14977 results for "cancer studies using rna-seq"

in 132.15 milliseconds.

• RNA-Sequencing data of Fusobacterium nucleatum treated CAFs and HT-29 tumor spheroid exposed to Fusobacterium nucleatum treated CAFs conditioned medium.

  RNA-Sequencing data of CAFs (patient derived CAF180 and CAF181 as well as the CT5.3 CAF cell line) and HT-29 tumor spheroid samples performed in the context of the study of the interaction of Fusobacterium nucleatum with CRC CAFs. Fusobacterium nucleatum interacts with cancer-associated fibroblasts to enhance colorectal cancer progression

  Dataset EGAD50000001614

• Transcriptomic dataset from a phase II study of pembrolizumab and epigenetic modification with azacitidine in platinum-resistant epithelial ovarian cancer

  This dataset includes sequence files from bulk RNA sequencing of tissue biospecimens from a phase II study investigating epigenetic priming followed by immune checkpoint blockade in platinum-resistant epithelial ovarian cancer (NCT02900560). There are 48 bulk RNA sequencing files from 24 specimens included in this dataset.

  Dataset EGAD50000001664

• NeoRhea Bulk RNA and Single nuclei RNA & ATAC

  The aim of this study is to compare baseline and surgery samples of ER+/HER2- early breast cancer patients. Patients have been treated with endocrine therapy in combination with palbociclib. Samples have been collected pre and post treatment.

  Study EGAS50000001403

• Single-cell profiling maps the spectrum of crosstalk between glioma cells and tumor associated macrophages

  Tumor associated macrophages (TAMs) are a heterogeneous glioma infiltrate, implicated in cancer progression. We performed single-cell RNA-sequencing, to survey TAM response-patterns in glioma.

  Study EGAS00001002185

• Whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing data from nasal cells of COVID-19 patients

  Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dataset EGAD50000000398

• Bell_activation_timecourse

  We purified human naive and memory B cells from PBMCs. We stimulated them with IgM cross-linker providing BCR stimulation, multimeric CD40L that engages costimulatory receptor CD40 on the B cell, and cytokines IL-2 and IL-21. To comprehensively characterise activation dynamics of naive and memory B cells, we performed single-cell RNA sequencing (scRNA-seq) and B cell receptor sequencing (BCR-seq) in resting cells (day 0), before the first division (day 1), at the time of the first division (day 3) and following the full B cell differentiation (day 6)

  Dataset EGAD50000002115

• The Landscape of Antisense Gene Expression in Human Cancers

  High throughput RNA Sequencing has revealed that the human genome is widely transcribed. However, the extent of natural antisense transcription, the molecular mechanisms by which natural antisense transcripts (NATs) might affect their cognate sense genes, and the role of NATs in cancer are less well understood. Here, we use strand-specific paired-end RNA sequencing (ssRNASeq) on a cohort of 376 cancer patients covering 9 tissue types to comprehensively characterize the landscape of antisense expression. Our results reveal that greater than 60% of annotated transcripts have measureable antisense expression and the expression of sense and antisense transcript pairs is in general positively correlated. Furthermore, by studying the expression of sense/antisense pairs across tissues we identify lineage-specific, ubiquitous and cancer-specific antisense loci. Our results raise the possibility that NATs participate in the regulation of well-known tumor suppressors and oncogenes. Finally, this study provides a catalogue of cancer related genes with significant antisense transcription (oncoNAT). This resource will allow researchers to investigate the molecular mechanisms of sense/antisense regulation and further advance our understanding of their role in cancer.

  Study phs000937

• Uncovering Inversion Formation in the Human Genome and its Impact to Disease

  The relevance of inversions for disease causation, speciation and adaptation is broadly recognized, although the prevalence of inversions is unknown. In humans, de novo inversions are associated with congenital anomalies in approximately 9.6% of patients. Yet, despite the biological relevance of inversions, their molecular features, formation mechanism, impact to the genomic structure of carriers, as well as their contribution to clinical phenotypes, have not been further explored. Inversions are typically classified as balanced reciprocal events generated by ectopic recombination, although recent studies reveal a distinct picture whereby inversions originate from mechanisms that concomitantly generate copy number variants (CNVs). Surprisingly, those complex inversions underlie as much as 30% of neurodevelopmental-associated CNVs. The hypothesis of this project are: inversions are often generated de novo by mechanisms other than ectopic recombination a relevant fraction of inversions are associated with complex genomic rearrangements (CGRs), often overlooked in sporadic diseases, and inversions are a "hidden" type of structural variation for which contribution to a clinical phenotypes has been under assessed due to the lack of appropriate detection tools. A combined strategy using multiple genomic tools will be applied to characterize inversions and associated genomic alterations in individuals with neurodevelopmental disorders and controls: whole genome sequencing (WGS) with short-and long-reads; genome mapping; classical cytogenetics; and array CGH. This project will establish common ground to bridge studies of rare and common diseases, human evolution, and population genetics.

  Study phs002999

• RNA sequencing data of 66 matched primary and recurrent high grade serous ovarian cancer

  Dac EGAC00001000741

• Targeted RNA sequencing of breast cancer GWAS loci

  Dataset EGAD00001004498

• Profiling of 27 type 2 diabetes GWAS loci using next-generation (NG) capture C in a human beta-cell model

  Most type 2 diabetes association signals are due to variants that impact gene regulation but identifying the genes they impact is challenging. We generated interaction profiles at 27 T2D GWAS loci using next-generation (NG) capture C (6 replicates) in the human beta-cell model, EndoC-betaH1, along with chromatin accessibility profiling using ATAC-Seq (9 replicates).

  Dataset EGAD00001008655

• RNASeq profiles from Indian HFrEF Cohort

  The dataset contains whole transcriptomics profiling from a cohort of 49 HFrEF patients. The myocardium samples were collected from these patients during heart transplant of LVAD implantation procedure. The RNA samples were collected in RNAlater. Total transcriptome libraries were prepared using TruSeq Stranded Total RNA Library Prep with Ribo-Zero Gold kit and sequenced on Illumina HiSeq4000.

  Dataset EGAD50000001196

• GEI Studies - Psoriasis

  The GEI Studies Project was started as an NIH consortium involving 5 disease groups with funding provided through the Genes, Environment, and Health Initiative (GEI). The objective of the project was to optimize strategies for identifying rare variants as a follow up to genome-wide association studies (GWAS) using next-generation sequencing technology. One of the five targeted diseases, Psoriasis, is a multifactorial skin disease characterized by epidermal hyperproliferation and chronic inflammation that affects approximately 2% of Americans. Because only about one-third of all patients with psoriasis have a relative who is also affected with the disorder, psoriasis is not widely recognized as a genetic disease. However, previous research on families and identical twins has shown psoriasis has a strong genetic component, although environmental factors (such as infections, stress, and injuries) are also important. Although no definite psoriasis gene has yet been identified, research during the last ten years has revealed over forty potential gene locations that may contribute to the disease. Large amounts of data generated using next-generation sequencing technology would provide a more detailed characterization of sequence variation which would in turn increase the likelihood of detecting causative loci. With the presumption that rare variants are frequently the cause of a large portion of phenotypic variation, it was necessary to use large sample sets. In the main body of this study, we sequenced 4,966 samples (812 dermatologist-diagnosed cases of purely cutaneous psoriasis (PsC), 1,497 cases of rheumatologist-diagnosed psoriatic arthritis, 665 cases of cutaneous psoriasis with uncertain psoriatic arthritis status (PsV) and 1,992 controls) across 5.7 Mb of sequence containing 100 psoriasis candidate loci and 769 genes. For each candidate locus, we considered sequences within 250 kb of the strongest association signal. Within this window, three strategies were employed. For ten of the strongest psoriasis signals, we used a whole-region approach which included non-coding intergenic and intronic sequence. For four established loci of lesser significance, we targeted all full transcription units within the +/- 250 kb interval. For the remaining signals, we targeted the exons of all transcription units within the +/- 250 kb interval. Due to complexities of high-efficiency targeting of HLA genes we selected 5 specific candidate genes for sequencing near the HLA-C gene.

  Study phs000766

• WGS of high grade serous ovarian tumours and matched blood normals

  FASTQ reads for 34 matched tumour-normal WGS pairs for high grade serous ovarian cancer patients. Scottish HGSOC samples were collected via local Bioresource facilities at Edinburgh, Glasgow, Dundee and Aberdeen and stored in liquid Nitrogen until required. HGSOC patients were determined from pathology records and were included in the study where there was matched tumour and whole blood samples. Tumour samples were divided into two for DNA and RNA extraction and slivers of tissue were taken, fixed in formalin and embedded in paraffin wax (FFPE). Samples were only included if they were confirmed as HGSOC and there was greater than 40% tumour cellularity throughout the tumour, determined using H&sE staining of the FFPE sections and pathology review. Somatic DNA was extracted from the tumour and germline DNA was extracted from whole blood. Somatic DNA was extracted using the Qiagen DNeasy Blood and tissue kit (cat no 69504). The tissue was initially homogenised using a Qiagen Bioruptor, followed by the manufacturers recommended protocol (including RNase digestion step). Germline DNA was extracted from 1-3ml whole blood using the Qiagen FlexiGene kit (cat no 51206) following the manufacturers recommended protocol. The resulting DNA underwent quality control as follows: firstly, A260 and A280nm were measured on a Denovix DS-11 Fx to qualitatively illustrate A260/280nm and A260/230nm ratios as surrogate measures of DNA purity. A260/280 had to be 1.8 or greater and A260/230 had to be 2.0 or greater. Then, DNA was quantified using LifeTechnologies Qubit dsDNA BR kit (cat no Q32850) and we required a minimum of 50ul at 25ng/ul for WGS. Thirdly, DNA was diluted to 25ng/ul and a representative sample was loaded onto a 0.8% TAE gel, ran at 100v for 60mins and then imaged using a BioRad ChemiDoc imaging system to visualise the DNA quality.

  Dataset EGAD00001010135

• WGS of high grade serous ovarian tumours and matched blood normals

  FASTQ reads for 81 matched tumour-normal WGS pairs for high grade serous ovarian cancer patients. Scottish HGSOC samples were collected via local Bioresource facilities at Edinburgh, Glasgow, Dundee and Aberdeen and stored in liquid Nitrogen until required. HGSOC patients were determined from pathology records and were included in the study where there was matched tumour and whole blood samples. Tumour samples were divided into two for DNA and RNA extraction and slivers of tissue were taken, fixed in formalin and embedded in paraffin wax (FFPE). Samples were only included if they were confirmed as HGSOC and there was greater than 40% tumour cellularity throughout the tumour, determined using H&E staining of the FFPE sections and pathology review. Somatic DNA was extracted from the tumour and germline DNA was extracted from whole blood. Somatic DNA was extracted using the Qiagen DNeasy Blood and tissue kit (cat no 69504). The tissue was initially homogenised using a Qiagen Bioruptor, followed by the manufacturers recommended protocol (including RNase digestion step). Germline DNA was extracted from 1-3ml whole blood using the Qiagen FlexiGene kit (cat no 51206) following the manufacturers recommended protocol. The resulting DNA underwent quality control as follows: firstly, A260 and A280nm were measured on a Denovix DS-11 Fx to qualitatively illustrate A260/280nm and A260/230nm ratios as surrogate measures of DNA purity. A260/280 had to be 1.8 or greater and A260/230 had to be 2.0 or greater. Then, DNA was quantified using LifeTechnologies Qubit dsDNA BR kit (cat no Q32850) and we required a minimum of 50ul at 25ng/ul for WGS. Thirdly, DNA was diluted to 25ng/ul and a representative sample was loaded onto a 0.8% TAE gel, ran at 100v for 60mins and then imaged using a BioRad ChemiDoc imaging system to visualise the DNA quality.

  Dataset EGAD00001009049

• Single Cell RNA-Sequencing in Adenoid Cystic Carcinoma

  This study of salivary adenoid cystic carcinoma aimed to profile individual malignant and stromal cells in treatment-naive head and neck adenoid cystic carcinoma, with or without metastatic cervical lymph nodes. Clinical and pathologic information was collected on all patients, in addition to a fresh biopsy sample from the primary tumor and/or metastatic lymph node at the time of initial surgery. A fresh biopsy sample from a matched local recurrence was also collected for a single unique patient. Biopsy specimens were processed for single cell RNA-seq. A total of ~1,700 single cells from seven participants were included in the final dataset.

  Study phs003070

• A benchmark of DNA methylation deconvolution methods for tumoral fraction estimation using DecoNFlow

  In cancer patients, circulating cell-free DNA (cfDNA) originates from both healthy and cancer cells, and the proportion of tumor-derived cfDNA serves as a surrogate marker of tumor burden. Tumoral cfDNA can be identified using patient-specific mutations or more general tumor-specific DNA methylation patterns that are preserved in cfDNA, enabling non-invasive cancer detection and monitoring. Accurately estimating tumor fractions remains challenging due to the heterogeneous mixture of cfDNA sources in body fluids. Computational DNA methylation deconvolution methods can address this by estimating tumoral fraction with or without reference methylomes. Here, we benchmarked 10 reference-based and 2 reference-free DNAm deconvolution tools and provide the data generated for this benchmarking, consisting of 10 neuroblastoma cell lines and one healthy cfDNA sample (pooled from 15 healthy cfDNA samples), profiled using cfRRBS.

  Study EGAS50000001529

• Integration of T Cell Repertoire, CyTOF, genotyping and symptomatology data reveals subphenotypic variability in COVID-19 Patients

  A total of 61 patients (33 mild and 28 severe) with a median age of 51 years who recovered from COVID-19 were included in this study (Table 1). All collected samples were confirmed in diagnosis of COVID-19 by RT-PCR and positive IgG serolog. For the 61 patients, TCR-seq, CyTOF, and genotyping data were generated and analyzed in separate studies, as part of larger cohorts. In total, there are 143 variables, with 129 being quantitative (TCRseq and CyTOF metrics) and 13 being qualitative (symptomatology and genotyping). For more information about cohort characteristics, data adquisition an pre-processing, please visit PMID: 39227859, 36969980 and 37287057.

  Dataset EGAD50000000840

• Title: Divergent levels of CD112 and INKA1 define a distinct subset of human long-term hematopoietic stem cells

  The data provided here was critical in establishing that human long-term hematopoietic stem cells (LT-HSC), previously described as the most primitive HSC population, is actually composed of distinct subsets that can be prospectively isolated. Via mechanistic studies centering around the Rho-GTPase effector kinase PAK4 and its inhibitor INKA1, we identified the immune checkpoint ligand CD112 as a marker for hematopoietic stem and progenitor cells, that is highest expressed on LT-HSC. More importantly, CD112 can be used to stratify functionally distinct subsets within LT-HSC: In response to regeneration-mediated stress, the CD112low subset exhibits a transient restraint (termed latency) before contributing to hematopoietic reconstitution, while the CD112high subset is primed to respond rapidly. High resolution RNA-seq of the CD112 surface expression spectrum within rare LT-HSC subsets (human umbilical cord blood) demonstrated that more genes are differentially upregulated in the deeper quiescent and less metabolic active subset. Genes enriched in this subset centre around cell adhesion and Rho-GTPase signaling. This is in agreement with the scRNAseq data from human G-CSF mobilized peripheral blood (mPB) generated here that was used as an model of in vivo activation/priming revealing via RNA-velocity and pseudo-time analysis that INKA1high versus PAK4high, CDK6high and CD112high enrichment are either detected early or late in diffusion pseudotime indicative of quiescent versus primed cell status, respectively. RNAseq following INKA1 overexpression in LT-HSC and ST-HSC revealed by GSEA an overall stemness preserving phenotype and particularly in LT-HSC, but not in short-term HSC (ST-HSC), suppression of transcriptional programs linked to activation. Collectively, our data decipher the molecular intricacies underlying HSC heterogeneity and self-renewal regulation and point to latency as an orchestrated physiological response that integrates quiescence control with HSC fate choices to preserve a stem cell reservoir.

  Dataset EGAD00001006541

• The patterns and dynamics of genomic instability in metastatic pancreatic cancer

  Pancreatic cancer is an aggressive malignancy with a five-year mortality of 97–98%, usually due to widespread metastatic disease. Previous studies indicate that this disease has a complex genomic landscape, with frequent copy number changes and point mutations, but genomic rearrangements have not been characterized in detail. Despite the clinical importance of metastasis, there remain fundamental questions about the clonal structures of metastatic tumours, including phylogenetic relationships among metastases, the scale of ongoing parallel evolution in metastatic and primary sites, and how the tumour disseminates. Here we harness advances in DNA sequencing to annotate genomic rearrangements in 13 patients with pancreatic cancer and explore clonal relationships among metastases. We find that pancreatic cancer acquires rearrangements indicative of telomere dysfunction and abnormal cell-cycle control, namely dysregulated G1-to-S-phase transition with intact G2–M checkpoint. These initiate amplification of cancer genes and occur predominantly in early cancer development rather than the later stages of the disease. Genomic instability frequently persists after cancer dissemination, resulting in ongoing, parallel and even convergent evolution among different metastases. We find evidence that there is genetic heterogeneity among metastasis-initiating cells, that seeding metastasis may require driver mutations beyond those required for primary tumours, and that phylogenetic trees across metastases show organ-specific branches. These data attest to the richness of genetic variation in cancer, brought about by the tandem forces of genomic instability and evolutionary selection.

  Study EGAS00000000064

• Enhancer profiling to identify identifies epigenetic markers of endocrine resistance in metastatic castration resistant prostate cancer patients

  ChIP-seq and matched input data of AR, FOXA1 and H3K27ac for mCRPC patient samples taken prior to and after treatment with AR targeted therapy

  Dataset EGAD00001008688

• Onco-exaptation of an Endogenous Retroviral LTR Drives IRF5 Expression in Hodgkin Lymphoma

  The transcription factor interferon regulatory factor 5 (IRF5) is upregulated in Hodgkin lymphoma (HL) and a key regulator of the aberrant transcriptome characteristic of this disease. Here we show that IRF5 upregulation in HL is driven by transcriptional activation of a normally dormant endogenous retroviral LOR1a long terminal repeat (LTR) upstream of IRF5. Specifically, through screening of RNA-seq libraries, we detected LTR-IRF5 chimeric transcripts in multiple HL cell lines but not in normal B-cell controls. In HL, the LTR was in an open and hypomethylated epigenetic state and we further show the LTR is the site of transcriptional initiation. Among HL cell lines, usage of the LTR promoter strongly correlates with overall levels of IRF5 mRNA and protein, indicating that LTR transcriptional awakening is a major contributor to IRF5 upregulation in HL. Taken together, oncogenic IRF5 overexpression in HL is the result of a specific LTR transcriptional activation. We propose that such LTR derepression is a distinct mechanism of oncogene activation (“onco-exaptation”) and that such a mechanism warrants further investigation in molecular and cancer research.

  Study EGAS00001001205

• Collagen Proteostasis in Health and Disease

  This study uses human iPSC-derived cartilage to investigate the effects of the p.Arg719Cys mutation in the COL2A1 gene, which is linked to precocious osteoarthritis. Using a CRISPR-edited isogenic cell line pair, we compared wild-type and mutant cartilage for matrix defects and cellular stress responses. We performed RNA-sequencing and quantitative proteomics to characterize changes in gene expression, protein interactions, and collagen folding.

  Study phs004112

• Bulk RNAseq FASTQ files of three PDAC organoid lines treated with LGK974 or DMSO for 24h

  This dataset contains raw FASTQ files from bulk RNA sequencing of three patient-derived pancreatic ductal adenocarcinoma (PDAC) organoid lines (P28, P40, P47). Each organoid line was treated with either the WNT secretion inhibitor LGK974 or DMSO for 24 hours, with three biological replicates per treatment condition. RNA was extracted using the Qiagen QiaSymphony SP system, and libraries were prepared with the Illumina Truseq stranded polyA kit. Sequencing was performed on an Illumina NextSeq2000 platform using single-end 50bp reads. Quality control was conducted with FastQC, and reads were trimmed with TrimGalore as appropriate. Data are controlled-access and intended for transcriptomic analysis of WNT pathway perturbation in PDAC organoid models.

  Dataset EGAD50000002219

• Single-cell multi-omics reveals clonal evolution and T-cell dynamics underlying differential responses to ibrutinib in Waldenström macroglobulinemia.

  To elucidate the molecular basis underlying differential response and resistance to ibrutinib in Waldenström’s macroglobulinemia (WM), we conducted a prospective phase II trial (NCT02604511) of ibrutinib monotherapy in treatment-naïve patients. Seventy-four sequential bone marrow (BM) aspirates from 17 patients, collected from baseline through 48 treatment cycles, were profiled using single-cell RNA and V(D)J sequencing.

  Study EGAS50000001596

• Capture Hi-C on Hodgkin lymphoma cell line L-428

  In situ promoter capture Hi-C on Hodgkin lymphoma cell line L-428 in experimental triplicates. Hi-C libraries were prepared as previously described (Orlando et al., 2018, https://currentprotocols.onlinelibrary.wiley.com/doi/pdf/10.1002/cphg.63). Promoter capture was based on 32,313 biotinylated 120-mer RNA baits (Agilent). Hi-C libraries were sequenced using Illumina HiSeq 2000 technology. The files are in FASTQ format.

  Study EGAS00001003032

• Angiopredict: predicting response for bevacizumab treatment

  In ANGIOPREDICT, academic cancer biologists and industry-based biotechnology researchers worked with clinicians to identify biomarkers to predict whether individual metastatic colorectal cancer patients will respond positively to bevacizumab containing therapy. In this retrospective study, copy number profiles were determined using whole genome shallow sequencing, and progression free survival and treatment data was collected.

  Study EGAS00001002724

• Dataset for Direct Detection of Early-Stage Cancers using Circulating Tumor DNA

  The dataset for Direct Detection of Early-Stage Cancers using Circulating Tumor DNA includes 602 bam files from next-generation sequencing on the Illumina HiSeq2500 or MiSeq. The samples analyzed include cancer cell lines as well as plasma and tissue specimens from healthy individuals and patients with cancer.

  Dataset EGAD00001003601

• Single cell analysis reveals new evolutionary complexity in uveal melanoma

  Uveal melanoma (UM) is a rare eye cancer that is highly aggressive and leads to metastatic death in up to half of patients. Here, we conduct droplet-based single-cell RNA sequencing of 59,915 neoplastic and non-neoplastic cells from 8 primary and 3 metastatic UMs. Single-cell VDJ sequencing of RNA is conducted to determine clonally expanded B/T- cell populations. Single-cell DNA sequencing of 1 primary and 1 metastasis is utilized.

  Study phs001861

• Somatic L1 retrotransposition mapping in high-grade serous ovarian carcinoma using LDI-PCR/Nanopore-sequencing

  Somatic L1 retrotransposition was mapped in high-grade serous carcinoma (HGSC) tumors using LDI-PCR/Nanopore-seq method. This method identifies somatic L1 insertions originating from two active L1 loci at chr22q12.1 and chrXp22.2. Multiple tumors from the same patient were utilised to understand L1-mediated intrapatient heterogeneity. Long-read data generated by LDI-Nanopore sequencing was aligned to the reference genome (GRCh38).

  Dataset EGAD50000001707

• DNA-seq BAM files from 16 patients affected by acute intermittent porphyria

  Paired-end BAM files from 16 patients affected by acute intermittent porphyria. Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). FASTQ files were processed at the CNAG (Barcelona) using the GEM short-read aligner on the human genome version hs37d5, producing a total of 16 BAM files.

  Dataset EGAD00001006951

• Sequencing data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Repli-seq data for "Replication timing alterations are associated with mutation acquisition during tumour evolution in breast and lung cancer"

  Dataset EGAD00001015363

• RNA_TPO3_2023

  Human engineered CRC organoids (APC KO; KRAS G12D; TP53 KO) were grown in either glucose or lactate, in the presence and absence of DCA or BRD4 inhibition (JQ1). Samples were collected and processed for bulk RNA-seq.

  Dataset EGAD50000000089

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Long-read RNA-seq of doxycycline-inducible DUX4 human myoblast cell lines

  The dataset includes the PacBio full-length isoform sequencing data of DUX4i myoblasts (Clone-5) with and without 16-hour DOX-treatment (referred to as DUX4- and DUX4+; n=1 in each condition).

  Dataset EGAD50000000718

• RNA-Seq of primary pediatric kidney tumor controls for the soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008709

• Gene expression in human monocyte differentiation

  This dataset consists of RNA-seq data data from human monocytes, monocyte-derived dendritic cells or monocyte-derived macrophages as well as monocyte-derived cells that were subjected to siRNA treatment targeting TET2, IRF4 and EGR2. In total, it includes 43 samples.

  Dataset EGAD00001006604

• Immune single-cell profiling of human chronic inflammatory skin disease

  This dataset includes 10X Genomics 3' single cell-RNA-seq profiles from 24 human rashes and 7 healthy controls. BAM files are provided for each sample.

  Dataset EGAD00001008624

• Log2 normalized TPM matrix for POPLAR (GO28753)

  This dataset contains log2(TPM + 1) for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008390

• Log2 normalized TPM matrix for OAK (GO28915)

  This dataset contains log2(TPM + 1) for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008391

• Gene expression in LPS-stimulated human monocyte-derived macrophages

  This dataset consists of RNA-seq data from human monocyte-derived macrophages that were subjected to siRNA treatment targeting RAD21 and either left untreated, or stimulated with LPS. In total, it includes 24 samples.

  Dataset EGAD00001007952

• Atypical teratoid/rhabdoid tumoroids reveal subgroup-specific drug vulnerabilities - RNA-Seq

  We demonstrate that ATRT tumoroids retain subgroup-specific epigenetic and gene expression profiles

  Dataset EGAD00001009794

• 17 scRNAseq samples

  17 samples were processed for single cell RNA sequencing (SORT-seq)

  Dataset EGAD00001007523

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• Expression Quantitative Trait Locus Mapping Studies in Mid-Secretory Phase Endometrial Cells Identifies HLA-F and TAP2 as Fecundability-Associated Genes

  We performed an unbiased genome-wide expression quantitative trait locus (eQTL) mapping study to identify common regulatory (expression) single nucleotide polymorphisms (eSNPs) in mid-secretory endometrium, corresponding to the luteal phase of the ovarian cycle. Biopsies were collected from 58 women with two or more early pregnancy losses and 53 of these samples passed all quality control. RNA was extracted from endometrial biopsies and DNA was extracted for sequencing from blood. Gene expression data can be found at NCBI GEO Series GSE77688.

  Study phs001146

• Comprehensive genomic characterization of early stage bladder cancer - nanopore sequencing

  For this project about non-muscle invasive bladder cancer (NMIBC), we analysed long read sequencing data from 4 patients using the Nanopore platform. The dataset is composed of 8 BAM files: 4 tumor samples and 4 paired blood samples.

  Study EGAS50000000510

• TRACERx100 metastatic samples

  Whole exome sequencing of 10 metastatic biopsies from four TRACERx100 patients (see EGA dataset EGAS00001002247), collected either after relapse or death. The data from these samples are initially published with Abbosh, C. et al. Phylogenetic ctDNA analysis depicts early stage lung cancer evolution. Nature, http://dx.doi.org/10.1038/nature22364 (2017). Abstract: Earlier detection of relapse following primary surgery for non-small cell lung cancer and the characterization of emerging subclones seeding metastatic sites might offer new therapeutic approaches to limit tumor recurrence. The potential to non-invasively track tumor evolutionary dynamics in ctDNA of early-stage lung cancer is not established. Here we conduct a patient-specific approach to ctDNA profiling in the first 100 lung TRACERx (TRAcking Cancer Evolution through therapy (Rx)) study participants, including one patient co-recruited to the PEACE (Posthumous Evaluation of Advanced Cancer Environment) post-mortem study. We identify independent predictors of ctDNA release in early-stage non-small cell lung cancer and perform tumor volume limit of detection analyses. Through blinded profiling of post-operative plasma, we observe evidence of adjuvant chemotherapy resistance and identify patients destined to experience recurrence of their lung cancer. Finally, we show that phylogenetic ctDNA profiling tracks the subclonal nature of lung cancer relapse and metastases, providing a new approach for ctDNA driven therapeutic studies.

  Dataset EGAD00001003301

• Dataset for colorectal_cancer-RNA

  Rare cancer sequencing data of 97 runs in tumor/control pairs, which were uploaded to umbrella studies. The sequencing was always paired

  Dataset EGAD00001008855

• Loss of RREB1 in pancreatic beta cells reduces cellular insulin content and affects endocrine cell gene expression

  Genome-wide studies have uncovered multiple independent signals at the RREB1 locus associated with altered type 2 diabetes (T2D) risk and related glycemic traits. However, little is known about the function of the zinc finger transcription factor RREB1 in glucose homeostasis or how changes in its expression and/or function influence diabetes risk. We studied its function using three transcriptomic strategies, profiling gene expression when RREB1 is knocked out or knocked down in the Endo-betaH1 cell line, in addition to the in vitro differentiation in hiPSCs.

  Dataset EGAD00001009740

• TGF-β attenuates tumour response to PD-L1 blockade by contributing to exclusion of T cells.

  We examined tumours from a large cohort of patients with metastatic urothelial bladder cancer (mUC) treated with an anti–PD-L1 agent (atezolizumab) and identified major determinants of clinical response and immune escape. Whole transcriptome profiles were generated for 368 patients using TruSeq RNA Access technology (Illumina). Somatic mutations were determined via whole exome sequencing for a subset of these patients. - Response was associated with CD8+ T effector cell phenotype and, to an even greater extent, high neoantigen or tumour mutation burden (TMB). On the other hand, lack of response was associated with a transforming growth factor β (TGF-β) signature, particularly in patients with CD8+ T cells preferentially residing in collagen-rich matrix surrounding tumours. Integration of these three independent biological features provided the best basis for understanding outcome in this setting. -

  Study EGAS00001002556

• Single cell RNA sequencing of 33 primary colorectal cancer

  Study EGAS00001003779

• Genes and Blood Clotting Study (GABC)

  Objectives: Use genome-wide approaches to identify genetic variants that influence common thrombosis and hemostasis factors, as well as selected common human traits. Design/Methods: The GABC study was a prospective sibling cohort design. Siblings were recruited by targeted email to the undergraduate and graduate student email lists at the University of Michigan. Healthy persons between 14 and 35 years old who had healthy siblings within the same age restriction were able to participate. Study participants agreed to an online informed consent and subsequently completed a 52-question online survey describing their specific bleeding traits as well as many common human traits. Fifty milliliters of blood was collected into a citrate-dextrose solution (ACD) from each participant. An aliquot of whole blood was used for an automated complete blood count analysis and the remainder was processed into platelet poor plasma and buffy coat portions. Plasma and buffy coat aliquots were snap frozen and stored in liquid nitrogen for future studies. 1189 individuals representing 507 sibships were collected between 06/26/2006 and 01/30/2009. Phenotyping Survey Details: To characterize individual bruising and bleeding history, the online survey recorded answers to questions based on a modified von Willebrand Disease (VWD) screening questionnaire. To characterize a collection of participant's common human traits, the survey recorded answers to questions about height, weight, presence of skin tags, history of acne, eye color, hair color, hair line characteristics, skin sunburn sensitivity, skin tanning ability, natural skin color, freckling, cheek dimpling, earlobe shape, shoe size, foot arch characteristics, hand fifth digit morphology, history of dyslexia, history of migraine headaches, history of seasonal allergies, history of apthous ulcers, tendency to sneeze while walking into a bright sunny place, history of dental caries, need for corrective eye lenses, handedness and like or dislike of strongly flavored foods. Biochemical phenotyping: Assays for plasma Von Willebrand Factor (VWF) antigen were performed using ELISA and "Alphalisa" techniques. Automated complete blood count analysis was performed on a Bayer Advia 120 on all participants (including WBC differential, RBC indices, and platelet count.) For the dbGaP v2 update, new biochemical phenotypes have been submitted and include von Willebrand Factor, von Willebrand Factor propeptide, plasminogen, gamma prime fibrinogen, ADAMTS 13, antithrombin III, protein C, and protein S. All new phenotypes were obtained using "Alphalisa" techniques. Genotyping Details: SNP genotyping was performed using genomic DNA extracted from peripheral blood at the Broad Institute, (MIT/Harvard). Genotyping was performed on the Illumina Omni-1 quad chip at the Broad Institute. For the dbGaP v2 update, genotyping data from the Illumina Human Exome was deposited. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to blood clotting through large-scale genome-wide association studies of siblings. Genotyping was performed at the Broad Institute of MIT and Harvard, a GENEVA genotyping center. Data cleaning and harmonization was performed by the primary investigators at the University of Michigan, Ann Arbor, and at the GEI-funded GENEVA Coordinating Center at the University of Washington. This study serves as a resource for investigators who are interested in the genetic determinants of specific plasma proteins in a healthy population. The sibling cohort design allows for linkage analysis in addition to association studies. Analysis of thrombosis and hemostasis related traits should help elucidate specific biochemical and genetic networks that maintain hemostasis. We hope to identify specific genetic determinants of VWF levels in order to better understand the factors that influence the development of VWD.

  Study phs000304

• Childhood B-cell acute lymphoblastic leukemia genomic and transcriptomic data

  The aim of the two studies was: 1) to genetically characterise childhood leukemia patients that lacked established cytogenetic abnormalities (termed B-other leukemia) and assess the clinical features of recurrent genetic abnormalities. 2) Assess the accuracy of whole genome sequencing as a diagnostic genetic test in childhood leukemia, relative to other traditional methods (karyotyping, FISH, MLPA) and whole transcriptome sequencing. As a result, this study includes targeted DNA-sequencing, whole genome sequencing and whole transcriptome sequencing data on childhood leukemia patients enrolled on UK clinical trials (UKALL2003 and UKALL2011).

  Study EGAS00001006863

• Breast Cancer Family Registry

  The Breast Cancer Family Registry (BCFR) is a multi-center prospective cohort, comprised of over 30,000 women and men from nearly 12,000 families from the United States, Canada, and Australia. Our BCFR resource has been used, and continues to be used, by breast cancer researchers around the world in order to find new ways to prevent, diagnose, and treat cancer. The BCFR provides an extensive and diverse range of resources, expertise, and specialized skills, and has several unique strengths: 1) the collection of a large number of individuals and families across a wide spectrum of breast cancer risk, including both affected and unaffected individuals; 2) the large collection of families with early-onset breast cancer; 3) the large collection of racial/ethnic minority families not replicated elsewhere; 4) the extensive molecular characterization performed to date; and 5) active follow-up of both probands and family members. Thus, the BCFR comprises a unique cohort of probands and family members at familial/genetic risk of breast cancer that will continue to facilitate a wide range of research studies, such as gene discovery, examination of cancer-related outcomes and risk factors in high-risk subjects, investigation of novel behavioral interventions, and cancer prevention trials among at-risk family members. Consequently, the BCFR Cohort, as one of the few cohorts available worldwide with biospecimens and extensive molecular and genetic characterization, combined with epidemiologic data and long-term follow up, will be an invaluable resource for translational research in the genetic epidemiology of breast cancer.

  Study phs002835

• Colon Cancer Family Registry (Colon CFR)

  The Colon Cancer Family Registry Cohort (CCFRC www.coloncfr.org) is a cohort of families recruited through six study sites located in the USA, Canada, Australia, and New Zealand. The CCFRC was formed as a resource to support studies on the etiology, prevention, and clinical management of colorectal cancer. Recruitment protocols fall broadly into two main categories: population-based and clinic-based ascertainment. Between 1998 and 2013, the CCFR recruited and interviewed probands who were either recently diagnosed with colorectal cancer that was reported to state or regional population cancer registries in the United States (Washington, California, Arizona, Minnesota, Colorado, New Hampshire, North Carolina, and Hawaii), Australia (Victoria), and Canada (Ontario) or were from multiple-case families referred to family-cancer clinics in the United States (Mayo Clinic in Rochester, Minnesota, and Cleveland Clinic in Cleveland, Ohio), Australia (Melbourne, Adelaide, Perth, Brisbane, and Sydney), New Zealand (Auckland), and Canada. Cases with known familial adenomatous polyposis were excluded. Once recruited, probands were asked for permission to contact their relatives for recruitment. Collectively, we have enrolled 42,49874 participants in 15,048 families who participated in standardized protocols used to collect information regarding family cancer history and colorectal cancer risk factors and biospecimens. All participants of population-based case families (excluding control-families) and clinic-based families are asked to provide updates on their personal and family history of cancer as well as their history of surgery, cancer screening, and some risk factors every 4-5 years either by telephone interview or by self-completed questionnaire via mail or online (PMID: 17982118).

  Study phs002733

• 1. Identidication of molecular biological mechanism associated with the development and prognosis of uterine cancer, uterine sarcoma, and endometrial hyperplasia / 2. Identification of molecular biological mechanism associated with the development of endometriosis and malignant transformation, ovarian cancer, fallopian tubal cancer, peritoneal cancer, and other malignant tumors in gynecological organs

  To identify molecular subtypes and carcinogenesis in clear cell ovarian carcinomas by whole-exome sequencing, RNA-sequencing, and methylation array, and to characterize high-grade serous carcinomas by NGS-based, integrative genomic analyses, with focus on homologous recombination deficiency, molecular subtypes and prognositic factors.

  Study JGAS000560

• Integrating Circulating Tumor DNA Analysis and Radiomics for Dynamic Risk Assessment in Localized Lung Cancer

  DNA was isolated from pre-treatment and mid-treatment plasma samples and matched germline samples from patients undergoing chemoradiation therapy for stage IIB-IIIB non-small cell lung cancer. Sequencing libraries were hybrid captured using custom selector pools designed to target genes frequently mutated in non-small cell lung cancer prior to ultra-deep next generation sequencing.

  Study phs003947

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• CALGB 40601: Randomized Phase III Trial of Paclitaxel Combined With Trastuzumab, Lapatinib, or Both As Neoadjuvant Treatment of HER2-Positive Primary Breast Cancer

  This randomized phase III trial studies paclitaxel and trastuzumab with or without lapatinib to see how well they work in treating patients with stage II or stage III breast cancer that can be removed by surgery. Drugs used in chemotherapy, such as paclitaxel, work in different ways to stop the growth of tumor cells, either by killing the cells, by stopping them from dividing, or by stopping them from spreading. Monoclonal antibodies, such as trastuzumab, can block tumor growth in different ways. Some block the ability of tumor cells to grow and spread. Others find tumor cells and help kill them or carry tumor-killing substances to them. Lapatinib may stop the growth of tumor cells by blocking some of the enzymes needed for cell growth. Giving paclitaxel with trastuzumab and/or lapatinib before surgery may make the tumor smaller and reduce the amount of normal tissue that needs to be removed. It is not yet known which regimen is more effective in treating patients with breast cancer.

  Study phs001570

• Cell-free DNA TAPS for early cancer detection

  Multimodal, genome-wide characterization of epigenetic and genetic information in circulating cell-free DNA (cfDNA) could enable more sensitive early cancer detection. However, due to technological challenges associated with DNA methylation sequencing in low input cfDNA samples, most studies have been limited by DNA damage caused by bisulfite sequencing, or the qualitative nature of enrichment-based sequencing. Recently, we developed TET-assisted Pyridine Borane Sequencing (TAPS), which is a mild, bisulfite-free method for base-resolution direct DNA methylation sequencing. Here we optimized TAPS for cfDNA (cfTAPS) to provide high-quality and high-depth whole-genome cell-free methylomes. We applied cfTAPS to 85 cfDNA samples from patients with hepatocellular carcinoma (HCC) or pancreatic ductal adenocarcinoma (PDAC) and non-cancer controls. From just 10 ng cfDNA (1-3 mL of plasma), we generated the most comprehensive cfDNA methylome to date. We demonstrated that cfTAPS provides multimodal information about cfDNA characteristics, including DNA methylation, tissue of origin, and DNA fragmentation. Integrated analysis of these epigenetic and genetic features enables accurate identification of early HCC and PDAC.

  Study EGAS00001004962

• MIBS MGS

  Metagenomic sequencing of the human gut in Maastricht IBS studies, cases and controls.

  Study EGAS00001001924

• Developing Targeted Therapy for Patients with Multiple Myeloma and Gain or Amplification of Chr1q (1q+)

  Multiple myeloma (MM) frequently presents with gain or amplification of chr1q (1q+), which is associated with inferior response to treatment and poor outcomes. To develop targeted therapy for MM with 1q+, we leveraged external and in-house dependency screens and drug screens, along with single-cell sequencing of patient tumors with subclonal 1q+. We demonstrated that MM with 1q+ exhibits higher sensitivity to MCL1 and PI3K inhibitors, which may be synergistic and act through established and novel mechanisms. Two human MM cell lines with 1q+, KMS12BM and KMS11, were profiled with either single-cell RNA-sequencing (scRNA-seq) alone (KMS12BM, KMS11) or both scRNA-seq and whole-genome sequencing (WGS; KMS12BM) to understand the factors that determine response to MCL1 and PI3K inhibitors and how these inhibitors work.

  Study phs003886

• National Human Genome Research Institute Tumor Sequencing Project (TSP) - Lung Adenocarcinoma

  The Tumor Sequencing Project (TSP) Consortium is a collaboration among participants at the Baylor College of Medicine Human Genome Sequencing Center, the Broad Institute Genome Sequencing Platform, the Dana Farber Cancer Institute, the Memorial Sloan-Kettering Cancer Center, the Genome Sequencing Center and Siteman Cancer Center at Washington University, the M.D. Anderson Cancer Center and the University of Michigan Medical Center. The TSP Part A will pilot approaches to large-scale identification of genomic changes in tumors by sequencing the exonic regions of 623 genes in 188 specimens of adenocarcinoma of the lung, as well as using high density SNP genotyping arrays for high resolution identification of changes in chromosomal copy number. The TSP Part B will pilot approaches to tumor characterization of lung adenocarcinoma samples using next-generation sequencing technologies and benchmark those results against Part A data generated with ABI3730 instruments.

  Study phs000144

• Genomic alterations in MM - CEL

  RNA from the same tumor sample (n=98) was also processed using the 3' IVT kit (Affymetrix) and hybridized to U133 Plus 2.0 arrays (Affymetrix).

  Dataset EGAD00010001577

• Single-cell RNA-sequencing of H3-K27M diffuse midline glioma.

  Fastq files are deposited for single-cell transcriptomes of patient H3-K27M diffuse midline gliomas, generated using the SMART-seq2 method.

  Dataset EGAD00001011339

• EED inhibition of organoid development

  Transcriptomics and epigenomics after chemical inhibition of EED during early human brain organoid development. To investigate the role of H3K27me3 inhibition during neuroectoderm induction, we treated brain organoids with 3 concentrations of EED inhibitor (and control) during the transition of pluripotency to neuroepithelium. At the neuroepithelium stage, we profiled the organoids using scRNA-seq (transcriptome) and bulk Cut&Tag (H3K27me3, H3K27ac). Library preparation for scRNA-seq was carried out with the 10x genomics platform.

  Dataset EGAD50000000224

• DNA-seq FASTQ files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by HPAH

  Paired-end DNA-seq FASTQ files from 16 carriers of the BMPR2 p.Arg491Gln mutation in a family affected by hereditary pulmonary arterial hypertension (HPAH). Whole genome sequencing of these samples was performed in an Illumina HiSeq 4000 instrument. Libraries were prepared using the Fisher PE Kit (Kapa Biosystems). Each sample was multiplexed across flowcells and lanes, leading to a total number of 86 FASTQ files.

  Dataset EGAD00001005756

• Epithelioid haemangioendothelioma (EHE) case series from the Stafford Fox Rare Cancer Program

  Nine EHE cases with comprehensive histologic and molecular profiling from the Walter and Eliza Hall Institute of Medical Research Stafford Fox Rare Cancer Program were collated via nation-wide referral to the Australian Rare Cancer Portal. Molecular analysis of RNA, DNA or both was possible in seven of nine cases. Survival was highly variable and unrelated to molecular profile. DNA sequences for two cases are deposited here.

  Study EGAS00001007474

• RNA sequencing, ATACseq, and TCR-seq of Tfh cells and CXCR5- CD4+ T cells in HIV infected lymph nodes

  The high dimensional analyses of CD4+ T cells in human lymph nodes are case-based analyses of the TCR repertoire, transcriptome, and epigenetic signatures of various CD4+ T cells in human lymph nodes. The study aims to determine clonal overlap between phenotypically distinct CD4+ T cells and the similarities between these populations on transcriptional and epigenetic levels. This study performs TCR repertoire sequencing using Molecular Identifier Clustering-based Immune Repertoire Sequencing (MIDCIRS). We found clonal overlap between a population of CXCR5- T cells and follicular helper T (Tfh) cells. We also show epigenetic and transcriptional similarities between CXCR5-PD-1+ T cells and Tfh cells. This study shares an overlapping set of donors with phs001548.

  Study phs001849

• Development and Use of Network Infrastructure for High-Throughput GWA Studies

  The "Development and Use of Network Infrastructure for High-Throughput GWA Studies" project is collaboration between Group Health Cooperative (GH), the University of Washington (UW), and the Fred Hutchinson Cancer Research Center (FHCRC). It is one of 5 sites participating in The Electronic Medical Records and Genomics (eMERGE) Network funded by the National Human Genome Research Institute (NHGRI) with additional funding from the National Institute of General Medical Sciences (NIGMS). The overall eMERGE project is designed to assess whether linking biorepositories of patients in healthcare delivery systems with electronic medical records (EMRs) is an efficient strategy for high-throughput genome wide association (GWA) studies and whether information can be pooled across sites. The primary phenotype in the Group Health/UW Aging and Dementia eMERGE study project is dementia. Phenotyped participants originated from four population-based sources. Seattle-area members of GH (a large integrated health care system in Washington State) consented and enrolled in 1) the University of Washington Alzheimer's Disease Patient Registry (ADPR) and 2) the Adult Changes in Thought (ACT) study, 3) Marshfield Clinic Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults, 4) Vanderbilt's BioVU, a de-identified DNA biobank. The ADPR (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is a population-based registry of incident dementia cases designed to identify all new dementia cases within GH from 1987 to 1996. Potential dementia cases were identified through referrals from primary care physicians, mental health services, and neurologists, as well as review of CT scans, neurology, emergency room, geriatrician, and mental health clinic logs, and hospital discharge diagnoses. Medical history, physical, laboratory testing, and neuropsychological testing were performed on all consenting potential cases. These data were reviewed by a consensus conference including a neuropsychologist, study physicians, and an epidemiologist. After discussion of the case, dementia status is assigned using DSM-III-R criteria. Alzheimer's disease status was assigned using the National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) criteria. The study base of the ADPR population was stable with an attrition rate of less than 1%/year. The ACT study (PI: Eric B. Larson; NIH/NIA U01 AG 006781) is an ongoing community-based cohort study designed to determine the incidence of Alzheimer's Disease (AD), other types of dementia, and cognitive impairment and to determine risk factors for these conditions. The original cohort of 2,581 was enrolled in 1994-1996. An expansion cohort of 811 was enrolled in 2000-2002. Continuous enrollment to keep 2,000 persons enrolled and at-risk for dementia outcomes was begun in 2005. To date the study has accrued more than 4,000 participants. Dementia-free participants are enrolled in this cohort and evaluated every two years by study personnel with many evaluations including an assessment of cognitive functioning using the Cognitive Abilities Screening Instrument (CASI), which is an extended version of the Mini-Mental State Examination that has been widely used in epidemiological studies of the elderly. Persons with CASI scores lower than 86 or in whom interviewers suspect unusual cognitive decline are followed up with dementia diagnostic evaluations which include physical and neurological examinations and neuropsychological tests. Medical records are reviewed, and laboratory tests and neuroimaging are obtained if not available. The dementia diagnoses and dementia subtypes are determined during a consensus conference attended by the examining clinicians and other study physicians, a neuropsychologist, and research nurse. After discussion of the case, dementia status is assigned using DSM-IV criteria. Alzheimer's disease status was assigned using NINCDS-ADRDA criteria. Individuals diagnosed with dementia are seen again one year following diagnosis using the same procedures. Individuals not diagnosed with dementia are returned to the pool of at-risk individuals and are seen at their next routinely scheduled biennial visit. The ACT sub-sample is stable; for the original cohort, median enrollment in GH was 19 years prior to joining the ACT study, and 85% of the cohort has ≥ 10 years of GH enrollment. DNA for the ADPR participants were obtained through a companion study, Genetic Differences in Cases and Controls (PI: Walter Kukull; NIH/NIA R01 AG007584). DNA obtained through both studies were extracted from blood using Gentra Systems Puregene methods. DNA concentration is determined by UV optical density. All samples are checked for quality by OD 260/280 ratio. For long-term storage, samples are aliquoted and stored at -70°C. The Marshfield study, Personalized Medicine Research Project (PMRP), a population-based DNA, plasma and serum biobank of 20,000 adults. PMRP was started in 2002 as a 3 Phase project. Completed in April 2004, the objectives of Phase I were to build and develop a large population-based biobank with DNA, plasma and serum samples to facilitate genomics research. Phase 1 was also to educate, inform and consult with the Marshfield Epidemiologic Study Area population and communities concerning potential studies, create the DNA foundation of the personalized medicine database and build the bioinformatics tools to store securely and analyze genotypic and phenotypic data. Phase I tasks included operation of the ethics and security advisory board, scientific advisory board and community advisory group. More than 18,000 residents aged 18 and above from 19 different zip codes surrounding Marshfield, WI were invited to participate in Phase I. After providing written informed consent, participants completed brief questionnaires that included questions about demographics, some environmental exposures, family history of disease, and adverse drug reactions, as well as family members living in the area. Participants provided 50ml of blood from which DNA was extracted and plasma and serum samples were stored. The informed consent process allowed access to electronic medical records and included language about non-disclosure of personal research results. A tick-off box was included so that participants could either allow or decline subsequent recontact for future research studied. The objectives of Phase II are to create the phenotypic database, establish the scientific and administrative infrastructure to support genetic mapping of the DNA and the initial discovery projects and genotype a sufficient portion of the genetic material to support these discovery projects. The objectives of Phase III are to expand the discovery projects, complete the genotyping of the genetic database and expand physician/health care provider education and community consultation. The Vanderbilt BioVU model uses discarded blood leftover from clinical care and de-identified clinical information, both of which are tracked with a Research Unique Identifier that is permanently disconnected from the medical record number used to generate it. The Vanderbilt IRB determined that the project does not qualify as "human subject" research under §46.102(f)(1)(2). The program has been reviewed by OHRP twice (the latest immediately prior to launch), and the determination of the Vanderbilt IRB that the project is consistent with the 8/10/2004 guidance has been validated. The model includes a simple opt out mechanism developed for patients who do not wish to have their samples included. Planning (including community involvement, ethics and IRB discussions, focus groups, development of operating procedures and pilot studies to assess them) began in May 2004, and the resource commenced sample collection in February 2007 and as of May 2009 contains approximately 56,000 samples. The current resource will be available to all Vanderbilt investigators who sign a Data Use Agreement. The resource represents Vanderbilt's broad patient population and thus provides a potential resource for research in a range of common and rare diseases as well as drug response or medication safety. BioVU patient protection model: There has been extensive involvement by the ethics community and the IRB to put in place procedures to provide privacy protection. The overall protection plan is multifaceted and includes a combination of technology and policy: (1) creation of the SD described above; (2) return of only the specific clinical data items requested by investigators (rather than the complete de-identified chart); (3) submission of any specific proposed project to the IRB and to a separate protocol review committee, both of which must approve; (4) implementing a Data Use Agreement that permits only approved queries and data analyses, specifically prohibits attempts at re-identification (at the risk of institutional sanctions), and mandates redeposit of all genetic information generated in a research study back into a genomic database; and (5) tracking and auditing all use.

  Study phs000234

• Clonal_expansion_of_mutated_cell_population_in_bladder_urothelium_

  1cm biospies of from patients undergoing bladder cystectomy will be collected. The underlying muscle and stroma will be removed and the remaining epithelia dissected into small sequential areas which will be sent for ultra-deep exome sequencing using a panel of known cancer and viral genes. Sequence analysis using similar methods to Martincorena I et al (Science 2015, 348:880) will provide an idea of the somatic mutational landscape in these patient samples. Individual patient muscle samples will also be sequenced as a reference.

  Study EGAS00001001687

• Bam files from Whole exome sequencing (WES, ~50x mean read depth) of metachronous bladder tumors

  In this study we characterized genomic alterations in two to five metachronous bladder tumors from 29 patients initially diagnosed with early stage disease. Fourteen patients (32 tumors) had non progressive disease (NPD) and 15 patients (34 tumors) had progressive disease (PD). Whole exome sequencing (WES, ~50x mean read depth and whole transcriptome RNA-seq was performed (RNA was not advalible for 4 tumors) Data provided here consist of 122 Bam files for WES (83 Tumors and 39 blood)

  Dataset EGAD00001002716

• The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk RNA-seq)

  RNA was isolated from purified human CD8 cells that were incubated with anti-HER2/CD3 TDB in the presence of SK-BR-3 cells. Sequencing libraries were generated and submitted for transcriptome profiling by high-throughput sequencing. Experiments were performed in triplicates for anti-HER2/CD3 TDB treatment and control. This Dataset is associated with the following ArrayExpress Experiment: E-MTAB-8211 - The effect of anti-HER2/CD3 TDB on transcription in human CD8 T cells (bulk)

  Dataset EGAD00001005187

• Integrated Exome-seq analysis of tumor thrombus

  We prospectively enrolled 83 patients with a renal mass and TT scheduled to undergo surgical resection. To accurately integrate genomic and transcriptomic findings and enable histological co-registration, simultaneous isolation of DNA and RNA was performed from individual samples characterized histologically through immediately flanking sections

  Study EGAS00001005511

• Single nucleus RNA Seq of LUAD patient derived lung samples

  Fastq files of single nucleus RNA Sequencing data from 26 patients including 26 lung adenocarcioma and 12 matched healthy tissue samples for 8 young female never smokers, 8 young female smokers, 7 elderly female never smokers and 3 male never smokers.

  Dataset EGAD00001008955

• Development of hunanized mice for human hematopoisis and immunity research

  We obtained peripheral blood or bone marrow samples from 112 acute myeloid leukemia patients and examined sensitivity and resistance of the AML samples to molecular targeting drugs. By doing RNA sequencing using AML cells, we found heterogenous gene expression patterns in AML with different mutational landscapes. From the RNA sequencing, we identified anti-apoptosis, cell cycle progression, and immune-related signals as pathways up-regulated in AML cells as compared with normal CD34+ cells. From the pathway analyses, we further setup in vitro experiments to find vulnerability genes in clinically-aggressive AML. BIRC, BCL2, MCL1, AURKB, and KIF10 may be essential molecules for AML cell survival and proliferation.

  Study JGAS000253

• Meisal temporal lobe epilepsy sequencing study

  Our understanding of mesial temporal lobe epilepsy (MTLE) is one of the most common forms of drug-resistant epilepsy in humans. Using RNA- and small RNA-sequencing in parallel, we explored differentially expressed genes in the hippocampus and cortex of MTLE patients who had undergone surgical resection and non-epileptic controls. We found significant enrichment for astrocytic and microglial genes amongst up-regulated genes and down-regulation of neuron-specific genes in the hippocampus of MTLE patients. The transcriptome profile of the small RNAs reflected disease state more robustly than mRNAs, even across brain regions which show very little pathology.

  Study EGAS00001003922

• (ChIP-seq) Shifted assembly and function of mSWI/SNF family subcomplexes underlie targetable dependencies in endometriod carcinomas

  ChIP-seq data of 18 samples from the VOA1066 undifferentiated endometrial carcinoma cell-line with various pulldowns: BRG1 (abcam, ab110642, GR3255117-11), BRD9 (CST, E4Q3F, Lot 1), ARID1A (CST, D2A8U, Lot 4), SS18 (CST, D6I4Z, Lot 1), PBRM1 (CST, D3F70, Lot 3), GLTSCR1 (CST, E6I3A, Lot 1), H3K27ac (CST, C36B11, Lot 16), or none. Sample were either untreated or received doxycycline-induced ARID1A treatment. Samples were sequenced on Illumina NextSeq 500 using 37 bp single-end sequencing parameters. Raw fastq files, along with processed bigwig files containing normalized genomic coverage, and called narrow peaks, are included for each sample.

  Dataset EGAD50000001473

• Preferential infiltration of distinct Vγ9δ2 T cells into Glioblastoma multiforme

  Glioblastoma multiforme (GBM), the most fatal CNS cancer, is highly infiltrative as a result of phenotypic alteration of cancer cells mainly driven by a mutual interaction among cancer cells, tumor-associated macrophages (TAMs) and other stromal cells. This work aims at characterizing GBM-infiltrating γδ T cells that may regulate the GBM tumor microenvironment and cancer cell gene expression. V(D)J repertoires of tumor-infiltrating and blood circulating γδ T cells from 4 patients were analyzed by NGS-based TCR sequencing. RNA gene expression profiling and immunostaining of cancer tissues were performed as well.

  Study EGAS00001002790

• RNA Sequencing of ECOG-E1308

  This study reports the RNA sequencing of HPV positive oropharyngeal squamous cell carcinoma samples from patients with HPV-associated stage III or stage IV cancer of the oropharynx that was surgically resectible. These patients participated in the ECOG-E1308 trial, a phase II trial that studied paclitaxel, cisplatin, and cetuximab followed by cetuximab and two different doses of intensity-modulated radiation therapy.

  Study phs003320

• A comprehensive assessment of somatic mutation detection in cancer using whole genome sequencing

  As whole genome sequencing for cancer genome analysis becomes a clinical tool, a full understanding of the variables affecting sequencing analysis output is required. Using tumor-normal sample pairs from two different types of cancer, chronic lymphocytic leukemia and medulloblastoma, we conducted a benchmarking exercise within the context of the International Cancer Genome Consortium. We compare sequencing methods, analysis pipelines, and even validation methods. Here we show that using PCR-free methods and increasing sequencing depth to ~100x showed benefits, as long as the tumor:control coverage ratio remains balanced. We observe widely varying mutation call rates and low concordance among analysis pipelines, reflecting the artifact-prone nature of the raw data and lack of standards for dealing with the artifacts. However, armed with the benchmark mutation set we have created, we show that many issues are in fact easy to remedy and have an immediate positive impact on mutation detection accuracy.

  Study EGAS00001001539

• 5' Single cell RNA sequencing of pre-treatment tissues from lung cancer patients receiving immunotherapy

  Study EGAS00001006188

• Fresh vs. frozen cell preparations of colorectal cancer single-cell RNA sequencing

  Study EGAS00001003769

• Somatic cancer gene mutation screening

  Sequencing of colorectal tumors and normal tissue using Ion AmpliSeq Cancer Hotspot Panel V2

  Dataset EGAD00001001010

• A spatiotemporal organ-wide gene expression and cell atlas of the developing human heart

  The process of cardiac morphogenesis in humans is incompletely understood. Its full characterization requires a deep exploration of the organ-wide orchestration of gene expression with a single-cell spatial resolution. Here, we present a molecular approach that reveals the comprehensive transcriptional landscape of cell types populating the embryonic heart at three developmental stages, and which maps cell type-specific gene expression to specific anatomical domains. Spatial Transcriptomics identified unique gene profiles corresponding to distinct anatomical regions in each developmental stage. Human embryonic cardiac cell types identified by single-cell RNA-sequencing confirmed and enriched the spatial annotation of embryonic cardiac gene expression. In situ sequencing was then used to refine these results and create spatial subcellular map for the three developmental phases. Finally, we generated a publicly available web resource of the human developing heart to facilitate future studies on human cardiogenesis.

  Study EGAS00001003996

• The Acquisition of Molecular Drivers in Pediatric Therapy-Related Myeloid Neoplasms

  Pediatric therapy-related myeloid neoplasms (tMN) occur in children after exposure to cytotoxic therapy and have a dismal prognosis1-4. The somatic and germline genomic alterations that drive these myeloid neoplasms in children and how they arise have yet to be comprehensively described. We use whole exome, whole genome, and/or RNA sequencing to characterize the genomic profile of 85 pediatric tMN cases (tMDS: n=29, tAML: n=56). Our data show that Ras/MAPK pathway mutations, alterations in RUNX1 or TP53, and KMT2A rearrangements are frequent somatic drivers, and we identify cases with aberrant MECOM expression secondary to enhancer hijacking. Unlike adults with tMN5-7, we find no evidence of pre-existing minor tMN clones (including those with TP53 mutations), but rather the majority of cases were unrelated clones arising as a consequence of cytotoxic therapy. These studies also uncover rare cases of lineage switch disease rather than true secondary neoplasms.

  Study EGAS00001004850

• A microRNA-signature that correlates with cognition and is a target against cognitive decline

  While some individuals age without pathological memory impairments, others develop age-associated cognitive diseases. Since changes in cognitive function develop slowly over time in these patients, they are often diagnosed at an advanced stage of molecular pathology, a time point when causative treatments fail. Thus, there is great need for the identification of inexpensive and minimal invasive approaches that could be used for screening with the aim to to identify individuals at risk for cognitive decline that can then undergo further diagnostics and eventually stratified therapies. In this study we use an integrative approach combining the analysis of human data and mechanistic studies in model systems to identify a circulating 3-microRNA signature that reflect key processes linked to neural homeostasis and informs about cognitive status. We furthermore provide evidence that expression changes of this signature represent multiple mechanisms de-regulated in the aging and diseased brain and are a suitable target for RNA therapeutics.

  Study EGAS00001005627

• Identification of responsible genes and development of standardized medicine for familial breast cancer by genetic analysis with NGS technology

  Aims: To clarify risk of germline variants of known causal genes for Hereditary Breast Ovarian Cancer Syndrome in Japan by combinatorial analysis of somatic and germline variants in the breast cancer tissue. Methods: Target caputure analysis by using Illumina HiSeq 2000; the panel genes are 119 genes including 30 HBOC known causal genes. Participants/Materials: 108 whole blood and 124 primary tumor samples from familial breast cancer patients.

  Study JGAS000224

• Whole-Exome Sequencing analyses in tamoxifen-associated endometrial cancer

  An increased incidence of endometrial cancer has been described for patients that have received tamoxifen to treat breast cancer. Using samples from endometrial tumors, isolated from surgivcal specimens of patients who previously received tamoxifen treatment for breast cancer, we aimed to identify whether there are specific somatic mutations enriched in this population, relative to endometrial tumors from the general population. For this, WES was performed on matched endometrial tumors and healthy tissue (n=21).

  Study EGAS00001006453

• Dataset for WGS and RNA samples of acute myeloid leukemia with MNX1 expression

  This dataset contains 10 samples of WGS, ATAC, 4C and RNAseq samples of patients with acute myeloid leukemia. The sequencing was performed on Illumina HiSeq 4000, 2000 and HiSeq X using Illumina TruSeq Nano DNA and Agilent Strand Specific RNA Kits. The sequencing was always paired.

  Dataset EGAD50000001098

• Single-cell RNA sequencing generated from 11 glioma patient samples

  This dataset includes paired-end fastq files from 6 IDH-mutant, 5 IDH-wild-type glioma patient samples of unmatched initial and recurrent timepoints profiled using single-cell RNA sequencing.

  Dataset EGAD00001007772

• Whole-Exome Sequencing and Targeted DNA Sequencing of Matched Ocular Melanocytosis and Uveal Melanoma

  Ocular melanocytosis is the most important predisposing condition for the eye cancer uveal melanoma (UM). Here we used whole-exome and deep targeted sequencing to identify for the first time a clonal Gq pathway mutation in ocular melanocytosis, which gave rise to UM. Additionally, we elucidated the order in which canonical genetic aberrations were acquired during tumor evolution. These findings provide a mechanistic explanation for the well-known clinical association of ocular melanocytosis with UM, and they provide new insights into UM tumor evolution. Reprinted from: Durante MA, Field MG, Sanchez MI, Covington KR, Decatur CL, Dubovy SR, Harbour JW. Genomic evolution of uveal melanoma arising in ocular melanocytosis, with permission from Cold Spring Harbor Molecular Case Studies.

  Study phs001835

• Genomic characterization of esophageal squamous cell carcinoma reveals critical genes underlying tumorigenesis and poor prognosis

  The genetic mechanisms underlying the poor prognosis of esophageal squamous cell carcinoma (ESCC) are not well understood. In this study, we comprehensively characterized somatic mutations, copy number alterations (SCNAs)/structural variants (SVs) found in ESCC from sequencing 10 whole-genome and 57 whole-exome matched tumor-normal pairs. We identified multiple somatic mutations seen previously in known cancer pathways and identified candidate genes for ESCC including VANGL1 and MIR4707. A survival analysis based on the expression profiles of 321 ESCC individuals indicated that the somatically altered genes we found were significantly associated with ESCC poorer survival. Subsequently, we performed functional studies to validate the roles of the altered genes in tumor proliferation and metastasis.

  Study EGAS00001001723

• Genomic data used in "ACT-Discover: identifying karyotype heterogeneity in pancreatic cancer evolution using ctDNA"

  Genomic data used in "ACT-Discover: identifying karyotype heterogeneity in pancreatic cancer evolution using ctDNA"

  Dataset EGAD00001010250

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• DAC for Studies of "Genetics and Genomics of Cardiovascular Diseases" Group at MDC Berlin, Germany

  DAC for Studies of "Genetics and Genomics of Cardiovascular Diseases" Group at MDC Berlin This is an umbrella DAC.

  Dac EGAC50000000481

• Dual inhibition of FLT3 and BCL-2 is effective in preclinical models of BCL11B-activated lineage ambiguous leukemia

  Aberrant activation of BCL11B (“BCL11B-a”) defines a subtype of lineage ambiguous leukemias with T-lymphoid and myeloid features, co-occurring activating FLT3 mutations, and a stem/progenitor immunophenotype and gene expression profile. As with other lineage ambiguous leukemias, optimal treatment is unclear and there are limited targeted therapeutic options. Here, we investigated the efficacy of BCL-2 and FLT3 inhibition with venetoclax and gilteritinib, respectively, in preclinical models of BCL11B-a leukemia. Despite variation in response to single agent therapies, the combination of venetoclax plus gilteritinib was highly effective in all models evaluated. BH3 profiling and single cell RNA-seq analysis suggests that resistance to venetoclax and/or gilteritinib monotherapies is due to the tumor-intrinsic activity of BCL-xL and/or MCL-1 prior to drug treatment. These data support clinical evaluation of venetoclax in combination with gilteritinib in BCL11B-a lineage ambiguous leukemias.

  Study EGAS50000000978

• Organoid drug profiling identifies methotrexate as a therapy for SCCOHT, a rare pediatric cancer

  Small cell carcinoma of the ovary, hypercalcemic type (SCCOHT) is a rare and lethal tumor in adolescent and young adult patients. Currently, there is no standard-of-care treatment for these patients. Reliable models that represent this disease and can be used for translational research are scarce. To model SCCOHTs, we have established eight patient-derived tumoroid lines from tumor lesions of three patients with SCCOHT. The tumoroids recapitulate genomic and transcriptomic characteristics of the corresponding patient tumors and capture intrapatient tumor heterogeneity. Organoid drug profiling using a library of 153 clinical compounds identified methotrexate as an effective and selective drug against SCCOHTs with a clinically relevant IC50 of 35 nmol/L. RNA sequencing demonstrated that methotrexate induced TP53 pathway activation and apoptosis. These data underscore that organoid technology can support the design of therapeutic strategies for rare cancers.

  Study EGAS00001007911

• Single-cell and spatial transcriptomic profiling of hormone-naïve localised prostate cancer

  Localised prostate cancers (PCa) are heterogeneous and multifocal, with diverse outcomes. Current prognostic methods are epithelium-centric, overlooking the complex cellular landscape within the tumour microenvironment (TME), which remains incompletely characterised. We performed a comprehensive analysis of cancerous and adjacent-benign cores from 24 patients with hormone therapy-naïve localised PCa using single-cell RNA-sequencing. By integrating copy number variation and transcriptional signatures, we classified epithelial cells across a malignant spectrum, revealing widespread molecular perturbation. We found an expansion of Club cell phenotypes, suggestive of Luminal dedifferentiation. We also performed a detailed annotation of stromal phenotypes, focusing on fibroblasts, and identified a novel peri-neural fibroblast population. Spatial transcriptomics elucidated the precise anatomical distribution of CAFs within the PCa TME. This study provides a valuable foundation for advancing our understanding of PCa pathobiology and developing a comprehensive cellular model of the disease.

  Study EGAS00001008332

• Gene-Specific RNA Sequencing in PLCG2-Associated Immune Dysregulation with Cold Urticaria

  This study utilized gene-specific RNA-sequencing of PLCG2 to screen for disease causing in-frame exon-skipping transcripts of PLCG2 in a collection of 9 subjects with cold urticaria, 2 subjects with known PLCG2-associated antibody deficiency and immune dysregulation (PLAID)-causing deletions of PLCG2 (positive controls) and 3 healthy subjects (negative controls). Full length cDNA of PLCG2 was generated using gene specific reverse transcription of peripheral blood mononuclear cell RNA. The full length PLCG2 cDNA was used as the template to create Illumina sequencing libraries. To identify the underlying genetic basis for the exon-skipping transcripts, trio-based whole genome sequencing was performed for probands in whom in-frame exon-skipping transcripts of PLCG2 were identified.

  Study phs003807