP-cells. In organoids derived from patients carrying heterozygous TSC2 mutations, dysregulation of mTOR signaling leads to CLIP-cell over-proliferation and formation of cortical tubers and subependymal tumors. Surprisingly, second-hit events resulting from copy-neutral loss-of-heterozygosity (cnLOH) are not causative for but occur during the progression of tumor lesions. Instead, EGFR signaling is required for tumor proliferation, opening up a promising approach to treat TSC lesions. Our study demonstrates that the analysis of developmental disorders in organoid models can lead to fundamental insights into human brain development and neuropsychiatric disorders.

  Study EGAS00001004586

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, CD4+ T cell subsets from 19 rheumatoid arthritis (RA), 62 systemic lupus erythematosus (SLE), 40 idiopathic inflammatory myopathy (IIM) and 64 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA). RNA-seq was performed with each CD4+ T cell subset samples.

  Study JGAS000626

• Whole Transcriptome Sequencing of NXF1 or CRM1 depleted Cell

  mRNA exporters, NXF1 and CRM1 are known to function in mRNA export. However, since each target mRNA has not been identified genome-widely, it is not clear whether they export exclusive mRNA subsets. To reveal this point, we prepared the nuclear and the cytoplasmic RNAs under either exporter inhibited condition and carried out RNA-seq. In these experiments, we also focused in the export machinery of aberrant transcripts that usually retained and decayed in the nucleus.

  Study JGAS000294

• The genomic landscape of follicular and diffuse large B-cell lymphoma

  As part of the ICGC, the ICGC MMML-Seq project performed whole genome sequencing and RNA sequencing of follicular and diffuse large B-cell lymphoma. Follicular and diffuse large B-cell lymphomas are the most common B-cell lymphomas in adulthood. Analyses were performed in concordance with the guidelines of the ICGC. The results define the genomic landscape of structural variants, somatic single nucleotide variants and mutational signatures in these lymphomas

  Study EGAS00001002199

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• NHLBI TOPMed: Pulmonary Fibrosis Whole Genome Sequencing

  This is a set of cases diagnosed with idiopathic pulmonary fibrosis, a fatal interstitial lung disease. These cases were included in the TOPMed phase three studies. The planned study will compare these cases to within-TOPMed controls for genome-wide association studies.

  Study phs001607

• Genomic Origins and Admixture in Latinos (GOAL)

  The GOAL Study was designed to comprehensively evaluate the genomic architecture of diverse Hispanic/Latino individuals with origins from the Caribbean, Central and South America, and to understand the impact of this diversity on genetic disease studies. Population structure and admixture are key confounders in genome-wide association and medical resequencing studies. In particular, accounting for difference in ancestry among cases and controls, both in terms of genomic and geographic location, is critical for proper analysis and interpretation of studies with multi- and trans-ethnic samples. Genomic studies of Hispanics/Latinos, the largest and fastest growing minority group in the US, reveal that they are a highly genetically heterogeneous admixed group with immense variation among individuals and populations in the proportions of African, European, and Native American ancestry. Knowledge of the underlying complex genetic structure of US Hispanic/Latino and Caribbean populations is, therefore, essential to ensuring robustness of genotype-phenotype associations and understanding the medical relevance of associated variants across diverse populations in the US and throughout the Americas. Furthermore, since much is known about the African and European migrations into the Americas over the past 500 years, population genetic studies of Hispanics/Latinos serve as an excellent model for developing novel algorithms and approaches for characterizing fine-scale genetic structure of admixed populations, in general. This project extends current studies of population genetic structure in US Hispanics/Latinos by densely genotyping parent-offspring triads from individuals (sampled in the US) of Caribbean-descent from six Latin American countries: Puerto Rico, Cuba, Dominican Republic, Haiti, Honduras and Colombia. This study will provide immediate insights and new statistical methods to improve study design and genetic analysis for medical genomic studies in Hispanics/Latinos, other complex admixed groups, and multi- and trans-ethnic studies.

  Study phs000750

• Whole Mitochondrial Sequencing of Gingivo-buccal Cancer: ICGC-India Project

  As a part of the ICGC, India has undertaken genomic studies on gingivobuccal cancer of the oral cavity, which is the most prevalent form of cancer among men in India. There are various known environmental (life-style) correlates of this cancer, the most important of which are tobacco chewing and HPV infection. Detailed clinical characterization of the patients, collection of data on demographic and environmental exposures, and isolation of DNA samples from blood and tumor tissues collected from each patient are being done at the Advanced Centre for Research, Treatment and Education on Cancer, Mumbai. Whole genome and other sequencing experiments are being performed at the National Institute of Biomedical Genomics, Kalyani. Whole mitochondria sequencing of 89 patients was performed in this study. The mean depth of sequencing was at least 2500X, but variable across platforms, 2689X and 9894X for amplicon sequencing in Ion Torrent PGM (Tumor-blood pairs=16) and Illumina HiSeq 2500 (Tumor-blood pairs =48), respectively; and, 14,190X for whole genome sequencing in Illumina HiSeq 2500 (Tumor-blood pairs =25). Associations of mutation data with important clinical aspects have been found.

  Study EGAS00001002425

• RNA sequencing of PTCL-NOS

  Study EGAS00001005015

• WGS of CTCs enriched using high-throughout microfluidic device from entire cancer patient leukopak

  Single-cell low-pass WGS analysis (illumina platform, PE150, 1-2x coverage) was performed on CTCs enriched using high-throughout microfluidic device from entire leukopak from patients with metastatic prostate cancer (GU-1 and GU-2) and metastatic hepatocellular carcinoma (HCC-1 and HCC-2).

  Study EGAS50000000723

• Paraganglioma Smart-Seq2 Single Nuclei Sequencing Data

  Paraganglioma is a rare neuroendocrine tumor that originates from chromaffin cells of the adrenal medulla or extra-adrenal paraganglia. This study aims to investigate the heterogeneity of this tumor and to identify potential biomarkers associated with its malignancy. To achieve this, we performed single-nucleus RNA sequencing of human paraganglioma samples using the SMART-Seq2 protocol.

  Study EGAS50000001184

• Molecular Signatures of DCIS to Invasive Progression for Basal-Like Breast Cancers: An Integrated Mouse Model and Human Tumor Study

  We studied the genomic signatures of progression in breast ductal carcinoma in situ (DCIS) as it progresses towards triple negative invasive breast cancer (TNBC). Single cell RNA sequencing (scRNAseq) was performed on the C3Tag genetically engineered mouse model that forms human breast-like DCIS and TNBC. Bulk RNA sequencing was performed on RNA harvested from archival formalin-fixed, paraffin embedded (FFPE) pairs comprising of estrogen receptor (ER) positive (ER+) and negative (ER-) subsets of DCIS. 

  Study phs002443

• Genome-Wide Association Studies of Prematurity and Its Complications (African American)

  Preterm delivery resulting in the birth of a premature infant is a complex problem with a devastating impact on individuals, families and society. The prevalence of preterm birth has increased steadily in developed countries over the last 20 years and more than three million children die of preterm birth worldwide each year. Despite the importance of the problem and its disproportionate occurrence in poor and minority populations, the underlying causes have been difficult to identify. Spontaneous preterm labor has as its suspected triggers infection, stress, poor nutrition and inherited factors. The single best predictor for preterm delivery is a previous preterm birth. Studies of twins and of recurrences within families provide evidence that genetic factors underlie a substantive component of the risk for prematurity. One major challenge in studying genetic factors in prematurity is that the risk case is not truly established. The genetic risk could reside either in the mother and her uterus or in the infant/placenta. Identification of genetic factors in the mother and/or infant could provide insights into identifying relevant environmental covariates that may be more amenable to rapid interventions but difficult to find using standard epidemiology alone. A comprehensive genome-wide association study (GWAS) is the ideal way to identify those genes that would not be suspected based on our current understanding of the biology of parturition. We are using 2200 African American samples with term or preterm labor. A subset of these (~800) are infant samples recruited by the Neonatal Research Network as part of a study on cytokines and infection in extremely low birth weight infants (Schelonka RL, et al., 2011. PMID: 21145756). Therefore, this group consists of infants <1,000 grams with clinical outcome data for the infant allowing study of the genetic contributors for not only preterm birth but also the complications that often accompany preterm birth. The result will enable a better understanding of the biology of parturition and suggest environmental modifications that can prolong gestations to improve neonatal and adult outcomes. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to preterm birth through large-scale genome-wide association studies of African-American cases and controls from multiple sites in the United States. Genotyping was performed at the Johns Hopkins University Center for Inherited Disease Research (CIDR). Data cleaning and harmonization were done at the GEI-funded GENEVA Coordinating Center at the University of Washington.

  Study phs000353

• Sequencing of in vitro generated macrophages and T cells

  Monocyte derived macrophages were polarised into M1 or M2 using IFNg+ ILP or IL-4 respectively (n =4) . Pan T cells were cultured with or without IL-2 for 4 days (n=4 - 6). Pan T cells were co-cultured with THP1 tumour cells for 20 hours in the presence or absence of ImmTAC molecules and in the presence or absence of M2 macrophages. Sorted T cells and macrophage populations prior and post co-culture were analysed by bulk RNA sequencing (60 million reads per sample) using the Illumina NovaSeq system.

  Study EGAS50000000837

• TRACERx 100: metastatic samples

  Whole exome sequencing of 10 metastatic biopsies from four TRACERx100 patients (see EGA dataset EGAS00001002247), collected either after relapse or death. The data from these samples are initially published with Abbosh, C. et al. Phylogenetic ctDNA analysis depicts early stage lung cancer evolution. Nature http://dx.doi.org/10.1038/nature22364 (2017). Abstract: Earlier detection of relapse following primary surgery for non-small cell lung cancer and the characterization of emerging subclones seeding metastatic sites might offer new therapeutic approaches to limit tumor recurrence. The potential to non-invasively track tumor evolutionary dynamics in ctDNA of early-stage lung cancer is not established. Here we conduct a patient-specific approach to ctDNA profiling in the first 100 lung TRACERx (TRAcking Cancer Evolution through therapy (Rx)) study participants, including one patient co-recruited to the PEACE (Posthumous Evaluation of Advanced Cancer Environment) post-mortem study. We identify independent predictors of ctDNA release in early-stage non-small cell lung cancer and perform tumor volume limit of detection analyses. Through blinded profiling of post-operative plasma, we observe evidence of adjuvant chemotherapy resistance and identify patients destined to experience recurrence of their lung cancer. Finally, we show that phylogenetic ctDNA profiling tracks the subclonal nature of lung cancer relapse and metastases, providing a new approach for ctDNA driven therapeutic studies.

  Study EGAS00001002415

• MutWP1__CRUK_Grand_Challenge_Mutographs_of_Cancer__head___neck

  The Mutographs project aims to advance our understanding of the causes of cancer through studies of mutational signatures. Led by Mike Stratton, together with Paul Brennan, Ludmil Alexandrov, Allan Balmain, David Phillips and Peter Campbell, this large-scale international research endeavour was awarded a Cancer Research UK Grand Challenge. Different patterns of somatic mutation are generated by the different environmental, lifestyle and genetic factors that cause cancer, many of them are still unknown. Within Mutographs, the International Agency for Research on Cancer is coordinating the recruitment of 5000 individuals with cancer (colorectal, renal, pancreatic, oesophageal adenocarcinoma or oesophageal squamous cancers) across 5 continents to explore whether different mutational signatures explain marked variation in incidence. In brief, through an international network of collaborators around the world, biological materials are collected, along with demographic, histological, clinical and questionnaire data. Whole genome sequences of tumour-germline DNA pairs are generated at the Wellcome Trust Sanger Institute. Non-tumour DNA is also studied for some cancer types. Somatic mutational signatures are subsequently extracted by non-negative matrix factorisation methods and correlated with risk factors data. Through an enhanced understanding of cancer aetiology, Mutographs unprecedented effort is anticipated to outline modifiable risk factors, lead to new approaches to prevent cancer, and provide opportunities to empower early detection, refine high-risk groups and contribute to further therapeutic development.

  Study EGAS00001005450

• Pediatric Investigation for Genetic Factors Linked with Renal Progression (PediGFR)

  The Pediatric Investigation for Genetic Factors Associated with Renal Progression (PediGFR) (RO1-DK082394) is an international collaborative study among three large prospective cohort studies of children with chronic kidney disease. The participating parent cohort studies are the Chronic Kidney Disease in Children (CKiD), the Effect of Strict Blood Pressure Control and ACE Inhibition on CRF Progression in Pediatric Patients (ESCAPE), and the Cardiovascular Comorbidity in Children with Chronic Kidney Disease (4C) study. In these cohorts, pediatric subjects with CKD have been prospectively followed with standardized measurements for renal progression. The dbGaP data upload will utilize the structure of sub-studies to include the genotype and baseline phenotype for the three cohorts, as well as the RBC trait and anemia data for a sub-study under PI Susan Furth: Role of Genetic Variation in the Anemia of Chronic Kidney Disease (K24DK078737). In brief PediGFR is a prospective study of children with chronic kidney disease (CKD) to determine genetic factors associated with kidney function measured by the estimated glomerular filtration rate (eGFR) by Schwartz equation. The PediGFR_v2 Cohort is utilized in the following dbGaP sub-studies. To view genotypes, other molecular data, and derived variables collected in these sub-studies, please click on the following sub-studies below or in the "Sub-studies" box located on the right hand side of this top-level study page phs000842 PediGFR_v2 Cohort. phs000843 4C phs000650 CKiD phs000844 ESCAPE

  Study phs000842

• Dataset of 5 RNAseq from 3 non-muscle-invasive bladder cancer patients

  RNAseq (FASTQ files) of 5 tumor from 3 non-muscle-invasive bladder cancer patients. For patient UC2, RNA from 3 different synchronous tumors was extracted. Relating to the other datasets from the project : no RNA was available from patient UC4. NB : patients aliases are the following : ROXY : UC1, OMAD : UC2, MAKI : UC3, HAPE : UC4

  Dataset EGAD50000002009

• Human lymphoma plasma cfRNA - raw data

  This study contains total RNA sequencing data from plasma of 65 different human donors: 30 diffuse large B-cell lymphoma patients, 13 primary mediastinal large B-cell lymphoma patients and 22 cancer-free controls.

  Study EGAS00001007127

• Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Illumina TSO500 RNA Dataset for Manuscript titled: Evaluation of Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration (EBUS-TBNA) Samples from Advanced Non-Small Cell Lung Cancer for Whole Genome, Whole Exome and Comprehensive Panel Sequencing

  Dataset EGAD00001015397

• Targeted_sequencing_of_genes_recurrently_mutated_in_AML

  Background Massively parallel sequencing technology has transformed cancer genomics. It is now feasible, in a clinically relevant time-frame, for a clinically manageable cost, to screen DNA from patient tumours for mutations essentially genome-wide. The challenge for personalised medicine will be to increase the sample size to thousands or tens of thousands of well-characterised cases in order to attain sufficient statistical power to stratify patients accurately across the complexity and genomic heterogeneity expected for most of the common tumour types. Currently, whole genome sequencing on this scale is not feasible, and targeted sequencing of relevant portions of the genome will be required. Pilot data We have developed protocols for large-scale, multiplexed sequencing of 100-200 genes in thousands of samples. Essentially, using robotic technology, genomic DNA from the cancer specimen is processed into sequencing libraries with unique DNA barcodes, thereby allowing sequencing reads to be attributed to the sample they derive from. Currently, these sequencing libraries can be generated in a 96-well format using fully automated protocols, and we are exploring methods to expand this to a 384-well format. The sequencing libraries are pooled and hybridized to custom sets of RNA baits representing the genomic regions of interest. Sequencing of the pulled-down libraries is done in pools of 48-96 samples per lane of an Illumina Hi-Seq. This protocol is already implemented at the Sanger Institute. We have published proof that somatic mutations in novel cancer genes can be identified from exome-wide sequencing. In unpublished pilot data, we have established the feasibility of robotic library production, custom pull-down, and multiplexed sequencing of barcoded libraries for 100 known myeloid cancer genes across 760 myelodysplasia samples. Highlights of the data thus far analysed reveal that the coverage is remarkably even between samples; when 96 samples are run, average coverage per lane of sequencing is ~250, with 90-95% of targeted exons covered by >25 reads; known mutations can be discovered in the data set; and the protocol is amenable to whole genome amplified DNA. The bioinformatic algorithms for identification of substitutions and indels in pull-down data are well-established; we have pilot data proving that copy number changes, LOH and genomic rearrangements in specific regions of interest can also be identified by tiling of baits across the relevant loci. Proposal We propose to apply this methodology to 10000 samples from patients with AML enrolled in clinical trials over the last 10-20 years. Oncogenic point mutations and potentially genomic rearrangements will be identified, and linked to clinical outcome data, with a view to undertaking the following sorts of analyses: • Identification of co-occurrence, mutual exclusivity and clusters of driver mutations. • Correlation of prognosis with driver mutations and potentially gene-gene interactions • Exploration of genomic markers of drug response Ultimately, we would like to be in a position to release the mutation data together with matched clinical outcome data to genuine medical researchers via a controlled access approach, possibly within the COSMIC framework (www.sanger.ac.uk/genetics/CGP/cosmic/). The vision here is to generate a portal whereby a clinician faced with an AML patient and his / her mutational profile can obtain a ‘personalised’ prediction of outcome, together with a fair assessment of the uncertainty of the estimate. With a sufficient sample size, there would also be the potential to develop decision support algorithms for therapeutic choices based on such data.

  Study EGAS00001000408

• LEF1 knockdown effects on human T cell transcriptome and chromatin accessibility profiles.

  LEF1 (Lymphoid Enhancer-Binding Factor 1) is a key transcription factor in T cell development and function, and its dysregulation has been implicated in various immune-related disorders. This study aimed to comprehensively characterize the transcriptional and epigenetic changes induced by LEF1 knockdown in human T cells. CD3+ T cells isolated from three healthy donors were transfected with either LEF1-specific siRNA or control siRNA, followed by activation with CD3/CD28 Dynabeads and culture in IL-2-containing media. Cells were harvested at 24, 48 and 72 hours post-transfection for multi-omics analysis including bulk RNA-seq, bulk ATAC-seq, single-cell CITE-seq (For CITE-seq, 48 and 72 hours only). This dataset provides insights into LEF1-dependent gene regulatory networks and chromatin accessibility patterns in activated human T cells, contributing to our understanding of T cell biology and potential therapeutic targets. This dataset is part of a comprehensive study investigating functional roles of risk polymorphisms in autoimmune diseases, particularly focusing on the rs58107865 variant at the LEF1 locus.

  Study JGAS000818

• RNA-seq of whole blood and PBMC samples from immunotherapy treated NSCLC patients

  This dataset contains 228 paired fastq files sequenced with Illumina Novaseq 6000, and the file with the sample and clinical data.

  Dataset EGAD50000000389

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• RNA sequencing of periprostatic fat after a 6 month deep androgen deprivation therapy

  Androgen deprivation therapy treated patients (n=11) were recruited from an open label neoadjuvant phase II study in which patients with high-risk disease received a ‘supercastration’ regimen consisting of degarelix 240/80 mg subcutaneously every four weeks; abiraterone acetate 500 mg orally daily titrating upwards every two weeks by 250 mg to a final dose of 1000 mg daily; bicalutamide 50 mg orally daily; and prednisolone 5 mg orally twice daily for a total of 6 months (Australian New Zealand Clinical Trials Registry 12612000772842). Untreated patients with similar pre-treatment characteristics were obtained from a prospective prostatectomy biorepository22,23. Prior to ligation of the dorsal venous complex and prostate pedicles, the anterior prostate was defatted and the specimen was removed immediately, placed in a sterile container and transferred on ice for long-term storage in the vapour phase of liquid nitrogen. A total of 50–100 µg of adipose tissue was separated from fresh frozen samples stored at −160°C. RNA was isolated using the Qiagen RNeasy Lipid Tissue Mini Kit and eluted in 35 µL nuclease-free water. 0.5–1 µg of total RNA was used as the input for cDNA library synthesis using TruSeq RNA Sample Prep Kit v2 (Illumina), and libraries were constructed according to manufacturer’s instructions. Samples were sequenced on a HiSeq 2500 (Illumina) using 101 base paired-end chemistry, aiming for 50 million mapped paired-end reads per sample.

  Dataset EGAD00001004971

• scRNA-seq of HSPC treated with gemcitabine and carboplatin

  4 samples of 2000000 HSPCs in 2 ml media each were then prepared and treated for 24 hours: carboplatin-high: 150 µg/ml carboplatin carboplatin-low: 18.75 µg/ml carboplatin gemcitabine: 25 ng/ml gemcitabine control: no drug Single-cells were subsequently extracted using the ddSEQ™ Single-Cell Isolator (Bio-Rad) and later sequenced using the SureCell™ Whole Transcriptome Analysis 3' Library Prep Kit (Illumina) on the NextSeq 500 System (Illumina) using the NextSeq 500/550 High Output Kit v2.5 150 Cycles (Illumina) all following the manufacturer's instructions. The raw FASTQ-files are available as read 1 and read 2 files from 4 lanes for each sample giving a total of 16 FASTQ-files. The FASTQ-files were also processed following the ddSeeker (Romagnoli, D., et al., BMC Genomics 2018, doi:10.1186/s12864-018-5249-x) and Drop-seq (Macosko, E.Z., et al., Cell 2015, doi:10.1016/j.cell.2015.05.002) protocols for processing scRNA-seq data to yield the final digital gene expression (dge) for each cell of each sample. This has resulted in one dge text file and one dge summary text file per sample. These 8 text-files with dge data are found in the zip-compressed analysis data-file.

  Dataset EGAD00001006080

• Mapping genetic effects on cell type-specific chromatin accessibility using single nucleus ATAC-seq

  Gene regulation is highly cell type-specific and understanding the function of non-coding genetic variants associated with complex traits requires molecular phenotyping at cell type resolution. In this study we performed single nucleus ATAC-seq (snATAC-seq) and genotyping in peripheral blood mononuclear cells from 13 individuals. We mapped chromatin accessibility QTLs (caQTLs) in each immune cell type and sub-type in a subset of 10 samples of European genetic ancestry.

  Study EGAS00001006184

• Effects of 2DG, Galactose, or Oligomycin on the epigenome remodeling induce by T cells activation.

  T cell activation is known to require a metabolic shift towards glycolysis, triggered by TCR-engagement . To substantiate the role of glycolysis in transcriptional reprogramming during antigen-driven T cell activation, we utilized a well-established ex-vivo model to recapitulate the process of antigen stimulation without the requirement for additional antigen-presenting cells . We initially explored and validated the conditions for both metabolic and epigenetic reprogramming. Antigen-mediated CD4+ T cells activation initiates context-specific gene-expression programs that drive effector functions and cell fates through changes in the epigenetic landscape . To evaluate global changes in histone modifications, we isolated CD4+ T cells from peripheral blood (PB) of healthy control (HC) human donors and either maintained them in resting conditions or stimulated with anti-CD3/CD28 for 24h. Rapid changes in the CD4+ epigenome and transcriptome were observed within 24h as measured by RNA-sequencing (RNA-seq) and H3K27ac chromatin immunoprecipitation followed by DNA-sequencing (ChIP-seq).To explore the requirement for metabolic reprogramming in regulating transcriptional responses after initial TCR engagement, CD4+ T cells from PB of healthy donors were isolated and activated in either the presence or absence of oligomycin (inhibitor of ATP synthase blocking the production of ATP by OXPHOS), 2-deoxyglucose (2DG; competitively inhibiting production of glucose-6-phosphate from glucose), or replacement of glucose with galactose. Galactose is metabolized through glycolysis, utilizing the Leloir pathway which is energy neutral, forcing cells to use all the pyruvate production to sustain the TCA cycle for OXPHOS and ATP synthesis at the expense of lactate production. Employing ChIP-seq and RNA-seq, inhibition of OXPHOS-mediated ATP production by oligomycin had only a limited effect on H3K27-acetylation or activation-induced transcription during the first 24h of activation. In contrast, inhibition of glycolysis by 2DG treatment compromised both H3K27-acetylation and transcriptional changes. However, under conditions of galactose-metabolism where lactate production is abrogated, activated CD4+ T cells were still able to globally remodel H3K27 acetylation and reprogram the transcriptome.

  Study EGAS00001007115

• Mechanism of Decitabine response in MDS/AML patients

  The dataset includes single cell RNA sequencing data from 17 AML/MDS patients undergoing a decitabine clinical trial. In total 47 samples were interrogated using 10X genomics ChromiumTM 140 Single Cell 5' Reagent Kit. The dataset includes bam files for each sample generated using CellRanger with default parameters.

  Dataset EGAD50000001354