15041 results for "cancer studies using rna-seq"

in 108.78 milliseconds.

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• Genes and Blood Clotting Study (GABC)

  Objectives: Use genome-wide approaches to identify genetic variants that influence common thrombosis and hemostasis factors, as well as selected common human traits. Design/Methods: The GABC study was a prospective sibling cohort design. Siblings were recruited by targeted email to the undergraduate and graduate student email lists at the University of Michigan. Healthy persons between 14 and 35 years old who had healthy siblings within the same age restriction were able to participate. Study participants agreed to an online informed consent and subsequently completed a 52-question online survey describing their specific bleeding traits as well as many common human traits. Fifty milliliters of blood was collected into a citrate-dextrose solution (ACD) from each participant. An aliquot of whole blood was used for an automated complete blood count analysis and the remainder was processed into platelet poor plasma and buffy coat portions. Plasma and buffy coat aliquots were snap frozen and stored in liquid nitrogen for future studies. 1189 individuals representing 507 sibships were collected between 06/26/2006 and 01/30/2009. Phenotyping Survey Details: To characterize individual bruising and bleeding history, the online survey recorded answers to questions based on a modified von Willebrand Disease (VWD) screening questionnaire. To characterize a collection of participant's common human traits, the survey recorded answers to questions about height, weight, presence of skin tags, history of acne, eye color, hair color, hair line characteristics, skin sunburn sensitivity, skin tanning ability, natural skin color, freckling, cheek dimpling, earlobe shape, shoe size, foot arch characteristics, hand fifth digit morphology, history of dyslexia, history of migraine headaches, history of seasonal allergies, history of apthous ulcers, tendency to sneeze while walking into a bright sunny place, history of dental caries, need for corrective eye lenses, handedness and like or dislike of strongly flavored foods. Biochemical phenotyping: Assays for plasma Von Willebrand Factor (VWF) antigen were performed using ELISA and "Alphalisa" techniques. Automated complete blood count analysis was performed on a Bayer Advia 120 on all participants (including WBC differential, RBC indices, and platelet count.) For the dbGaP v2 update, new biochemical phenotypes have been submitted and include von Willebrand Factor, von Willebrand Factor propeptide, plasminogen, gamma prime fibrinogen, ADAMTS 13, antithrombin III, protein C, and protein S. All new phenotypes were obtained using "Alphalisa" techniques. Genotyping Details: SNP genotyping was performed using genomic DNA extracted from peripheral blood at the Broad Institute, (MIT/Harvard). Genotyping was performed on the Illumina Omni-1 quad chip at the Broad Institute. For the dbGaP v2 update, genotyping data from the Illumina Human Exome was deposited. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to blood clotting through large-scale genome-wide association studies of siblings. Genotyping was performed at the Broad Institute of MIT and Harvard, a GENEVA genotyping center. Data cleaning and harmonization was performed by the primary investigators at the University of Michigan, Ann Arbor, and at the GEI-funded GENEVA Coordinating Center at the University of Washington. This study serves as a resource for investigators who are interested in the genetic determinants of specific plasma proteins in a healthy population. The sibling cohort design allows for linkage analysis in addition to association studies. Analysis of thrombosis and hemostasis related traits should help elucidate specific biochemical and genetic networks that maintain hemostasis. We hope to identify specific genetic determinants of VWF levels in order to better understand the factors that influence the development of VWD.

  Study phs000304

• Somatic cancer gene mutation screening

  Sequencing of colorectal tumors and normal tissue using Ion AmpliSeq Cancer Hotspot Panel V2

  Dataset EGAD00001001010

• CALGB 40601: Randomized Phase III Trial of Paclitaxel Combined With Trastuzumab, Lapatinib, or Both As Neoadjuvant Treatment of HER2-Positive Primary Breast Cancer

  This randomized phase III trial studies paclitaxel and trastuzumab with or without lapatinib to see how well they work in treating patients with stage II or stage III breast cancer that can be removed by surgery. Drugs used in chemotherapy, such as paclitaxel, work in different ways to stop the growth of tumor cells, either by killing the cells, by stopping them from dividing, or by stopping them from spreading. Monoclonal antibodies, such as trastuzumab, can block tumor growth in different ways. Some block the ability of tumor cells to grow and spread. Others find tumor cells and help kill them or carry tumor-killing substances to them. Lapatinib may stop the growth of tumor cells by blocking some of the enzymes needed for cell growth. Giving paclitaxel with trastuzumab and/or lapatinib before surgery may make the tumor smaller and reduce the amount of normal tissue that needs to be removed. It is not yet known which regimen is more effective in treating patients with breast cancer.

  Study phs001570

• Cell-free DNA TAPS for early cancer detection

  Multimodal, genome-wide characterization of epigenetic and genetic information in circulating cell-free DNA (cfDNA) could enable more sensitive early cancer detection. However, due to technological challenges associated with DNA methylation sequencing in low input cfDNA samples, most studies have been limited by DNA damage caused by bisulfite sequencing, or the qualitative nature of enrichment-based sequencing. Recently, we developed TET-assisted Pyridine Borane Sequencing (TAPS), which is a mild, bisulfite-free method for base-resolution direct DNA methylation sequencing. Here we optimized TAPS for cfDNA (cfTAPS) to provide high-quality and high-depth whole-genome cell-free methylomes. We applied cfTAPS to 85 cfDNA samples from patients with hepatocellular carcinoma (HCC) or pancreatic ductal adenocarcinoma (PDAC) and non-cancer controls. From just 10 ng cfDNA (1-3 mL of plasma), we generated the most comprehensive cfDNA methylome to date. We demonstrated that cfTAPS provides multimodal information about cfDNA characteristics, including DNA methylation, tissue of origin, and DNA fragmentation. Integrated analysis of these epigenetic and genetic features enables accurate identification of early HCC and PDAC.

  Study EGAS00001004962

• RNASeq profiles from Indian HFrEF Cohort

  The dataset contains whole transcriptomics profiling from a cohort of 49 HFrEF patients. The myocardium samples were collected from these patients during heart transplant of LVAD implantation procedure. The RNA samples were collected in RNAlater. Total transcriptome libraries were prepared using TruSeq Stranded Total RNA Library Prep with Ribo-Zero Gold kit and sequenced on Illumina HiSeq4000.

  Dataset EGAD50000001196

• Integration of T Cell Repertoire, CyTOF, genotyping and symptomatology data reveals subphenotypic variability in COVID-19 Patients

  A total of 61 patients (33 mild and 28 severe) with a median age of 51 years who recovered from COVID-19 were included in this study (Table 1). All collected samples were confirmed in diagnosis of COVID-19 by RT-PCR and positive IgG serolog. For the 61 patients, TCR-seq, CyTOF, and genotyping data were generated and analyzed in separate studies, as part of larger cohorts. In total, there are 143 variables, with 129 being quantitative (TCRseq and CyTOF metrics) and 13 being qualitative (symptomatology and genotyping). For more information about cohort characteristics, data adquisition an pre-processing, please visit PMID: 39227859, 36969980 and 37287057.

  Dataset EGAD50000000840

• The Landscape of Antisense Gene Expression in Human Cancers

  High throughput RNA Sequencing has revealed that the human genome is widely transcribed. However, the extent of natural antisense transcription, the molecular mechanisms by which natural antisense transcripts (NATs) might affect their cognate sense genes, and the role of NATs in cancer are less well understood. Here, we use strand-specific paired-end RNA sequencing (ssRNASeq) on a cohort of 376 cancer patients covering 9 tissue types to comprehensively characterize the landscape of antisense expression. Our results reveal that greater than 60% of annotated transcripts have measureable antisense expression and the expression of sense and antisense transcript pairs is in general positively correlated. Furthermore, by studying the expression of sense/antisense pairs across tissues we identify lineage-specific, ubiquitous and cancer-specific antisense loci. Our results raise the possibility that NATs participate in the regulation of well-known tumor suppressors and oncogenes. Finally, this study provides a catalogue of cancer related genes with significant antisense transcription (oncoNAT). This resource will allow researchers to investigate the molecular mechanisms of sense/antisense regulation and further advance our understanding of their role in cancer.

  Study phs000937

• National Human Genome Research Institute Tumor Sequencing Project (TSP) - Lung Adenocarcinoma

  The Tumor Sequencing Project (TSP) Consortium is a collaboration among participants at the Baylor College of Medicine Human Genome Sequencing Center, the Broad Institute Genome Sequencing Platform, the Dana Farber Cancer Institute, the Memorial Sloan-Kettering Cancer Center, the Genome Sequencing Center and Siteman Cancer Center at Washington University, the M.D. Anderson Cancer Center and the University of Michigan Medical Center. The TSP Part A will pilot approaches to large-scale identification of genomic changes in tumors by sequencing the exonic regions of 623 genes in 188 specimens of adenocarcinoma of the lung, as well as using high density SNP genotyping arrays for high resolution identification of changes in chromosomal copy number. The TSP Part B will pilot approaches to tumor characterization of lung adenocarcinoma samples using next-generation sequencing technologies and benchmark those results against Part A data generated with ABI3730 instruments.

  Study phs000144

• Profiling of 27 type 2 diabetes GWAS loci using next-generation (NG) capture C in a human beta-cell model

  Most type 2 diabetes association signals are due to variants that impact gene regulation but identifying the genes they impact is challenging. We generated interaction profiles at 27 T2D GWAS loci using next-generation (NG) capture C (6 replicates) in the human beta-cell model, EndoC-betaH1, along with chromatin accessibility profiling using ATAC-Seq (9 replicates).

  Dataset EGAD00001008655

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K36me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001231

• Fastq data for ChIP-Seq (H3K27ac) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27ac) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001403

• ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001233

• Fastq data for ChIP-Seq (Input) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (Input) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001409

• ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K4me1) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001232

• ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K9me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001234

• ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27ac) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001229

• Fastq data for ChIP-Seq (H3K4me1) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me1) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001406

• ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (H3K27me3) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001230

• Fastq data for ChIP-Seq (H3K27me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K27me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001404

• Fastq data for ChIP-Seq (H3K9me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K9me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001408

• Fastq data for ChIP-Seq (H3K36me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K36me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001405

• Fastq data for ChIP-Seq (H3K4me3) assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for ChIP-Seq (H3K4me3) assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001407

• March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  March 2016 update of smRNA-Seq assays data (bam/fastq) for reference epigenomes generated at Centre for Epigenome Mapping Technologies (Canadian Epigenetics, Environment and Health Research Consortium), Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001959

• Clonal_expansion_of_mutated_cell_population_in_bladder_urothelium_

  1cm biospies of from patients undergoing bladder cystectomy will be collected. The underlying muscle and stroma will be removed and the remaining epithelia dissected into small sequential areas which will be sent for ultra-deep exome sequencing using a panel of known cancer and viral genes. Sequence analysis using similar methods to Martincorena I et al (Science 2015, 348:880) will provide an idea of the somatic mutational landscape in these patient samples. Individual patient muscle samples will also be sequenced as a reference.

  Study EGAS00001001687

• TK-EPN862 - Patient-dervied xenograft model of Posterior Fossa A Ependymoma - RNAseq

  Ependymomas (EPN) are the third most common malignant brain cancer in children. Treatment strategies for pediatric EPN have remained unchanged over recent decades, with 10-year survival rates stagnating at just 67% for children aged 0-14 years. Moreover, patients who survive treatment for the most common subtype of pediatric EPN (posterior fossa A (PFA)), often suffer long-term neurological side effects as a result of therapy. It is evident that there is a need for safer, more effective treatments for pediatric EPN patients. There are ten distinct subgroups of EPN, each with their own molecular and prognostic features. To identify and facilitate the testing of new treatments for EPN, in vivo laboratory models representative of the diverse molecular subtypes are required. Here, we describe the establishment of a patient-derived orthotopic xenograft (PDOX) model of PFA EPN, derived from a metastatic cranial lesion. Patient and PDOX tumors were analyzed using immunohistochemistry, DNA methylation profiling, whole genome sequencing (WGS) and RNA sequencing. Both patient and PDOX tumors classified as PFA EPN by methylation profiling, and shared similar histological features consistent with this molecular subgroup. RNA sequencing revealed that gene expression patterns were maintained across the primary and metastatic tumors, as well as the PDOX. Copy number profiling revealed gains of chromosomes 7, 8 and 19, and loss of chromosomes 2q and 6q in the PDOX and matched patient tumor. No clinically significant single nucleotide variants were identified, consistent with the low mutation rates observed in PFA EPN. Overexpression of EZHIP RNA and protein, a common feature of PFA EPN, was also observed. Despite the aggressive nature of the tumor in the patient, this PDOX was unable to be maintained past two passages in vivo. Others who have successfully developed PDOX models report some of the lowest success rates for EPN compared to other pediatric brain cancer types attempted, with loss of tumorigenicity not uncommon, highlighting the challenge in propagating these tumors in the laboratory. Here, we discuss our collective experiences with PFA EPN PDOX model generation and propose potential approaches to improve future success in establishing preclinical EPN models

  Study EGAS00001006844

• Gene-Environment Interactions in COCCaINE Use Disorder: Collaborative Case-Control Initiative in Cocaine Addiction

  Drug addiction is a phenotype that has high heritability estimates. In recent years, association studies of candidate genes and some genome-wide association studies (GWAS) have identified a large number of SNPs associated with substance use, abuse or dependence, particularly in phenotypes related to alcohol and nicotine use. Regarding snorted or smoked cocaine dependency, only one GWAS has been conducted so far. In addition, genetic association studies that specifically evaluated smoked cocaine dependence (e.g. crack) are rare, because of characteristics related to the route of administration and duration of the effect of the drug. Thus, the main aim of this GWAS was to identify genetic variations that modulate the risk for the cocaine dependence.

  Study phs001810

• Neurogenetic Investigations of Obsessive-Compulsive Disorder

  Obsessive-compulsive disorder (OCD) is a disabling early-onset neuropsychiatric disorder with a clear genetic contribution to risk but unclear underlying pathophysiology, which has hindered the development of new treatments and interventions. This study uses high-throughput sequencing approaches to identify OCD risk genes, detect gene expression differences in OCD, and determine epigenetic signatures driving gene expression in OCD brain. These studies will improve our understanding of the underlying mechanisms of OCD and identify points of traction for mechanistic studies in model systems, ultimately leading to novel therapeutics, and reducing the significant morbidity and mortality associated with this disabling illness. Furthermore, insights gained in these studies can inform gene discovery approaches to other complex neuropsychiatric disorders.

  Study phs001929

• Sweden-Schizophrenia Population-Based Case-Control Exome Sequencing

  Current findings of the genetic risk of schizophrenia and bipolar disorder emerging from genome wide association studies (GWAS) support a highly polygenic model displaying the full spectrum of causal alleles that includes the extremes of rare, penetrant alleles as well as common alleles of small effect. Lower frequency polymorphism, rare variants and private mutations have eluded measurement by GWAS studies and thus association with disease. In order to create a comprehensive catalogue of low frequency or rare coding variation in individuals with psychiatric disease and to build a foundation for future genetic studies of schizophrenia and bipolar disorder, we have obtained whole exome DNA sequence from a population-based schizophrenia and bipolar disorder Swedish case-control cohort.

  Study phs000473

• WGS of high grade serous ovarian tumours and matched blood normals

  FASTQ reads for 81 matched tumour-normal WGS pairs for high grade serous ovarian cancer patients. Scottish HGSOC samples were collected via local Bioresource facilities at Edinburgh, Glasgow, Dundee and Aberdeen and stored in liquid Nitrogen until required. HGSOC patients were determined from pathology records and were included in the study where there was matched tumour and whole blood samples. Tumour samples were divided into two for DNA and RNA extraction and slivers of tissue were taken, fixed in formalin and embedded in paraffin wax (FFPE). Samples were only included if they were confirmed as HGSOC and there was greater than 40% tumour cellularity throughout the tumour, determined using H&E staining of the FFPE sections and pathology review. Somatic DNA was extracted from the tumour and germline DNA was extracted from whole blood. Somatic DNA was extracted using the Qiagen DNeasy Blood and tissue kit (cat no 69504). The tissue was initially homogenised using a Qiagen Bioruptor, followed by the manufacturers recommended protocol (including RNase digestion step). Germline DNA was extracted from 1-3ml whole blood using the Qiagen FlexiGene kit (cat no 51206) following the manufacturers recommended protocol. The resulting DNA underwent quality control as follows: firstly, A260 and A280nm were measured on a Denovix DS-11 Fx to qualitatively illustrate A260/280nm and A260/230nm ratios as surrogate measures of DNA purity. A260/280 had to be 1.8 or greater and A260/230 had to be 2.0 or greater. Then, DNA was quantified using LifeTechnologies Qubit dsDNA BR kit (cat no Q32850) and we required a minimum of 50ul at 25ng/ul for WGS. Thirdly, DNA was diluted to 25ng/ul and a representative sample was loaded onto a 0.8% TAE gel, ran at 100v for 60mins and then imaged using a BioRad ChemiDoc imaging system to visualise the DNA quality.

  Dataset EGAD00001009049

• WGS of high grade serous ovarian tumours and matched blood normals

  FASTQ reads for 34 matched tumour-normal WGS pairs for high grade serous ovarian cancer patients. Scottish HGSOC samples were collected via local Bioresource facilities at Edinburgh, Glasgow, Dundee and Aberdeen and stored in liquid Nitrogen until required. HGSOC patients were determined from pathology records and were included in the study where there was matched tumour and whole blood samples. Tumour samples were divided into two for DNA and RNA extraction and slivers of tissue were taken, fixed in formalin and embedded in paraffin wax (FFPE). Samples were only included if they were confirmed as HGSOC and there was greater than 40% tumour cellularity throughout the tumour, determined using H&sE staining of the FFPE sections and pathology review. Somatic DNA was extracted from the tumour and germline DNA was extracted from whole blood. Somatic DNA was extracted using the Qiagen DNeasy Blood and tissue kit (cat no 69504). The tissue was initially homogenised using a Qiagen Bioruptor, followed by the manufacturers recommended protocol (including RNase digestion step). Germline DNA was extracted from 1-3ml whole blood using the Qiagen FlexiGene kit (cat no 51206) following the manufacturers recommended protocol. The resulting DNA underwent quality control as follows: firstly, A260 and A280nm were measured on a Denovix DS-11 Fx to qualitatively illustrate A260/280nm and A260/230nm ratios as surrogate measures of DNA purity. A260/280 had to be 1.8 or greater and A260/230 had to be 2.0 or greater. Then, DNA was quantified using LifeTechnologies Qubit dsDNA BR kit (cat no Q32850) and we required a minimum of 50ul at 25ng/ul for WGS. Thirdly, DNA was diluted to 25ng/ul and a representative sample was loaded onto a 0.8% TAE gel, ran at 100v for 60mins and then imaged using a BioRad ChemiDoc imaging system to visualise the DNA quality.

  Dataset EGAD00001010135

• Expression Quantitative Trait Locus Mapping Studies in Mid-Secretory Phase Endometrial Cells Identifies HLA-F and TAP2 as Fecundability-Associated Genes

  We performed an unbiased genome-wide expression quantitative trait locus (eQTL) mapping study to identify common regulatory (expression) single nucleotide polymorphisms (eSNPs) in mid-secretory endometrium, corresponding to the luteal phase of the ovarian cycle. Biopsies were collected from 58 women with two or more early pregnancy losses and 53 of these samples passed all quality control. RNA was extracted from endometrial biopsies and DNA was extracted for sequencing from blood. Gene expression data can be found at NCBI GEO Series GSE77688.

  Study phs001146

• Collagen Proteostasis in Health and Disease

  This study uses human iPSC-derived cartilage to investigate the effects of the p.Arg719Cys mutation in the COL2A1 gene, which is linked to precocious osteoarthritis. Using a CRISPR-edited isogenic cell line pair, we compared wild-type and mutant cartilage for matrix defects and cellular stress responses. We performed RNA-sequencing and quantitative proteomics to characterize changes in gene expression, protein interactions, and collagen folding.

  Study phs004112

• Bulk RNAseq FASTQ files of three PDAC organoid lines treated with LGK974 or DMSO for 24h

  This dataset contains raw FASTQ files from bulk RNA sequencing of three patient-derived pancreatic ductal adenocarcinoma (PDAC) organoid lines (P28, P40, P47). Each organoid line was treated with either the WNT secretion inhibitor LGK974 or DMSO for 24 hours, with three biological replicates per treatment condition. RNA was extracted using the Qiagen QiaSymphony SP system, and libraries were prepared with the Illumina Truseq stranded polyA kit. Sequencing was performed on an Illumina NextSeq2000 platform using single-end 50bp reads. Quality control was conducted with FastQC, and reads were trimmed with TrimGalore as appropriate. Data are controlled-access and intended for transcriptomic analysis of WNT pathway perturbation in PDAC organoid models.

  Dataset EGAD50000002219

• Single-cell multi-omics reveals clonal evolution and T-cell dynamics underlying differential responses to ibrutinib in Waldenström macroglobulinemia.

  To elucidate the molecular basis underlying differential response and resistance to ibrutinib in Waldenström’s macroglobulinemia (WM), we conducted a prospective phase II trial (NCT02604511) of ibrutinib monotherapy in treatment-naïve patients. Seventy-four sequential bone marrow (BM) aspirates from 17 patients, collected from baseline through 48 treatment cycles, were profiled using single-cell RNA and V(D)J sequencing.

  Study EGAS50000001596

• Capture Hi-C on Hodgkin lymphoma cell line L-428

  In situ promoter capture Hi-C on Hodgkin lymphoma cell line L-428 in experimental triplicates. Hi-C libraries were prepared as previously described (Orlando et al., 2018, https://currentprotocols.onlinelibrary.wiley.com/doi/pdf/10.1002/cphg.63). Promoter capture was based on 32,313 biotinylated 120-mer RNA baits (Agilent). Hi-C libraries were sequenced using Illumina HiSeq 2000 technology. The files are in FASTQ format.

  Study EGAS00001003032

• A comprehensive assessment of somatic mutation detection in cancer using whole genome sequencing

  As whole genome sequencing for cancer genome analysis becomes a clinical tool, a full understanding of the variables affecting sequencing analysis output is required. Using tumor-normal sample pairs from two different types of cancer, chronic lymphocytic leukemia and medulloblastoma, we conducted a benchmarking exercise within the context of the International Cancer Genome Consortium. We compare sequencing methods, analysis pipelines, and even validation methods. Here we show that using PCR-free methods and increasing sequencing depth to ~100x showed benefits, as long as the tumor:control coverage ratio remains balanced. We observe widely varying mutation call rates and low concordance among analysis pipelines, reflecting the artifact-prone nature of the raw data and lack of standards for dealing with the artifacts. However, armed with the benchmark mutation set we have created, we show that many issues are in fact easy to remedy and have an immediate positive impact on mutation detection accuracy.

  Study EGAS00001001539

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• DNA-seq BAM files from 16 patients affected by acute intermittent porphyria

  Paired-end BAM files from 16 patients affected by acute intermittent porphyria. Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001006951

• Genomic data used in "ACT-Discover: identifying karyotype heterogeneity in pancreatic cancer evolution using ctDNA"

  Genomic data used in "ACT-Discover: identifying karyotype heterogeneity in pancreatic cancer evolution using ctDNA"

  Dataset EGAD00001010250

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• Whole-Exome Sequencing and Targeted DNA Sequencing of Matched Ocular Melanocytosis and Uveal Melanoma

  Ocular melanocytosis is the most important predisposing condition for the eye cancer uveal melanoma (UM). Here we used whole-exome and deep targeted sequencing to identify for the first time a clonal Gq pathway mutation in ocular melanocytosis, which gave rise to UM. Additionally, we elucidated the order in which canonical genetic aberrations were acquired during tumor evolution. These findings provide a mechanistic explanation for the well-known clinical association of ocular melanocytosis with UM, and they provide new insights into UM tumor evolution. Reprinted from: Durante MA, Field MG, Sanchez MI, Covington KR, Decatur CL, Dubovy SR, Harbour JW. Genomic evolution of uveal melanoma arising in ocular melanocytosis, with permission from Cold Spring Harbor Molecular Case Studies.

  Study phs001835

• Genomic characterization of esophageal squamous cell carcinoma reveals critical genes underlying tumorigenesis and poor prognosis

  The genetic mechanisms underlying the poor prognosis of esophageal squamous cell carcinoma (ESCC) are not well understood. In this study, we comprehensively characterized somatic mutations, copy number alterations (SCNAs)/structural variants (SVs) found in ESCC from sequencing 10 whole-genome and 57 whole-exome matched tumor-normal pairs. We identified multiple somatic mutations seen previously in known cancer pathways and identified candidate genes for ESCC including VANGL1 and MIR4707. A survival analysis based on the expression profiles of 321 ESCC individuals indicated that the somatically altered genes we found were significantly associated with ESCC poorer survival. Subsequently, we performed functional studies to validate the roles of the altered genes in tumor proliferation and metastasis.

  Study EGAS00001001723

• Identification of responsible genes and development of standardized medicine for familial breast cancer by genetic analysis with NGS technology

  Aims: To clarify risk of germline variants of known causal genes for Hereditary Breast Ovarian Cancer Syndrome in Japan by combinatorial analysis of somatic and germline variants in the breast cancer tissue. Methods: Target caputure analysis by using Illumina HiSeq 2000; the panel genes are 119 genes including 30 HBOC known causal genes. Participants/Materials: 108 whole blood and 124 primary tumor samples from familial breast cancer patients.

  Study JGAS000224

• Whole-Exome Sequencing analyses in tamoxifen-associated endometrial cancer

  An increased incidence of endometrial cancer has been described for patients that have received tamoxifen to treat breast cancer. Using samples from endometrial tumors, isolated from surgivcal specimens of patients who previously received tamoxifen treatment for breast cancer, we aimed to identify whether there are specific somatic mutations enriched in this population, relative to endometrial tumors from the general population. For this, WES was performed on matched endometrial tumors and healthy tissue (n=21).

  Study EGAS00001006453

• RNAseq samples of patients with anti-PD-1 resistant HNSCC from a non-randomized, open-label phase 1b clinical trial

  Immune checkpoint blockade (ICB) is an effective treatment for a subset of patients with head and neck squamous cell carcinoma (HNSCC); however, the majority remain refractory. In a nonrandomized, open-label Phase 1b clinical trial, participants with recurrent and/or metastatic (R/M) HNSCC who had progressed on ICB were treated with low-dose 5-azacytidine (5-aza) daily for either 5 or 10 days, in combination with durvalumab and tremelimumab. The primary objective was to determine the biologically effective dose of 5-aza. In this study, RNA sequencing (RNA-seq) was performed on baseline and on-treatment samples from eight participants, and transcriptomic changes were analyzed to assess the impact of low-dose 5-aza treatment.

  Study EGAS50000000728

• PCa-LINES

  PCa-LINES: Ribo-minus RNA-seq of 4 patient samples and 2 PCa cell lines ---- Detection of fusion transcripts and their genomic breakpoints from RNA sequencing data Youri Hoogstrate, Malgorzata A. Komor, René Böttcher, Job van Riet, Harmen J. G. van de Werken, Stef van Lieshout, Ralf Hoffmann, Evert van den Broek, Anne S. Bolijn, Natasja Dits, Daoud Sie, David van der Meer, Floor Pepers, Chris H. Bangma, Geert J. L. H. van Leenders, Marcel Smid, Pim French, John W.M. Martens, Wilbert van Workum, Peter J. van der Spek, Bart Janssen, Eric Caldenhoven, Christian Rausch, Mark de Jong, Andrew P. Stubbs, Gerrit A. Meijer, Remond J.A. Fijneman, Guido Jenster bioRxiv 2021.05.17.441778; doi: https://doi.org/10.1101/2021.05.17.441778 https://www.biorxiv.org/content/10.1101/2021.05.17.441778v1

  Study EGAS00001004613

• Intraductal transplantation models of human pancreatic ductal adenocarcinoma reveal progressive transition of molecular subtypes

  Pancreatic ductal adenocarcinoma (PDAC) is the most lethal common malignancy, with little improvement in patient outcomes over the past few decades. Recently, subtypes of pancreatic cancer with different prognoses have been elaborated. However, the inability to model these subtypes has precluded mechanistic investigation of their origins. Here, we present an orthotopic xenotransplantation model of human patient-derived PDAC organoids in which organoids are grafted via direct injection into the pancreatic duct of immunocompromised (NSG) mice. Tumors that arise from these intraductally grafted organoids (IGOs) enable the distinction of the two main PDAC subtypes: intraepithelial neoplasms from this model progress in an indolent or invasive manner representing the classical or basal-like subtypes of PDAC, respectively, depending on which organoid they originate from. RNA-sequencing was used to characterize the tumors that resulted from IGO xenografts, and to compare the fast- and slow-progressing IGO tumors. Tumors generated using a traditional orthotopic xenograft model, in which organoids are injected into the parenchyma of the pancreas (i.e. orthotopically grafted organoids, or OGOs), were also sequenced for comparison with the IGO tumors. To further characterize the model, laser-capture microdissection followed by RNA-sequencing was used to compare intraductal to invasive lesions resulting from IGOs. To better understand the connection between KRAS signaling and the fast-progressing phenotype, RNA-sequencing was used to compare cultured organoids in which oncogenic KRAS (GeneID: 3845) was hyperactivated to control organoids, and to compare laser-capture microdissected lesions derived from IGOs of KRAS-hyperactivated organoids to lesions derived from control organoids. To ascertain copy number, low-coverage, whole genome DNA-sequencing was performed on organoids cultured in vitro, and on laser-capture microdissected lesions derived from IGO tumors.

  Study phs002045

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Genomic alterations in MM - CEL

  RNA from the same tumor sample (n=98) was also processed using the 3' IVT kit (Affymetrix) and hybridized to U133 Plus 2.0 arrays (Affymetrix).

  Dataset EGAD00010001577

• Single-cell RNA-sequencing of H3-K27M diffuse midline glioma.

  Fastq files are deposited for single-cell transcriptomes of patient H3-K27M diffuse midline gliomas, generated using the SMART-seq2 method.

  Dataset EGAD00001011339

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• 5' Single cell RNA sequencing of pre-treatment tissues from lung cancer patients receiving immunotherapy

  Study EGAS00001006188

• Fresh vs. frozen cell preparations of colorectal cancer single-cell RNA sequencing

  Study EGAS00001003769

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• Development and Use of Network Infrastructure for High-Throughput GWA Studies

  The "Development and Use of Network Infrastructure for High-Throughput GWA Studies" project is collaboration between Group Health Cooperative (GH), the University of Washington (UW), and the Fred Hutchinson Cancer Research Center (FHCRC). It is one of 5 sites participating in The Electronic Medical Records and Genomics (eMERGE) Network funded by the National Human Genome Research Institute (NHGRI) with additional funding from the National Institute of General Medical Sciences (NIGMS). The overall eMERGE project is designed to assess whether linking biorepositories of patients in healthcare delivery systems with electronic medical records (EMRs) is an efficient strategy for high-throughput genome wide association (GWA) studies and whether information can be pooled across sites. The primary phenotype in the Group Health/UW Aging and Dementia eMERGE study project is dementia. Phenotyped participants originated from four population-based sources. Seattle-area members of GH (a large integrated health care system in Washington State) consented and enrolled in 1) the University of Washington Alzheimer's Disease Patient Registry (ADPR) and 2) the Adult Changes in Thought (ACT) study, 3) Marshfield Clinic Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults, 4) Vanderbilt's BioVU, a de-identified DNA biobank. The ADPR (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is a population-based registry of incident dementia cases designed to identify all new dementia cases within GH from 1987 to 1996. Potential dementia cases were identified through referrals from primary care physicians, mental health services, and neurologists, as well as review of CT scans, neurology, emergency room, geriatrician, and mental health clinic logs, and hospital discharge diagnoses. Medical history, physical, laboratory testing, and neuropsychological testing were performed on all consenting potential cases. These data were reviewed by a consensus conference including a neuropsychologist, study physicians, and an epidemiologist. After discussion of the case, dementia status is assigned using DSM-III-R criteria. Alzheimer's disease status was assigned using the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria. The study base of the ADPR population was stable with an attrition rate of less than 1%/year. The ACT study (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is an ongoing community-based cohort study designed to determine the incidence of Alzheimer's Disease (AD), other types of dementia, and cognitive impairment and to determine risk factors for these conditions. The original cohort of 2,581 was enrolled in 1994-1996. An expansion cohort of 811 was enrolled in 2000-2002. Continuous enrollment to keep 2,000 persons enrolled and at-risk for dementia outcomes was begun in 2005. To date the study has accrued more than 4,000 participants. Dementia-free participants are enrolled in this cohort and evaluated every two years by study personnel with many evaluations including an assessment of cognitive functioning using the Cognitive Abilities Screening Instrument (CASI), which is an extended version of the Mini-Mental State Examination that has been widely used in epidemiological studies of the elderly. Persons with CASI scores lower than 86 or in whom interviewers suspect unusual cognitive decline are followed up with dementia diagnostic evaluations which include physical and neurological examinations and neuropsychological tests. Medical records are reviewed, and laboratory tests and neuroimaging are obtained if not available. The dementia diagnoses and dementia subtypes are determined during a consensus conference attended by the examining clinicians and other study physicians, a neuropsychologist, and research nurse. After discussion of the case, dementia status is assigned using DSM-IV criteria. Alzheimer's disease status was assigned using NINCDS-ADRDA criteria. Individuals diagnosed with dementia are seen again one year following diagnosis using the same procedures. Individuals not diagnosed with dementia are returned to the pool of at-risk individuals and are seen at their next routinely scheduled biennial visit. The ACT sub-sample is stable; for the original cohort, median enrollment in GH was 19 years prior to joining the ACT study, and 85% of the cohort has ≥ 10 years of GH enrollment. DNA for the ADPR participants were obtained through a companion study, Genetic Differences in Cases and Controls (PI: Walter Kukull; NIH/NIA R01 AG007584). DNA obtained through both studies were extracted from blood using Gentra Systems Puregene methods. DNA concentration is determined by UV optical density. All samples are checked for quality by OD 260/280 ratio. For long-term storage, samples are aliquoted and stored at -70°C. The Marshfield study, Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults. PMRP was started in 2002 as a 3 Phase project. Completed in April 2004, the objectives of Phase I were to build and develop a large population-based biobank with DNA, plasma and serum samples to facilitate genomics research. Phase 1 was also to educate, inform and consult with the Marshfield Epidemiologic Study Area population and communities concerning potential studies, create the DNA foundation of the personalized medicine database and build the bioinformatics tools to store securely and analyze genotypic and phenotypic data. Phase I tasks included operation of the ethics and security advisory board, scientific advisory board and community advisory group. More than 18,000 residents aged 18 and above from 19 different zip codes surrounding Marshfield, WI were invited to participate in Phase I. After providing written informed consent, participants completed brief questionnaires that included questions about demographics, some environmental exposures, family history of disease, and adverse drug reactions, as well as family members living in the area. Participants provided 50ml of blood from which DNA was extracted and plasma and serum samples were stored. The informed consent process allowed access to electronic medical records and included language about non-disclosure of personal research results. A tick-off box was included so that participants could either allow or decline subsequent recontact for future research studied. The objectives of Phase II are to create the phenotypic database, establish the scientific and administrative infrastructure to support genetic mapping of the DNA and the initial discovery projects and genotype a sufficient portion of the genetic material to support these discovery projects. The objectives of Phase III are to expand the discovery projects, complete the genotyping of the genetic database and expand physician/health care provider education and community consultation. The Vanderbilt BioVU model uses discarded blood leftover from clinical care and de-identified clinical information, both of which are tracked with a Research Unique Identifier that is permanently disconnected from the medical record number used to generate it. The Vanderbilt IRB determined that the project does not qualify as "human subject" research under §46.102(f)(1)(2). The program has been reviewed by OHRP twice (the latest immediately prior to launch), and the determination of the Vanderbilt IRB that the project is consistent with the 8/10/2004 guidance has been validated. The model includes a simple opt out mechanism developed for patients who do not wish to have their samples included. Planning (including community involvement, ethics and IRB discussions, focus groups, development of operating procedures and pilot studies to assess them) began in May 2004, and the resource commenced sample collection in February 2007 and as of May 2009 contains approximately 56,000 samples. The current resource will be available to all Vanderbilt investigators who sign a Data Use Agreement. The resource represents Vanderbilt's broad patient population and thus provides a potential resource for research in a range of common and rare diseases as well as drug response or medication safety. BioVU patient protection model: There has been extensive involvement by the ethics community and the IRB to put in place procedures to provide privacy protection. The overall protection plan is multifaceted and includes a combination of technology and policy: (1) creation of the SD described above; (2) return of only the specific clinical data items requested by investigators (rather than the complete de-identified chart); (3) submission of any specific proposed project to the IRB and to a separate protocol review committee, both of which must approve; (4) implementing a Data Use Agreement that permits only approved queries and data analyses, specifically prohibits attempts at re-identification (at the risk of institutional sanctions), and mandates redeposit of all genetic information generated in a research study back into a genomic database; and (5) tracking and auditing all use.

  Study phs000234

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• Germline and Somatic Genetic Landscape of Pediatric Rhabdomyosarcoma

  Dynamic approaches that integrate population-based research and molecular biology are needed to explain the mechanisms underlying pediatric rhabdomyosarcoma (RMS) and to determine novel prevention strategies. RMS, the most common soft-tissue sarcoma in children and adolescents, has one of the poorest 5-year survival rates among all pediatric cancers (less than 65%). One of the strongest risk factors for RMS is having a cancer predisposition syndrome. The syndromes that are most commonly seen among those with RMS are Li-Fraumeni, neurofibromatosis type 1, Costello, Noonan, and DICER1. Based on smaller clinic-based studies, only about 7% of RMS cases are thought to be associated with the genes responsible for these syndromes. However, there have been no population-based assessments to support this estimate. Even in the most recent large-scale evaluations of germline mutations in predisposition genes among children with cancer, very few RMS cases were included (43 cases). Furthermore, no distinctions were made between the major histologic subtypes of RMS: embryonal (eRMS) and alveolar (aRMS), which display differences in terms of age distribution, incidence, and cytogenetics. For instance, nearly 80% of alveolar cases are driven by a chromosomal translocation between either PAX3 or PAX7 and FOXO1, whereas these fusions are not seen in embryonal cases. In fact, RMS research is shifting from categorization based on histology to fusion status (eRMS is overwhelmingly fusion-negative). Another limitation in previous studies has been the inability to evaluate the frequency of de novo germline mutations (DNMs) in cancer predisposition genes due to the absence of any well-characterized cohorts of RMS case-parent trios. Therefore, a major gap in our understanding of the role of cancer predisposition in pediatric RMS that limit translational impact is there have been no population-based assessments to determine the true impact of these mutations on pediatric RMS, which limits clinical sequencing guidelines and surveillance protocols in these children.Overall Project Strategy: The objective of this project is to advance our understanding of the relationship between cancer predisposition genes and pediatric RMS. Our central hypotheses are: 1) mutations in cancer predisposition genes are more common than expected in children with RMS; and 2) children with fusion-negative tumors have a higher burden of germline mutations than those with fusion-positive tumors. The framework for this study relies on >600 well annotated samples collected from newly diagnosed RMS patients and stored in the Children’s Oncology Group (COG) Biopathology Center.

  Study phs002304

• ADAGESIII: Contribution of genotype to glaucoma phenotype in African Americans

  Glaucoma results in vision loss due to damage of the optic nerve that is irreversible if undetected or untreated. The most common form of glaucoma is primary open angle glaucoma (POAG). While glaucoma affects all races, persons of African descent are disproportionately affected; studies show African-Americans (AAs) are about four to five times more likely than Caucasian Americans to develop the disease. Glaucoma is the leading cause of irreversible blindness in Americans of African descent, and the second leading cause in all Americans. The lack of understanding about the etiology of POAG impedes our ability to identify and treat it early in its development. Evidence of genetic contribution in the pathogenesis of POAG is well established. Since POAG tends to run in families, it is critical to identify the genetic basis of the disease in order to develop effective therapies for early intervention. While genome wide association studies (GWAS) for glaucoma have been completed for Caucasian populations, evidence from other studies suggests that a GWAS of glaucoma specific genes to the African-American population will yield unique and important findings for both this population and for glaucoma in general. A better understanding of the relationship among the stage of disease, the rate of change, ancestry, and other important risk factors being tracked in the ongoing African Descent and Glaucoma Study (ADAGES) will allow us to evaluate the relationship between genetics, visual loss and structural damage in this high-risk cohort. The scientific plan for this new study focuses on glaucoma in ∼2058 African-Americans by detailed phenotyping of new subjects, acquisition of samples from both new and established previously phenotyped study subjects for a repository, establishment of a data coordinating center, and genome wide association studies. The recruitment, enrollment, and phenotyping of both established and new subjects occurs at five clinical centers, University of California (UCSD), New York Eye and Ear Infirmary (Mt Sinai) and Columbia University Medical Center, a private practice in the Atlanta area, the University of Alabama at Birmingham, and the Robert Cizik Eye Clinic in Houston, TX. UCSD is also the location for the Data Coordinating Center and the Repository with Robert N. Weinreb as Principal Investigator. LA BioMed at Harbor-UCLA did the genotyping with a GWAS panel of ∼1 million single nucleotide polymorphisms (SNPs) using the Illumina MEGA array under the direction of Jerome Rotter, Ida Chen, and Kent Taylor.

  Study phs001673

• Long read mRNA sequencing of human neural retinal samples - Usher syndrome transcript landscape

  Long-read (PacBio) RNA sequencing dataset of three neural retinal samples. Three PacBio libraries were prepared according the 'standard workflow' optimized for sequencing transcripts centered around 2kb. Additionally one Library (input HNR_S2) was prepared according an optimized 'long workflow' to enrich for larger transcripts up to >10kb. To further enhance the capture of full-length transcripts for USH2A and ADGRV1 (USH2C) genes, we also employed a targeted enrichment approach using the Samplix Xdrop System, followed by PacBio long-read sequencing. USH2A and ADGRV1 enrichment was performed by targeting '5- mid and 3' targets of the respective genes. Finally, we also added ONT (Oxford Nanopore technology) long-read mRNA sequencing of three independent neural retina samples. These data were used for the validation of events observed from the Iso-Seq and Samplix data. The ONT datasets contain sequencing data of the Usher-associated genes. Files are raw BAM, and CRAM format files generated by a Sequel II machine. Additionally, the ccs3 BAM format files are included.

  Dataset EGAD50000000720

• Diverse Cellular Composition in Alveolar Rhabdomyosarcoma Revealed by Single Cell RNA Sequencing

  Using single cell RNAseq data to characterize tumor composition and cellular states for Alveolar Rhabdomyosarcoma. We find that that ARMS tumors harbor phenotypically and transcriptionally distinct malignant subpopulations within an immune-influenced microenvironment.

  Study EGAS50000001564

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• Analysis of Papilloma Infiltrating T cells from an Exceptional Responder to Immunotherapy

  This data corresponds to single cell RNA-seq data of TIL from a young woman with recurrent respiratory papillomatosis who was treated with PD-L1 blockade and experienced durable disease control over a 4+ year period. A HPV6 E2-specific, HLA-B*55 restricted TCR was identified and shown to be present in both the immediate post treatment and 4 year TIL, with a gene expression profile indicative of being a tissue resident memory T cell. 

  Study phs002826

• Modulation of Lung Immune Responses to Viral Infection-Microbiome Interactions with Respiratory Organoids

  Here, we colonized bronchial epithelial air-liquid interface tissue cultures with 58 different individual microbes. Following 18 and 48 hours of colonization, we performed bulk RNA-seq of the host epithelial cells (n=3). Overall, we found significant microbial species-level and strain-level variation in host gene expression changes for innate immunity and epithelial barrier genes. Of particular interest, we found significant heterogeneity in stimulation of host interferon and antiviral interferon-stimulated genes.Study registered in ImmPort under accession # SDY2281.

  Study phs003627

• Generation of hypoimmunogenic induced pluripotent stem cells by CRISPR-Cas9 system and detailed evaluation for clinical application

  We established hypoimmunogenic human induced pluripotent stem cells (iPSCs) to minimize the immune rejection caused by mismatches of HLA type. Here, we optimized the protocol for good manufacturing practice (GMP)-compatible CRISPR-Cas9 genome editing to deplete the three gene locus (HLA-A, HLA-B, and CIITA genes) simultaneously in HLA homozygous iPSCs. RNA-seq and flow cytometry analyses confirmed the successful depletion of HLAs, and lineage-specific differentiation into cardiomyocytes was verified.

  Study EGAS50000001194

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the feature of age-associated helper T (ThA) cells and its contribution to autoimmune diseases, various peripheral blood immune cell subsets from 136 systemic lupus erythematosus (SLE) and 89 healthy controls (HC) were collected (Naive_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, ThA, Naive_CD8, Naive_B, SM_B, USM_B, DN_B, Plasmablast, NK, CD16p_Mono, CL_Mono, Neu, mDC, pDC, TEMRA_CD8, CM_CD8, EM_CD8, NC_Mono, Int_Mono, LDG). RNA-seq was performed with each cell subset samples.

  Study JGAS000627

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  To elucidate the regulation of gene expression in immune cell subsets and its contribution to autoimmune diseases, 24 peripheral blood immune cell subsets from 50 Systemic Sclerosis and 48 Healthy Controls were collected (Naive_CD4, Mem_CD4, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Th1, Th2, Th17, Tfh, NK, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono, Int_Mono, NC_Mono, mDC, pDC). RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000296

• Comprehensive molecular profiling of pulmonary pleomorphic carcinoma

  Information regarding the molecular features of pulmonary pleomorphic carcinoma (PPC) is insufficient. Here, we performed next-generation sequencing to determine the genomic and transcriptomic profiles of PPC. Whole exome sequencing (WES) of fresh-frozen tissue samples and target-capture sequencing of formalin-fixed-paraffin-embedded (FFPE) samples were performed. Fresh-frozen tissue samples and FFPE samples were subjected to WES and target-capture sequencing as normal control, respectively. Fresh-frozen tissue samples and 56 FFPE samples were subjected to RNA-seq.

  Study JGAS000297

• Integrative understanding of human immune system by functional genomics and development of intervention strategies for the prevention of autoimmune diseases

  Various peripheral blood immune cell subsets from 89 healthy volunteers and 136 systemic lupus erhythematosus (SLE) donors were collected (Naive_CD4, Mem_CD4, Th1, Th2, Th17, Tfh, Fr._I_nTreg, Fr._II_eTreg, Fr._III_T, Naive_CD8, EM_CD8, CM_CD8, TEMRA_CD8, NK, Naive_B, USM_B, SM_B, DN_B, Plasmablast, CL_Mono (or CD16n_Mono), CD16p_Mono, Int_Mono, NC_Mono, mDC, pDC, Neu, LDG). 22 SLE donors were analyzed longitudinally. RNA-seq was performed with each immune cell subset samples. After gene expression quantification samples were filtered.

  Study JGAS000486

• PEACE melanoma 14

  Understanding the evolutionary pathways to metastasis and resistance to immune checkpoint inhibitors (ICI) in melanoma is critical for improving outcomes. Here we present the most comprehensive intra-patient metastatic melanoma dataset assembled to date as part of the PEACE research autopsy programme, including exome, panel-sequenced, RNA-seq, and single-cell whole-genome sequencing samples from 14 ICI-treated patients. The main goals of the project are to decipher the evolutionary dynamics of melanoma metastases and to elucidate mechnisms of resistance to therapies.

  Study EGAS00001007081

• Paired exome analysis in urothelial carcinoma

  In this study we characterized genomic alterations in two to five metachronous tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth), Ultra deep targeted sequencing (~6,809x mean read depth) and whole transcriptome RNA-seq was performed for all samples. In addition multiregional WES was performed on 8 adjacent regions from a single tumor.

  Study EGAS00001001686

• LCM-RNAseq on human lung macrophages

  In the reported study, we employed Laser Capture Microdissection (LCM) for the transcriptome profiling of lung macrophages cells populations as a function of location within the healthy tissue. In detail, macrophage mini-bulks (100 cells each) were collected by LCM from 4 healthy human donors in 5 different locations of the airways (a total of 20 biopsies), including parenchyma (L1 – lower left lobe (LLL); L6 – 80% distance from LLL tip), trachea (L2), bronchi (L3 – 1st/2nd generation; L5 – 3rd/4th generation) and processed for RNA-seq.

  Study EGAS00001006168

• BAM files of total RNA-Seq data of POPS control samples (GRCh37)

  Placental biopsies (n = 64 female placentas, n = 67 male placentas) were selected from healthy pregnancies from the POPs cohort. A quality control process was also applied for the RNA-Seq datasets: reads were trimmed with Trim Galore!, which uses cutadapt internally and were mapped to the same version of human genome reference (hg19). TopHat2, a splice-aware mapper built on top of Bowtie2 short-read aligner, was used in the mapping process in which so-called two-pass (or two-scan) alignment protocol was applied to rescue unmapped reads from the initial mapping step. In the second mapping, previously unmapped reads were re-aligned to the exon-intron junctions detected in the first-mapping by TopHat2 and were combined across all 131 placenta samples. The initial and second mapped reads were merged by samtools

  Dataset EGAD00001003462

• Preferential infiltration of distinct Vγ9δ2 T cells into Glioblastoma multiforme

  Glioblastoma multiforme (GBM), the most fatal CNS cancer, is highly infiltrative as a result of phenotypic alteration of cancer cells mainly driven by a mutual interaction among cancer cells, tumor-associated macrophages (TAMs) and other stromal cells. This work aims at characterizing GBM-infiltrating γδ T cells that may regulate the GBM tumor microenvironment and cancer cell gene expression. V(D)J repertoires of tumor-infiltrating and blood circulating γδ T cells from 4 patients were analyzed by NGS-based TCR sequencing. RNA gene expression profiling and immunostaining of cancer tissues were performed as well.

  Study EGAS00001002790

• Comprehensive NGS Profiling to Enable Detection of ALK Gene Rearrangements and MET Amplifications in Non-Small Cell Lung Cancer

  We evaluate the analytical performance of the PGDx™ elio™ tissue complete assay, a 505 gene next-generation sequencing (NGS) tissue-based assay, that has now been FDA-cleared for use by physicians to help guide treatment decisions for cancer patients, using a NSCLC cohort of 38 patients.

  Study EGAS50000000010

• A spatiotemporal organ-wide gene expression and cell atlas of the developing human heart

  The process of cardiac morphogenesis in humans is incompletely understood. Its full characterization requires a deep exploration of the organ-wide orchestration of gene expression with a single-cell spatial resolution. Here, we present a molecular approach that reveals the comprehensive transcriptional landscape of cell types populating the embryonic heart at three developmental stages, and which maps cell type-specific gene expression to specific anatomical domains. Spatial Transcriptomics identified unique gene profiles corresponding to distinct anatomical regions in each developmental stage. Human embryonic cardiac cell types identified by single-cell RNA-sequencing confirmed and enriched the spatial annotation of embryonic cardiac gene expression. In situ sequencing was then used to refine these results and create spatial subcellular map for the three developmental phases. Finally, we generated a publicly available web resource of the human developing heart to facilitate future studies on human cardiogenesis.

  Study EGAS00001003996

• The Acquisition of Molecular Drivers in Pediatric Therapy-Related Myeloid Neoplasms

  Pediatric therapy-related myeloid neoplasms (tMN) occur in children after exposure to cytotoxic therapy and have a dismal prognosis1-4. The somatic and germline genomic alterations that drive these myeloid neoplasms in children and how they arise have yet to be comprehensively described. We use whole exome, whole genome, and/or RNA sequencing to characterize the genomic profile of 85 pediatric tMN cases (tMDS: n=29, tAML: n=56). Our data show that Ras/MAPK pathway mutations, alterations in RUNX1 or TP53, and KMT2A rearrangements are frequent somatic drivers, and we identify cases with aberrant MECOM expression secondary to enhancer hijacking. Unlike adults with tMN5-7, we find no evidence of pre-existing minor tMN clones (including those with TP53 mutations), but rather the majority of cases were unrelated clones arising as a consequence of cytotoxic therapy. These studies also uncover rare cases of lineage switch disease rather than true secondary neoplasms.

  Study EGAS00001004850

• A microRNA-signature that correlates with cognition and is a target against cognitive decline

  While some individuals age without pathological memory impairments, others develop age-associated cognitive diseases. Since changes in cognitive function develop slowly over time in these patients, they are often diagnosed at an advanced stage of molecular pathology, a time point when causative treatments fail. Thus, there is great need for the identification of inexpensive and minimal invasive approaches that could be used for screening with the aim to to identify individuals at risk for cognitive decline that can then undergo further diagnostics and eventually stratified therapies. In this study we use an integrative approach combining the analysis of human data and mechanistic studies in model systems to identify a circulating 3-microRNA signature that reflect key processes linked to neural homeostasis and informs about cognitive status. We furthermore provide evidence that expression changes of this signature represent multiple mechanisms de-regulated in the aging and diseased brain and are a suitable target for RNA therapeutics.

  Study EGAS00001005627

• Genomic Architecture of Progression and Treatment Response in AMD

  Numerous studies have identified common and rare genetic variation associated with risk of advanced age-related macular degeneration (AMD). However, risk is just one facet of AMD disease architecture. Both disease progression and response to treatment are two critical elements that may also be influenced by genetic variation. The primary aim of this study was to identify genetic variation influencing progression and response to treatment for AMD, with a secondary aim of further elucidating the genetic etiology of AMD risk. We ascertained AMD cases and controls of European ancestry from Vanderbilt Eye Institute (VEI) and the Bascom Palmer Eye Institute (BPEI) and obtained blood samples from all participants. Eyes were examined using standard ophthalmological methods, and graded according the modified Age-Related Eye Disease Study scale (AREDS grades 1-5) using fundus photography. Individuals were re-examined in follow-up exams at regular intervals to assess any change in AMD grade. Eyes with advanced neovascular AMD that were examined using ocular coherence tomography imaging (OCT), treated with anti-angiogenesis therapy and monitored for response to treatment. All individuals ascertained for the study were exome-chipped for genome-wide single nucleotide variation coverage. To target rare genetic variation, whole exome sequencing was performed on individuals at the phenotypic extremes based on 1) AMD grade, 2) rate of progression from intermediate to advanced AMD and 3) response to anti-VEGF treatment for eyes with advanced neovascular AMD.

  Study phs001046

• RNA Sequencing of ECOG-E1308

  This study reports the RNA sequencing of HPV positive oropharyngeal squamous cell carcinoma samples from patients with HPV-associated stage III or stage IV cancer of the oropharynx that was surgically resectible. These patients participated in the ECOG-E1308 trial, a phase II trial that studied paclitaxel, cisplatin, and cetuximab followed by cetuximab and two different doses of intensity-modulated radiation therapy.

  Study phs003320

• Development of hunanized mice for human hematopoisis and immunity research

  We obtained peripheral blood or bone marrow samples from 112 acute myeloid leukemia patients and examined sensitivity and resistance of the AML samples to molecular targeting drugs. By doing RNA sequencing using AML cells, we found heterogenous gene expression patterns in AML with different mutational landscapes. From the RNA sequencing, we identified anti-apoptosis, cell cycle progression, and immune-related signals as pathways up-regulated in AML cells as compared with normal CD34+ cells. From the pathway analyses, we further setup in vitro experiments to find vulnerability genes in clinically-aggressive AML. BIRC, BCL2, MCL1, AURKB, and KIF10 may be essential molecules for AML cell survival and proliferation.

  Study JGAS000253

• Meisal temporal lobe epilepsy sequencing study

  Our understanding of mesial temporal lobe epilepsy (MTLE) is one of the most common forms of drug-resistant epilepsy in humans. Using RNA- and small RNA-sequencing in parallel, we explored differentially expressed genes in the hippocampus and cortex of MTLE patients who had undergone surgical resection and non-epileptic controls. We found significant enrichment for astrocytic and microglial genes amongst up-regulated genes and down-regulation of neuron-specific genes in the hippocampus of MTLE patients. The transcriptome profile of the small RNAs reflected disease state more robustly than mRNAs, even across brain regions which show very little pathology.

  Study EGAS00001003922

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680