10960 results for "fc 26 coins u7buy Visit Buyfc26coins.com Megkaptam az FC 26 érméket a garantált idő előtt. Mindig bonuszként!.HNTf"

in 48.23 milliseconds.

• Genome-Wide Association Study of Breast Cancer in the African Diaspora - the ROOT study

  The paucity of data on the genetic epidemiology of breast cancer for racial/ethnic groups other than those of European ancestry hinders the development of innovative interventions to reduce health disparities. Women in the African Diaspora experience a disproportionate burden of pre-menopausal breast cancer in comparison to all other races for reasons that remain unknown and understudied. This higher proportion of early-onset breast cancer might suggest a stronger genetic component in these populations. Genome-wide association studies (GWAS) have revealed several genetic loci that confer risk of breast cancer. Because all GWAS started the discovery stage in women of European ancestry and replicated mainly in women of European ancestry, we propose a novel approach for a GWAS in indigenous African women to identify alleles associated with breast cancer risk which will then be replicated in other populations. This innovative design builds on our current understanding of the etiologic heterogeneity in breast cancer and the distribution of breast cancer molecular subtypes which differ between women of African ancestry and women of European ancestry. The major objective of the proposed studies is to get to the "root" causes of breast cancer by identifying breast cancer risk alleles in a pooled sample of women of African ancestry and to replicate our findings in other populations. To achieve this objective, we conducted a case control study of breast cancer in women of African ancestry, including Africans living in Nigeria, African Americans and African Barbadians. We will genotype ~3800 individuals using the Illumina HumanOmni2.5-Quad platform. We will conduct both standard and novel genetic analyses of the data to map genes associated with breast cancer susceptibility, verify genotyping and carry out fine-mapping studies in genes or regions showing association with breast cancer risk, and replicate in other African American and non-African American populations. By pooling unique resources from studies throughout the African Diaspora, this study has the potential to identify risk alleles in several genes that contribute to increased breast cancer risk and may have implications for early detection, prognosis and treatment of breast cancer in ALL women. This should ultimately lead to improved outcomes for those who suffer a disproportionate burden of early-onset breast cancer.

  Study phs000383

• Foregut Microbiome in Development of Esophageal Adenocarcinoma

  The distal esophagus is an important anatomical area where gastric acid reflux can cause reflux esophagitis (RE), Barrett's esophagus (BE) (intestinal metaplasia), and esophageal adenocarcinoma (EA). The incidence of EA has increased 6-fold in the U.S. since the 1970s, parallel to a significant increase in the prevalence of gastroesophageal reflux diseases (GERD). Although specific host factors might predispose one to disease risk, such a rapid increase in incidence must be predominantly environmental. The cause remains unknown. Our hypothesis is that changes in the foregut microbiome are associated with EA and its precursors, RE and BE in the GERD sequence. We will conduct a case control study to characterize the microbiome in every stage of the GERD sequence as well as analyze the trend in changes in the microbiome along disease progression toward EA. Specific Aim 1. To conduct a comprehensive population survey of the foregut microbiome and demonstrate its association with GERD sequence, by a 16S rRNA gene survey. We will analyze samples of the foregut microbiome at three anatomic loci: mouth, distal esophagus, and gastric corpus. Changes of the microbiota in the distal esophagus will be correlated with the phenotypes. Spatial relationship between the esophageal microbiota and upstream (mouth) and downstream (stomach) foregut microbiotas as well as temporal stability of the microbiome-disease association will also be examined. Specific Aim 2. To define distal esophageal metagenome and demonstrate its association with GERD sequence, by shotgun metagenomic analysis. We will first classify samples of the metagenome into metagenotypes by between-sample k-mer distance and correlate the metagenotypes with the four phenotypes. Subsequent detailed analyses will include pathway-disease and gene-disease associations. DNA viruses and fungi, if identified, also will be correlated with the phenotypes. A significant association between the foregut microbiome composition and GERD sequence, if demonstrated, will be the first step for eventually testing the causal hypothesis that an abnormal microbiome is required for the development of the sequence of phenotypic changes toward EA. If EA and its precursors represent a microbial ecological disease, treating the cause of GERD might become possible, for example, by normalizing the microbiome through use of antibiotics, probiotics, or prebiotics. Causative therapy for GERD could prevent its progression and reverse the current trend of increasing incidence of EA.

  Study phs000260

• Kids First: The Genomic Basis of Structural Birth Defects Associated with Chromosome 18 Copy Number Changes

  Chromosome abnormalities are a common cause of structural birth defects. Both childhood cancers and structural birth defects are critical and costly conditions associated with substantial morbidity and mortality. Elucidating the underlying genetic etiology of these diseases has the potential to profoundly improve preventative measures, diagnostics, and therapeutic interventions.However, because these genomic copy number changes involve multiple genes and because most of these conditions are individually rare, defining the specific causative genes behind specific phenotypes has been a challenge. We met that challenge by spending the last 28 years enrolling and evaluating anyone with a chromosome 18 abnormality. The cohort now includes over 700 individuals with a wide variety of chromosome 18 copy number changes (CNV), as well as their parents. Because the vast majority of these participants have individually unique CNVs, we have been able to perform extensive genotype-phenotype correlations resulting in 58 publications. Of the 263 genes on chromosome 18, 28 are linked to specific hemizygous phenotypes. However, most have low penetrance. Genomic sequence data could identify variants in the extant allele that are hypermorphic and compensate for hemizygosity, or are hypomorphic and exacerbate hemizygosity. Additionally, there are phenotypes within this cohort that are rare, or an extreme version of one of the more common phenotypes. Genomic sequence data could help discover new biallelic conditions by revealing functional sequence variants of the extant allele. In both of these cases, there could also be variants in other genes on other chromosomes that may be associated with the phenotype that confer susceptibility or resilience. Inclusion of this unique cohort in the Gabriella Miller Kids First Pediatric Research Program can advance the goals of the program in several ways. First, by adding known susceptibility loci to the existing Kids First cohorts for the structural birth defects that are also found in our cohort. Second, for those structural birth defects known to be polygenetic, this cohort has a single defined risk factor which can simplify the search for secondary factors. Third, these studies can also bring clarity to people with chromosome 18 conditions and help to make the genotype more accurately predict phenotype. This approach could be a model for understanding the many other rare chromosome abnormalities which collectively are a common cause of structural birth defects.

  Study phs002627

• Immune-Related Adverse Events after Immune Checkpoint Blockade-Based Therapy are Associated with Improved Survival in Advanced Sarcoma

  Immune activation after immune checkpoint blockade (ICB) can lead to a unique group of adverse events (AEs), which have been associated with improved outcome in many carcinomas. The association between immune-related AEs (irAEs) and outcome in patients with sarcoma is not well studied. This study has two components: (1) a retrospective clinical study of irAEs among 131 patients treated with ICB at Memorial Sloan Kettering Cancer Center and (2) an analysis of a subset of these patients who have whole transcriptome sequencing available for analysis. In the clinical study portion, we reviewed a cohort of patients with advanced sarcoma treated on prospective clinical trials utilizing ICB-based therapy between April 2017 and January 2020. The objectives were to pool the safety data from each trial, identify irAEs, and correlate them with best overall response by RECIST 1.1, progression-free survival (PFS) and overall survival (OS). Association of irAEs with response and survival was assessed using a Cox regression model. A total of 131 patients were included. Forty-two (32%) had at least one irAE of any grade and 16 (12%) had at least one Grade ≥ 3 irAE. On Cox analysis adjusting for clinical covariates that were significant in the univariate setting, the hazard ratio (HR) for an irAE (HR 0.662, 95% CI 0.421 - 1.041) approached, but did not reach statistical significance for PFS (P = 0.074), while patients had a significantly lower HR for OS (HR 0.443, 95% CI 0.246 – 0.798; P = 0.007) compared to those without or before an irAE. Tumor samples with available RNA sequencing data were stratified by presence of an irAE to identify patterns of differential gene expression. In total, 71 unique patients had RNA sequencing available for analysis. The transcriptomes of 31 of these patients have been previously uploaded to dbGaP (phs002852), leaving 36 unique transcriptomes that have not been previously publicly shared. Three patients did not agree for their sequencing to be publicly shared. Therefore, 33 unique patient samples will be uploaded to this dbGaP study. Overall, this study found that gene expression profiling on baseline tumor samples from patients who had an irAE had higher numbers of tumor-infiltrating dendritic cells, CD8+ T cells, and regulatory T cells as well as upregulation of immune and inflammatory pathways.

  Study phs003284

• Whole Blood Transcriptomics of Patients With Melioidosis

  Melioidosis is a neglected tropical infection caused by the Gram negative bacterium Burkholderia pseudomallei that is associated with high mortality rates in southeast Asia. The goal of this study was to a) identify human blood leukocyte transcriptomic features and pathways specific to melioidosis (vs other etiologies of infection), b) identify transcriptomic features and pathways specific to fatal melioidosis, and c) identify transcriptomic predictors of death in patients with melioidosis. This study used clinical data and whole blood leukocyte samples from a subset of participants in the Ubon Sepsis Study, a prospective single-center cohort study conducted at Sunpasitthiprasong Hospital, Ubon Ratchathani, Thailand between 2013 and 2017. Participants in the Ubon Sepsis Study had suspected or documented infection with accompanying systemic manifestations of infection and were enrolled, with blood sampling, within 24 hours of admission to the study hospital. Enrolled patients were followed over time and vital status was determined at 28 days after enrollment. The subset of participants from the parent Ubon Sepsis Study cohort selected for this study was comprised of 164 patients with melioidosis (defined as having a culture of clinical sample positive for B. pseudomallei), 35 patients with Gram negative bacteremia due to either Escherichia coli or Klebsiella pneumoniae, 16 patients with Gram positive bacteremia due to Staphylococcus aureus, and 19 patients who had negative blood cultures and no clinical sample culture-positive for B. pseudomallei. Fifty uninfected control patients with or without diabetes were recruited from the outpatient department and blood donation center at Udon Thani hospital, Udon Thani, Thailand from 2018 to 2019. Blood was collected at the time of enrollment in Tempus Blood RNA tubes. RNA was extracted using the Tempus Spin RNA Isolation kit. RNA sequencing (RNA-Seq) was performed at the University of Washington Northwest Genomics Center. Analysis was performed using a variety of statistical methods. The main finding of the study was that the transcriptomes of melioidosis patients, compared to patients with other infections, were characterized by upregulation of interferon signaling. The transcriptomes of patients with fatal melioidosis were notable for upregulation of inflammatory and type 2 immune responses and downregulation of genes related to T-cell function. A five-gene (EPHB1, SYCP2L, MERTK, IL5RA, and SPOCK1) predictive signature for death in melioidosis was developed.

  Study phs003724

• Kids First: Genetics of Pediatric Germ Cell Tumors

  The Gabriella Miller Kids First Pediatric Research Program (Kids First) is a trans-NIH effort initiated in response to the 2014 Gabriella Miller Kids First Research Act and supported by the NIH Common Fund. This program focuses on gene discovery in pediatric cancers and structural birth defects and the development of the Gabriella Miller Kids First Pediatric Data Resource (Kids First Data Resource). All of the genomic and phenotypic data from this study are accessible through dbGaP. The data is also available at the Kids First Portal, where other Kids First datasets can also be accessed in the cloud for data analysis, data visualization, collaboration and interoperability, open to all researchers and developers.Pediatric malignant germ cell tumors (GCTs) represent approximately 6% of childhood cancers, including 3% of tumors in children aged 0-14 years and 15% of tumors in adolescents. GCTs are heterogeneous and grouped together due to the presumed common cell of origin, the primordial germ cell (PGC). GCTs typically occur in the testes or ovaries; however, extragonadal GCTs can occur and are likely a result of abnormal germ cell migration during development. Evidence suggests that GCTs, including those diagnosed in adults, are initiated in utero. Thus, alterations in normal embryonic development are likely to be especially relevant to GCT etiology. Germline susceptibility has not been evaluated in an agnostic fashion in pediatric GCT, mainly due to a lack of an adequate number of samples; however, emerging evidence supports a genetic etiology.In the two Kids First GCT projects, we will evaluate genetic susceptibility to intracranial and extracranial GCT by sequencing probands and their unaffected parents. The goals of the project are to: 1) evaluate the contribution of rare genetic variants in GCT through the use of aggregate burden tests, focusing on genes and established regulatory regions; 2) identify de novo SNVs and CNVs in pediatric GCT using a case-parent triad design; and 3) identify molecular signatures in GCT tumor specimens, overall and by age group and tumor characteristics. Whole Genome Sequencing (WGS) data generated through the Gabriella Miller Kids First Pediatric Research Program will provide an opportunity to investigate the genetic origins of GCT in a diverse set of samples. Given the limited knowledge of GCT etiology and biology, the results of the proposed analyses are likely to have a big impact on the field.

  Study phs002322

• Sensitive and robust liquid biopsy-based detection of PIK3CA mutations

  Over the last years, the treatment of hormone receptor-positive metastatic breast cancer patients has dramatically changed. Combination strategies attempting to overcome resistance to endocrine therapy such as targeting the PI3 kinase pathway are gaining importance. The phase III SOLAR-1 trial demonstrated the benefit of the addition of alpelisib to fulvestrant, thereby providing further clinical evidence of the increasing importance of PIK3CA testing. Here, we performed a comparison of liquid biopsy and tissue-based detection of PIK3CA mutations in HR-positive metastatic breast cancer patients. Plasma samples and the latest available tumor tissue from 69 patients with metastatic hormone-receptor positive breast cancer were analyzed for PIK3CA hotspot mutations. A high-resolution NGS assay (SiMSen-Seq) was used for plasma samples covering 11 recurrent PIK3CA mutations, used for stratification in SOLAR-1. Additionally, mFAST-SeqS was used to estimate the tumor fractions in the plasma samples. For tumor tissue samples, targeted Ion Torrent NGS was employed. Matched tissue and plasma samples were available from 63 patients. PIK3CA mutations were detected in 46.1% of the tissue samples and in 50.7% of the plasma samples. The variant allele frequency (VAF) ranged from 4.36% to 72.93% with a median of 28.60% in tissue samples, and from 0.28% to 49.85% with a median of 1.17% in plasma samples. The most frequent variants in tissue and plasma were H1047R, E545K, and E542K. We detected at least one of 11 PIK3CA mutations from the SOLAR-1 trial in 51/63 patients, both in tissue and plasma. In 7 patients, such mutations were found only in plasma. In 5 patients, PIK3CA mutations found in tissue were not detectable in ctDNA, 2 of which had a low tumor fraction.Together, in 33/67 plasma samples without detectable PIK3CA mutations, 18 samples had elevated tumor fraction, implicating true negative results. In the remaining 15 patients with low tumor fraction, additional tissue analysis was needed. SiMSen-Seq-based detection of PIK3CA mutations in plasma shows advantageous concordance with the tissue analyses. A combination with an untargeted, mutation-independent approach for detecting ctDNA fractions may confirm a negative PIK3CA result and thereby enhance the performance of the SiMSen-Seq test. This combinatory approach for selecting suitable patients for alpelisib treatment should be validated in larger patient cohorts.

  Study EGAS00001004940

• Molecular_characterization_of_invasive_lobular_carcinoma

  Invasive lobular carcinoma (ILC) is the second most common histological subtype of breast cancer accounting for 10-15% of cases. ILC differs from invasive ductal carcinoma (IDC)with respect to epidemiology, histology, and clinical presentation. Moreover, ILC is lesssensitive to chemotherapy, more frequently bilateral, and more prone to form gastrointestinal, peritoneal, and ovarian metastases than IDCs. In contrast to IDC, the prognostic value ofhistological grade (HG) in ILC is controversial. One of the three major components of histological grading (tubule formation) is missing in ILC which hinders the process of gradingin this histological subtype and results in the classification of approximately two thirds of ILC as HG 2.Over the last decade, a number of gene expression signatures have shed light onto breast cancer classification, allowing breast cancer care to become more personalized. Withrespect to the management of estrogen receptor (ER)-positive breast cancer, several gene expression signatures provide prognostic and/or predictive information beyond what is possible with current classical clinico-pathological parameters alone. Nevertheless, most studies using gene expression signature have not considered different histologic subtypesseparately. Recently, a comprehensive research program has elucidated some of the biological underpinnings of invasive lobular carcinoma. Genetic material extracted from 200 ILC tumor samples were studied using gene expression profiling and identified ILCmolecular subtypes. These proliferation-driven gene signatures of ILC appear to have prognostic significance. In particular, the Genomic Grade (GG) gene signature improved upon HG in ILC and added prognostic value to classic clinico-pathologic factors. In addition this study demonstrated that most ILC are molecularly characterized as luminal-A (~75%)followed by luminal-B (~20%) and HER2-positve tumors (~5%). Moreover, we investigated the prognostic value of known gene signatures/ gene modules in the same cohort of ILC. As a second step within the scope of this project, we aim to investigate the interactionsbetween somatic ILC tumor mutations to observed transcriptome findings. To this end, we aim to perform somatic mutation analysis for the ILC tumors for which Affymetrix gene expression profiling is available. To this end, we will use a gene screen assay, which specifically interrogates the mutational status of a few hundreds of cancer genes. We believe that this pioneering effort will be fundamental for a tailored treatment of ILC withimprovement in patients' outcome.

  Study EGAS00001000292

• Multi-omics data of 1000 Inflammatory Bowel Disease patients

  Portal available at https://1000ibd.org Inflammatory bowel disease (IBD) is a chronic complex disease of the gastrointestinal (GI) tract. Patients with IBD can experience a wide range of symptoms, but the pathophysiological mechanisms that cause these individual differences in clinical presentation remain largely unknown. In consequence, IBD is currently classified into subtypes using clinical characteristics. If we are to develop a more targeted treatment approach, molecular subtypes of IBD need to be discovered that can be used as new drug targets. To achieve this, we need multiple layers of molecular data are generated from the same IBD patients.We initiated the 1000IBD project to prospectively follow more than 1000 IBD patients from the Northern provinces of the Netherlands. For these patients, we have collected a uniquely large number of phenotypes and generated multi-omics profiles. To date, 1,215 participants have been enrolled in the project and enrolment is on-going, with 609 patients being present in the first data release. Phenotype data collected for these participants includes information on dietary and environmental factors, drug responses, and adverse drug events. Genome information has been generated using genotyping (ImmunoChip, Global Screening Array and HumanExomeChip) and sequencing (whole exome sequencing and targeted resequencing of IBD susceptibility loci), transcriptome information generated using RNA-sequencing of intestinal biopsies and microbiome information generated using both sequencing of the 16S rRNA gene and whole genome shotgun metagenomic sequencing.All molecular data generated within the 1000IBD project will be shared in multiple data on the European Genome-Phenome Archive (www.ega-archive.org). The first data release, will contain basic phenotypes for 609 participants, genotypes of 314 participants, gut microbiome data generated by tag sequencing the 16S gene of feces from 315 participants and intestinal biopsies from 107 participants, and gut microbiome metagenomic sequencing of feces of 355 participants . Future releases will comprise many more additional phenotypes and -omics data layers. 1000IBD data can be used by other researchers as a replication cohort, a dataset to test new software tools, or a dataset for applying new statistical models.

  Study EGAS00001002702

• Defective Homologous Recombination DNA Repair as Therapeutic Target in Advanced-Stage Chordoma (HIPO_021)

  HIPO project: HIPO_021 Importance: Chordomas are rare tumors of the axial skeleton and skull base with few therapeutic options and no clinically validated molecular drug targets. The value of comprehensive genomic analyses for guiding medical therapy of patients with advanced-stage chordoma is unknown.Objective: To identify therapeutically tractable genetic lesions in a cohort of chordoma patients within a genomics-guided precision oncology program and to document the outcome of individualized, molecularly targeted chordoma therapy.Design, Setting, and Participants: We performed whole-exome sequencing of tumor and matched germline control samples from seven patients with locally advanced or metastatic chordoma who were enrolled in a cross-institutional molecular stratification registry trial for younger adults with advanced-stage cancer across all histologies and patients with rare tumors. All patients were heavily pretreated and had progressive disease prior to molecular analysis.Interventions: Individualized medical therapy was administered according to the patients’ molecular profiles.Main Outcomes and Measures: Candidate therapeutic targets identified by whole-exome sequencing and response to genotype-directed therapy.Results: All patients harbored alterations of two or more genes known to be involved in DNA repair via homologous recombination (HR), including heterozygous deletions of ERCC6, FANC family members, RAD51L (n = 6), BRCA2 (n = 5), ATR, CHEK2, RAD18, RAD51B, and XRCC3 (n = 4); inactivating PTEN mutations coupled with loss of heterozygosity (n = 2); and pathogenic germline variants in BRCA2 (n = 1), NBN (n = 1), and CHEK2 (n = 1) that were accompanied by somatic deletion of the corresponding wild-type alleles. Consistently, a mutational signature associated with defective HR was enriched in all samples and co-occurred with extensive genomic instability, as evidenced by HR deficiency scores and high numbers of large-scale state transitions. These results prompted off-label treatment with the poly(ADP-ribose) polymerase (PARP) inhibitor olaparib in a patient whose tumor was refractory to irradiation and systemic treatment with imatinib, which led to a prolonged response and substantial clinical improvement.Conclusions and Relevance: Advanced-stage chordomas are frequently characterized by genomic imprints of defective HR DNA repair. HR deficiency represents a new therapeutic opportunity in this intractable disease through repositioning of PARP inhibitors that warrants further exploration in clinical trials.

  Study EGAS00001002720

• CRCbiome: Gut metagenome of Norwegian screening participants using FIT sampling

  The study aims to characterize the gut metagenome of Norwegian screening participants and assess the ability of the gut metagenome to identify those at need for colonoscopy. Background: Colorectal cancer (CRC) screening reduces CRC incidence and mortality. However, current screening methods are either hampered by invasiveness or suboptimal performance, limiting their effectiveness as primary screening methods. To aid in the development of a non-invasive screening test with improved sensitivity and specificity, we have initiated a prospective biomarker study (CRCbiome), nested within a large randomized CRC screening trial in Norway. We aim to develop a microbiome-based classification algorithm to identify advanced colorectal lesions in screening participants testing positive for an immunochemical fecal occult blood test (FIT). We will also examine interactions with host factors, diet, lifestyle and prescription drugs. The prospective nature of the study also enables the analysis of changes in the gut microbiome following the removal of precancerous lesions. Methods: The CRCbiome study recruits participants enrolled in the Bowel Cancer Screening in Norway (BCSN) study, a randomized trial initiated in 2012 comparing once-only sigmoidoscopy to repeated biennial FIT, where women and men aged 50–74 years at study entry are invited to participate. Since 2017, participants randomized to FIT screening with a positive test result have been invited to join the CRCbiome study. Self-reported diet, lifestyle and demographic data are collected prior to colonoscopy after the positive FIT-test (baseline). Screening data, including colonoscopy findings are obtained from the BCSN database. Fecal samples for gut microbiome analyses are collected both before and 2 and 12 months after colonoscopy. Samples are analyzed using metagenome sequencing, with taxonomy profiles, and gene and pathway content as primary measures. CRCbiome data will also be linked to national registries to obtain information on prescription histories and cancer relevant outcomes occurring during the 10 year follow-up period. Discussion: The CRCbiome study will increase our understanding of how the gut microbiome, in combination with lifestyle and environmental factors, influences the early stages of colorectal carcinogenesis. This knowledge will be crucial to develop microbiome-based screening tools for CRC. By evaluating biomarker performance in a screening setting, using samples from the target population, the generalizability of the findings to future screening cohorts is likely to be high.

  Study EGAS50000000170

• Center for Craniofacial and Dental Genetics (CCDG): Genetics of Orofacial Clefts and Related Phenotypes

  The purpose of this study is to investigate the genetics of orofacial clefts (OFCs) in a large study population, and importantly, to incorporate subclinical phenotypic features into these studies. Orofacial clefts (OFCs) comprise a significant fraction of human birth defects (about 1/700 live births (Rahimov et al. 2012) and represent a major public health challenge, as individuals with these anomalies require surgical, nutritional, dental, speech, medical and behavioral interventions, thus imposing a substantial economic and personal burden (Berk and Marazita 2002*). The most common forms include OFCs of the lip alone (CL, Figure 1A), CL plus cleft palate (CL+CP, Figure 1B) or of the palate only (CP, Figure 1C). Individuals born with OFC may have their first surgical repair at age 3 months, but this initial surgery is just the beginning of a lifetime of health burdens. An individual born with an OFC has a hospital use rate increased for most ages (up to 233% increase for children ages 0-10 years and 16% for middle aged adults (Wehby et al. 2012). Healthcare costs for children with OFCs are estimated to be 800% greater compared with their unaffected peers (Boulet et al. 2009). Data from Denmark show that people born with CL with or without CP (CL/P) have an increased mortality up to age 55, which may be attributed to an increased risk of suicide and/or certain cancers (Christensen et al. 2004). The focus of most OFC genetic research has been CL and/or CP. Furthermore, the majority of OFC, i.e. about 70% of CL/P and 50% of CP is considered "nonsyndromic" (Jones 1988), i.e. isolated anomalies with no other apparent cognitive or structural abnormalities. Figure 1 Sample OFC Types A: Bilateral Cleft Lip; B:Cleft Lip plus Cleft Palate; C:Cleft Palate Alone The factors leading to the majority of nonsyndromic OFCs are still unclear, particularly at an individual family level. As is true for many complex traits, substantial progress in gene identification has occurred in the OFC field in the last two years (Dixon et al. 2011; Marazita 2012). Genome Wide Association Studies (GWAS) and sequencing studies to date by our research team and others have focused on genetic risk factors for overt CL/P and CPO-and have been very successful. A major finding from this work is that OFCs exhibit significant genetic heterogeneity, i.e., multiple genetic regions have been implicated (Beaty et al. 2010; Ludwig et al. 2012). Thus, approaches are needed to understand this genetic heterogeneity. Are there GxG interactions at work? Are there subsets of families, each due to a different gene? Our research group has shown that a promising approach to dissect the etiology of OFC is to focus on subclinical phenotypic features within entire cleft families (not just in affected cases, but also in their non-cleft relatives). These subtle features are believed to represent mild manifestations of the same underlying genetic susceptibility responsible for OFCs; as such, their inclusion in case-control and family-based genetic studies can help to clarify and refine the relationship between genotype and phenotype. The study population comprises a large number of families and individuals (~12,000 individuals) from multiple populations worldwide (Caucasians from the US and Europe, Asians from China and the Philippines, Mixed Native American/Caucasians from South America, and Africans from Nigeria and Ethiopia). There are cases, case families (nuclear families and extended kindreds), as well as controls with no history of OFC nor other developmental defects. *Berk NW, Marazita ML (2002) Costs of Cleft lip and Palate: Personal and Societal Implications. In: Wyszynski DF (ed) Cleft Lip and Palate: From Origin to Treatment. Oxford University Press, Inc., New York, pp 458-467.

  Study phs000774

• Study of Melanoma Risk in Australia and the United Kingdom

  The results from a small number of melanoma GWAS have been published. Initial studies identified several pigmentation- and nevus-associated loci that mediate an effect on melanoma risk, however, these studies were somewhat limited in that sample number (hence power) was low, they used first-generation low density SNP arrays, or used pools of DNA samples. Subsequently, additional melanoma GWAS have been completed, including a "Phase 2" study by the International Melanoma Genetics Consortium (GenoMEL), a full GWAS of the Australian sample resource previously used in a pooled-DNA GWAS, and study conducted through the MD Anderson Cancer Center and the Brigham and Women's Hospital. The groups who performed these studies have recently shared data and replicated a number of new melanoma susceptibility loci. Aside from the identification of novel loci, there are two additional notable outcomes of these studies. Firstly, an examination of the observed versus expected test statistics (Q-Q plot) from the Australian study, even after removing data from SNPs within known replicated susceptibility loci, reveals that there remains an excess of positive results. Similarly, the latest GenoMEL study finds almost three times as many SNPs reaching p-values between 10-4 and 10-5 as would be expected by chance. In the light of other studies of complex traits [1], these data suggest that studies based on additional melanoma samples from the same population are likely to identify an even larger "polygenic tail" and should prove invaluable in identifying and characterizing the underlying loci. A second observation, is that the effect size for replicated associations differs very little between GWAS. Given the strong effect of ultraviolet radiation (UVR) on risk of melanoma this might be expected to affect penetrance, particularly in the Australian and English samples, which are ethnically similar, but have very different sun exposures. We hypothesize that those SNPs whose effects are strongly mediated by UVR exposure may have smaller marginal effects on risk and are therefore harder to detect initially, suggesting a whole category of genetic effects that are unexplored.Indeed, most melanoma GWAS performed to date used samples from both European and Australian populations in discovery and or replication, and thus, existing studies have been poorly powered to detect associations with a wide difference in effect between these low- and high-UVR populations. Here, we wish to pursue this hypothesis further and plan to genotype additional cases drawn from the English and Australian populations. This will serve two complementary objectives: firstly, it will greatly increase our collective power to detect additional new melanoma risk alleles; secondly, it will highlight associations that are stronger specifically within the context of either low-UVR or high-UVR exposure environments. We posit that these data will be invaluable, not just for identifying novel melanoma-associated loci, but also for addressing gene-environment interactions. We have available a collection of valuable resources to help fulfill our aims. These include a considerable number of well-characterized and ungenotyped Australian and UK melanoma cases, as well as existing genotype data from sets of Australian and UK cases and population-based controls. We propose the following Specific Aims: To extend our current collective melanoma GWAS by genotyping a large number of additional UK and Australian cases. To jointly analyze these data and identify new melanoma risk loci. To determine whether pre-existing and new melanoma risk alleles show different degrees of association between the English and Australian populations, and assess whether these differences might be due to differences in sunlight exposure.

  Study phs000519

• A Genomic Atlas of Systemic Interindividual Epigenetic Variation in Humans (GTEx)

  Methylation of cytosines in CpG dinucleotides is an epigenetic mechanism with essential roles in mammalian development. To explore its functions in cellular differentiation, unbiased analysis of CpG methylation by whole genome bisulfite sequencing (WGBS) has been used to characterize epigenetic differences among different human tissues and cell types. Meanwhile, human interindividual variation in DNA methylation that is not cell-type specific has attracted relatively little attention. Systemic interindividual epigenetic variation is important, however, because like genetic variation it is a potential determinant of phenotypic variation and can be assessed in any easily obtainable DNA sample. Since systemic epigenetic variants originate in the preimplantation embryo, their establishment can be influenced by periconceptional environment, and potentially provide information about lifetime risks relevant to global health, obesity, and cancer. We elucidated systemic interindividual variation in CpG methylation in the human genome. We studied brain, heart, and thyroid tissues (representing all three germ layer lineages) from each of 10 donors in the NIH Gene-Tissue Expression (GTEx) project. We performed deep whole genome bisulfite sequencing for these 30 samples, achieving a sequencing depth of over 50x coverage per sample. We identified 9,926 correlated regions of systemic interindividual variation (CoRSIVs). These regions, comprising just 0.1% of the human genome, often correlate with one another over long genomic distances, are associated with transposable elements and subtelomeric regions, conserved across various human ethnic groups, and particularly sensitive to periconceptional environment. While genetic variation appears to influence methylation at most CoRSIVs, many show no evidence of genetic influence, suggestive of 'pure' epigenetic variation. At CoRSIVs, interindividual variation in DNA methylation in an easily biopsied tissue predicts expression in other tissues, and genes associated with these loci are implicated in a range of human disorders. In addition to charting a previously unrecognized molecular level of human individuality, this atlas of human CoRSIVs provides a resource for future population-based investigations into how interindividual epigenetic variation modulates risk of disease.Version 2 now also includes Target Capture Sequencing of CoRSIVs in 808 tissues (188 GTEx Donors). Focusing on the CoRSIVs identified by analyzing WGBS data, a Target Capture Bisulfite sequencing assay was developed. Using the genotype data of 188 GTEx donors, we assessed mQTL by capturing a 1MB region at each CoRSIV and quantifying methylation by Bisulfite-seq. The Target Capture Bisulfite sequencing data will be available to download via the AnVIL project.

  Study phs001746

• All you need to know about our new DAC Portal v2

  An updated version to boost the management of DACs (Data Access Committees), policies, and data access requests. In September of 2023, we launched new services for all EGA users, including a DAC Portal. Since then, our team has been working to refine it and improve the user experience. The version 2 of our DAC Portal is now ready, with a range of new features aimed at streamlining your workflow and boosting productivity. If you are interested in learning more about the latest version of our DAC Portal, then you are in the right place! In this post, you will find information about the implemented features and more. The full documentation is available on our website. Moreover, we highly recommend exploring the DAC Portal through the Take the Tour. This said, let's get cracking! Customise your data access requests table This table offers the possibility to tailor information about the data access requests by making visible or hiding different columns regarding the Dataset Persistent Identifier, the Organisation or the requestor's name s, among others. You can choose which columns to see, depending on your needs and interests. Additionally, we have implemented two new features columns with two new functionalities, DAC Comment and Expiration Date. You can find more details in the following sections! In this table, all data access requests are displayed by default. With the latest version of the Portal, you can now apply filters, combine them, and save them for future use. Leave internal comments on pending requests and visible to all the DAC Members We understand that many Data Access Committees (DACs) cannot instantly approve or deny data access requests. Often, there's an intermediary phase where discussions and the signing of legal documents are necessary. To facilitate this process, we've introduced the DAC comment feature! When you navigate to the DAC column, you'll find two tabs: "User" and "DAC". Under "User", you'll see the message provided by the requester at the time of requesting access to the data. As a DAC member/admin, you can then add an internal comment in the "DAC" tab. These comments are visible only to DAC members/admins, ensuring confidentiality. Requesters won't have access to DAC comments. By adding a DAC comment to a pending request, we'll know that you've begun reviewing it. This allows you to filter pending requests without DAC comments to focus on genuinely new requests, and it prevents you from receiving email notifications about ongoing data requests. Set expiration dates for permissions and revoke them automatically The latest update to the DAC Portal introduces a new feature allowing you to set expiration dates for new access requests. For instance, if you anticipate approving a data access request but only wish to grant access for a limited time, you can now specify an expiration date for the granted permissions. Once this date is reached, the permissions will automatically be revoked. By default, permissions are granted indefinitely without an expiration date. However, if you ever need to revoke permissions, you can easily do so from the History page. Audit your metadata objects Managing and auditing your metadata objects will be easier from now on as the new DAC Portal enhances and facilitates your role as a Data Controller. This is possible thanks to the tables available in each of the primary tabs visible on the homepage: DACs, Policies and Datasets. Starting with DACs, this section allows to check the policies linked to a specific DAC. In Policies, you can obtain a list of the datasets connected to a particular policy. In the Dataset tab, it is possible to group datasets by either DAC or Policy, as well as the release status. Now you have the option of deprecating metadata objects that you don’t want to use anymore, or that were created by mistake. You will find the deprecate button on the EDIT page of the DAC, as well as for registered policies. You can find more information here. What's neat about this feature is that once a DAC or policy is deprecated, it becomes hidden within the DAC Portal. This ensures that you only see information that is consistently up to date! Define your preferences regarding email notifications For pending requests, you will be able to decide how often you want to get the notifications: daily, weekly or fortnightly. Remember, you will not receive email notifications for pending requests with a DAC comment! Furthermore, you have the flexibility to decide which notifications you wish to receive, such as invitations to join a new DAC or notifications regarding DAC acceptance by the Helpdesk, among other options. Check the User preference to see the complete list of available notification settings! What’s next: incoming DAC Portal API In addition to the new DAC Portal, we are excited to announce the release of the DAC API! This enables users to programmatically manage permissions. If you are interested in learning more about the technical specifications, you can consult the DAC API specification. This post was written by Aina Jené and Ana T. Alonso.

  Blog new-dac-portal-v2

• MediMer: A versatile do-it-yourself peptide-receptive MHC class I multimer platform for tumor neoantigen-specific T cell detection

  Peptide-loaded MHC class I (pMHC-I) multimers have revolutionized our capabilities to monitor disease-associated T cell responses with high sensitivity and specificity. To improve the discovery of T cell receptors (TCR) targeting neoantigens of individual tumor patients with recombinant MHC molecules, we developed a peptide-loadable MHC class I platform termed MediMer. MediMers are based on soluble disulfide-stabilized β2-microglobulin/heavy chain ectodomain single-chain dimers (dsSCD) that can be easily produced in large quantities in eukaryotic cells and tailored to individual patients’ HLA allotypes with only little hands-on time. Upon transient expression in CHO-S cells together with ER-targeted BirA biotin ligase, biotinylated dsSCD are purified from the cell supernatant and are ready to use. We show that CHO-produced dsSCD are free of endogenous peptide ligands. Empty dsSCD from more than 30 different HLA-A,B,C allotypes, that were produced and validated so far, can be loaded with synthetic peptides matching the known binding criteria of the respective allotypes, and stored at low temperature without loss of binding activity. We demonstrate the usability of peptide-loaded dsSCD multimers for the detection of human antigen-specific T cells with comparable sensitivities as multimers generated with peptide-tethered β2m-HLA heavy chain single-chain trimers (SCT) and wild-type peptide-MHC-I complexes prior formed in small-scale refolding reactions. Using allotype-specific, fluorophore-labeled competitor peptides, we present a novel dsSCD-based peptide binding assay capable of interrogating large libraries of in silico predicted neoepitope peptides by flow cytometry in a high-throughput and rapid format. We discovered rare T cell populations with specificity for tumor neoepitopes and epitopes from shared tumor-associated antigens in peripheral blood of a melanoma patient including a so far unreported HLA-C*08:02-restricted NY-ESO-1-specific CD8+ T cell population. Two representative TCR of this T cell population, which could be of potential value for a broader spectrum of patients, were identified by dsSCD-guided single-cell sequencing and were validated by cognate pMHC-I multimer staining and functional responses to autologous peptide-pulsed antigen presenting cells. By deploying the novel CHO producer cell-based dsSCD MHC-I MediMer platform, we hope to significantly improve success rates for the discovery of personalized neoepitope- specific TCR in the future by being able to also cover rare HLA allotypes.

  Study EGAS50000000065

• Prevention and Early Treatment of Acute Lung Injury (PETAL) - Low Tidal Volume Universal Support Feasibility of Recruitment for Interventional Trial (LOTUS FRUIT) (PETAL-LOTUS FRUIT-BioLINCC)

  Data Access NOTE: Please refer to the “Authorized Access” section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives: The two main goals of PETAL-LOTUS FRUIT were to conduct a prospective, observational study within all PETAL Network sites to determine the frequency of and outcomes from acute respiratory failure and the current usual care for tidal volume ventilation in patients with and without acute respiratory distress syndrome (ARDS), and to simulate the design and power of the proposed LOTUS trial. Background: A previous study demonstrated improved survival among patients with ARDS receiving tidal volume (Vt) targeted to 6 ml/kg of predicted body weight (PBW). As a result, low–tidal volume ventilation (LTVV) is now recommended for all patients with ARDS, although penetration of this evidence-based practice has been limited, especially early in mechanical ventilation. LTVV may also benefit patients without ARDS. Consequently, there has been increasing call to apply LTVV for all patients with acute respiratory failure upon initiation of mechanical ventilation. The PETAL Network considered performing a pragmatic stepped-wedge, cluster-randomized, controlled, hybrid implementation trial to examine systematic implementation of a default 6 ml/kg PBW LTVV strategy in patients with acute respiratory failure requiring intubation to improve adherence to LTVV and decrease mortality in acute respiratory failure. Trial planning may be better estimated by simulation than routine, simplistic calculations, but such simulations require detailed data of initial parameters. Participants: 2848 patients from 49 hospitals were enrolled. Enrollment varied by hospital, ranging from 4 to 100 patients, the maximum enrollment allowed per site. Design: PETAL-LOTUS FRUIT was a multicenter, prospective, observational cohort study of patients with acute respiratory failure on mechanical ventilation in the PETAL Network hospitals. For all patients, baseline demographic data, the hospital location, indication for intubation (hypoxemic or hypercapnic respiratory failure or both, altered level of consciousness, or surgery), type of intensive care unit (ICU), and Sequential Organ Failure Assessment score in the first 24 hours after intubation were collected. Baseline ventilator data immediately after intubation, arterial blood gas results and oxygen saturation as measured by pulse oximetry, and presence of ARDS was also collected for all patients. ARDS was defined as a ratio of arterial oxygen tension to fraction of inspired oxygen (FiO2) less than or equal to 300 with a chest radiograph within 24 hours of the qualifying ratio of arterial oxygen tension to FiO2 that had bilateral infiltrates unexplained by mass, collapse, or effusion. For the first 50 patients enrolled at each hospital, daily data on ventilator mode, Vt, and presence of ARDS for the first 3 days after intubation was collected. Vt indexed to PBW was calculated from the set Vt for patients on ventilator mode with volume settings. For patients on pressure ventilation modes, Vt was calculated from the ratio of minute ventilation (in ml/min) to the respiratory rate. Enrolled patients were followed until hospital discharge or 28 days for clinical outcomes including mortality, ventilator-free days, and length of stay. To determine the possible improvement in mortality that could be observed with a reduction in Vt from current usual care in the PETAL-LOTUS FRUIT cohort to 6 ml/kg PBW, mortality was estimated as a function of initial Vt. Five models based on data from three distinct patient populations were used. 500 simulations of a stepped-wedge, cluster-randomized clinical trial using the model with greatest predicted benefit for lowering the Vt to 6 ml/kg PBW in PETAL-LOTUS FRUIT sites were performed. Conclusions: Use of initial tidal volumes less than 8 ml/kg predicted body weight was common at hospitals participating in the PETAL Network. After considering the size and budgetary requirement for a cluster-randomized trial of LTVV versus usual care in acute respiratory failure, the PETAL Network deemed the proposed trial infeasible (PMID: 30407869).

  Study phs003791

• Idiopathic Pulmonary Fibrosis Network AntiCoagulant Effectiveness in Idiopathic Pulmonary Fibrosis (IPFNet-ACE-IPF-BioLINCC)

  Data Access NOTE: Please refer to the "Authorized Access" section below for information about how access to the data from this accession differs from many other dbGaP accessions. Objectives: The ACE-IPF trial tested the hypothesis that treatment with warfarin at recognized therapeutic doses would reduce rates of mortality, hospitalization, and declines in Forced Vital Capacity (FVC) in subjects with Idiopathic pulmonary fibrosis (IPF).Background: IPF is a chronic, progressive lung disease of unknown cause characterized by the histopathologic pattern of usual interstitial pneumonia. The median survival of patients with IPF after the onset of symptoms is 2 to 5 years. Prior animal and human studies in pulmonary fibrosis provide a compelling rationale to examine anticoagulation as a therapeutic approach in IPF. Large epidemiologic studies link IPF with thrombosis-related clinical events, such as an increased risk of acute coronary syndrome and deep vein thrombosis. The suspected causal relationship may extend beyond simple coagulation cascade-induced thrombus formation, as procoagulant enzymes may directly stimulate fibrosis via cell surface receptor - mediated responses.Participants: Patients aged 35 to 80 years with progressive IPF were potentially eligible. Progressive IPF was defined as a history of (1) worsening of dyspnea, or (2) physiologic deterioration defined as an absolute decline of either FVC greater than or equal to 10% or DlCO greater than or equal to 15%, a reduction in arterial oxygen saturation of greater than or equal to 5%, or progression of radiographic findings. Between December 14, 2009 and April 1, 2011, 145 subjects were enrolled: 72 in the warfarin group and 73 in the placebo group. The mean age for the population was 67 years. 27% of the subjects were women and 92% were white.Participants were excluded if they met any of the following criteria: current indication for, or treatment with, warfarin, prasugrel, or clopidogrel combined with aspirin; the presence of an increased risk of bleeding; a recent cerebral vascular accident or gastrointestinal bleeding; any current signs or symptoms of severe, progressive, or uncontrolled comorbid illness; and their presence on the active list for lung transplantation. Design: ACE-IPF was a double-blind, randomized, placebo-controlled trial of warfarin targeting an international normalized ratio (INR) of 2.0 to 3.0 in patients with IPF. Subjects were randomized in a 1:1 ratio to warfarin or matching placebo for a planned treatment period of 48 weeks. Study subjects were provided two strengths of warfarin tablets (1 mg and 2.5 mg) or matching placebos. Subjects measured their INR with encrypted meters at least weekly. Participants were seen at screening, baseline, and at 16, 32, and 48 weeks after enrollment. Home monitoring was validated by plasma INR measurement at the week 1 and 16 visits.The primary outcome was a composite endpoint based on the time to all-cause mortality; nonelective, nonbleeding hospitalization; or a decrease in the absolute FVC greater than or equal to 10% from baseline value. Secondary outcome measures included rates of mortality, hospitalization, respiratory-related hospitalization, acute exacerbation, bleeding, cardiovascular events, and changes over time in FVC, 6-minute walk test distance, DlCO, plasma fibrin D-dimer levels, and quality of life (QOL).Conclusions: The study did not show a benefit for warfarin in the treatment of patients with progressive IPF and was terminated due to excess mortality in the warfarin treatment group. Treatment with warfarin was associated with an increased risk of mortality in an IPF population who lacked other indications for anticoagulation.Reported causes of death indicated 11 of the 14 were respiratory-related in the warfarin group versus three of the three in the placebo group. There were also three cardiovascular deaths in the warfarin group versus none in the placebo group. No deaths were attributed to bleeding. The warfarin group also demonstrated an increased rate of combined all-cause hospitalization and all-cause mortality. (Am J Respir Crit Care Med. 2012 Jul 1;186(1):88-95.)

  Study phs004070

• Sickle Cell Disease Implementation Consortium Registry (SCDIC Registry-BioLINCC)

  Data Access NOTE: Please refer to the "Authorized Access" section below for information about how access to the data from this accession differs from many other dbGaP accessions.Objectives: To understand the barriers to care and other factors related to reduced healthcare utilization after the transition from pediatric to adult SCD care which may contribute to increased morbidity and mortality.Background: Fifty years ago, it was rare for individuals with SCD to live beyond childhood. Advances in care delivery and treatment have more than doubled the life expectancy of individuals with sickle cell disease (SCD) since 1972. Beginning in the 1970s, measures such as newborn screening, prophylactic administration of penicillin, and immunization against bacterial infections decreased complications and morbidity, increasing the length and quality of life of children with SCD. Blood transfusions are currently the only proven way to prevent some of the major complications of SCD, especially recurrent stroke. They are also used frequently to help manage some of the acute complications of SCD. More recently, the use of hydroxyurea (HU) as a therapeutic agent to increase fetal hemoglobin has been shown to further reduce the debilitating symptoms of and improve survival in SCD. L-glutamine and crizanlizumab are additional treatments to reduce pain crises and voxelotor is approved to lower the risk of anemia and improve blood flow. In the absence of a widely accessible cure, treatment for SCD is usually aimed at avoiding crises, relieving symptoms, and preventing complications. Many of the advances in treatment have not translated into an increase in longevity or quality of life for adolescents and adults because of disparities in access to routine primary health care.Individuals with SCD experience a markedly increased mortality beginning in the second decade of life. The third and later decades of life are frequently associated with severe chronic pain progressive organ damage and frequent hospitalizations. The provision of evidence-based and expert opinion-based care in SCD is complicated by the difficulties that many patients experience in obtaining access to the health care system and in receiving long-term care from knowledgeable providers. A registry of 2,400 people with SCD was established to provide a rich resource to study the natural history of SCD and to understand barriers to care during the transition from pediatric to adult care. Participants: 2,438 participants with a confirmed diagnosis of SCD were enrolled into the registry over an 18-month period. At the time of enrollment, all participants were 15-45 years of age, English speaking, and without a bone marrow transplant.Design: The SCDIC Registry is a longitudinal observational cohort study. At enrollment, data collection included a medical record abstraction of clinical history, the most recent lab results, and a participant survey which included several patient reported outcomes from PROMIS, ASCQ-Me and NeuroQoL. Similar surveys were administered at annual follow-up. Four to five years after enrollment, a second record abstraction was completed with all clinical events that occurred since enrollment and another set of recent labs. There were many research questions proposed to be answered with the study data thus there was no primary outcome.Conclusions: As noted previously, there were no primary outcomes determined at the start of the study. Research questions included examination of co-morbidities, healthcare utilization, and patient reported outcomes. Key findings from the Registry include:Executive dysfunction, learning difficulties, and poor comprehension significantly associated with poor activities of daily living skills. Executive dysfunction also associated with HU non-adherence. Continuing HU after conception increased odds of miscarriage or stillbirth compared to women who were not using HU. Continuing HU after conception increased odds of low birth weight in infants. Compared to adolescents, young adults had significantly more severe pain, organ dysfunction, mental health disorders, sleep problems, and barriers to medical care. Young adults were significantly less likely to see a sickle cell specialist in the past 2 years. Females had higher pain frequency and severity, more pain episodes, anxiety, depression, hospitalizations, and higher fetal hemoglobin levels. Males had more respiratory, musculoskeletal, genitourinary, and cardiovascular complications, more skin ulcers, and more use of HU. Among 128 subjects that died during the study period, iron overload, pulmonary hypertension, and depression, were significant predictors of the risk of death in multivariate analyses.

  Study phs004203

• DHODH is a synthetic-lethal vulnerability in BCOR-deficient acute myeloid leukemia

  Acute Myeloid Leukemia (AML) remains challenging to treat, especially in cases with mutations in the BCL-6 co- repressor (BCOR), which are associated with poor prognosis and chemo-resistance. In this study, we reveal a synthetic lethal interaction between BCOR and dihydroorotate dehydrogenase (DHODH). We demonstrate that BCOR-deficient cells have a heightened sensitivity to DHODH inhibitors such as brequinar and leflunomide, that are already in clinical use. We confirm that DHODH inhibition selectively induces cell death in BCOR-mutant cells in multiple cellular models, in malignant and non-malignant cells, through chemical and genetic manipulation. Interestingly, we find that the dependency on DHODH does not stem from its role in de novo pyrimidine biosynthesis disruption. Rather, DHODH’s role in the electron transport chain, essential for mitigating reactive oxygen species, may be the physiological vulnerability that pushes BCOR-mutant cells toward cell death when DHODH is inhibited. DHODH inhibitors could be repurposed as targeted therapies for BCOR-mutant tumors, offering a promising strategy for precision medicine in AML and other cancers.

  Study EGAS50000001060

• DHODH is a synthetic-lethal vulnerability in BCOR-deficient acute myeloid leukemia

  Acute Myeloid Leukemia (AML) remains challenging to treat, especially in cases with mutations in the BCL-6 co- repressor (BCOR), which are associated with poor prognosis and chemo-resistance. In this study, we reveal a synthetic lethal interaction between BCOR and dihydroorotate dehydrogenase (DHODH). We demonstrate that BCOR-deficient cells have a heightened sensitivity to DHODH inhibitors such as brequinar and leflunomide, that are already in clinical use. We confirm that DHODH inhibition selectively induces cell death in BCOR-mutant cells in multiple cellular models, in malignant and non-malignant cells, through chemical and genetic manipulation. Interestingly, we find that the dependency on DHODH does not stem from its role in de novo pyrimidine biosynthesis disruption. Rather, DHODH’s role in the electron transport chain, essential for mitigating reactive oxygen species, may be the physiological vulnerability that pushes BCOR-mutant cells toward cell death when DHODH is inhibited. DHODH inhibitors could be repurposed as targeted therapies for BCOR-mutant tumors, offering a promising strategy for precision medicine in AML and other cancers.

  Study EGAS50000001108

• Somatic mutation and selection at epidemiological scale - Sanger_NanoSeq_RandD

  Bottleneck sequencing of human tissue including neurons, cord blood, sperm This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/. As we age, many tissues become colonised by microscopic clones carrying somatic driver mutations. Some of these clones represent a first step towards cancer whereas others may contribute to ageing and other diseases. However, our understanding of the clonal landscapes of human tissues, and their impact on cancer risk, ageing and disease, remains limited due to the challenge of detecting somatic mutations present in small numbers of cells. Here, we introduce a new version of nanorate sequencing (NanoSeq), a duplex sequencing method with error rates of less than 5 per billion base pairs, which is compatible with whole-exome and targeted gene sequencing. Deep sequencing of polyclonal samples with single-molecule sensitivity enables the simultaneous detection of mutations in large numbers of clones, yielding accurate somatic mutation rates, mutational signatures and driver mutation frequencies in any tissue. Applying targeted NanoSeq to 1,042 non-invasive samples of oral epithelium and 371 samples of blood from a twin cohort, we found an unprecedentedly rich landscape of selection, with 46 genes under positive selection driving clonal expansions in the oral epithelium, over 62,000 driver mutations, and evidence of negative selection in some genes. The high number of positively selected mutations in multiple genes provides high-resolution maps of selection across coding and non-coding sites, a form of in vivo saturation mutagenesis. Multivariate regression models enable mutational epidemiology studies on how carcinogenic exposures and cancer risk factors, such as age, tobacco or alcohol, alter the acquisition and selection of somatic mutations. Accurate single-molecule sequencing has the potential to unveil the polyclonal landscape of any tissue, providing a powerful tool to study early carcinogenesis, cancer prevention and the role of somatic mutations in ageing and disease.

  Dataset EGAD00001015624

• National Eye Institute (NEI) Age-Related Eye Disease Study (AREDS)

  The Age-Related Eye Disease Study (AREDS) was initially designed as a long-term multi-center, prospective study of the clinical course of age-related macular degeneration (AMD) and age-related cataract. In addition to collecting natural history data, AREDS included a clinical trial of high-dose vitamin and mineral supplements for AMD and a clinical trial of high-dose vitamin supplements for cataract. AREDS participants were 55 to 80 years of age at enrollment and had to be free of any illness or condition that would make long-term follow-up or compliance with study medications unlikely or difficult. On the basis of fundus photographs graded by a central reading center, best-corrected visual acuity and ophthalmologic evaluations, 4,757 participants were enrolled in one of several AMD categories, including persons with no AMD. The clinical trials for AMD and cataract were conducted concurrently. AREDS participants were followed on the clinical trials for a median time of 6.5 years. Subsequent to the conclusion of the clinical trials, participants were followed for an additional 5 years and natural history data were collected. The AREDS research design is detailed in AREDS Report 1. AREDS Report 8 contains the mainline results from the AMD trial; AREDS Report 9 contains the results of the cataract trial. Blood samples were also collected from 3,700+ AREDS participants for genetic research. Genetic samples from 600 AREDS participants (200 controls, 200 Neovascular AMD cases, and 200 Geographic Atrophy cases) were selected using data available in March 2005 and then were evaluated with a genome-wide scan. These data, as well as selected phenotypic data, were made available in the dbGaP. DNA from AREDS participants, which is currently being stored in the AREDS Genetic Repository, is available for research purposes. However, not all of the 3,700+ AREDS participants who submitted a blood sample currently have DNA available. In addition to including the data from the genome-wide scan on the 600 original samples, this second version of the AREDS dbGaP database provides a comprehensive set of data tables with extensive clinical information collected for the 4,757 participants who participated in AREDS. The tables include information collected at enrollment/baseline, during study follow-up, fundus and lens pathology, nutritional estimates, quality of life measures and measures of morbidity and mortality. In November 2010, over 72,000 high quality fundus and lens photographs of 595 AREDS participants (of the original 600 selected for the genome-wide scan) were made available in the AREDS dbGaP. In addition to the genome-wide scan data, the fundus and lens grading data for these participants are also available through the AREDS dbGaP. Details about the ocular photographs that are available may be found in the document "Age-Related Eye Disease Study (AREDS) Ocular Photographs". In January 2012, a measure of daily sunlight exposure was added in a separate "sunlight" table. Furthermore, the "followup" table has been revised. The visual acuity for the right eye was inadvertently missing at odd-numbered visits (01, 03, 05, etc.). This data is now part of the table. In February 2014 over 134,500 high-quality fundus photographs (macular field F2) of 4613 AREDS participants were added to the existing AREDS dbGaP resource. The AREDS dbGaP image archive already contains over 72,000 high quality fundus and lens photographs of 595 AREDS participants for whom dbGaP-accessible genotype data exist. Information about the available ocular photographs found in the document "Age-Related Eye Disease Study (AREDS) Ocular Photographs" has been updated with an addendum. It is hoped that this resource will better help researchers understand two important diseases that affect an aging population. These data may be applied to examination and inference on genetic and genetic-environmental bases for age-related diseases of public health significance and may also help elucidate the clinical course of both conditions, generate hypotheses, and aid in the design of clinical trials of preventive interventions. Definitions of Final AMD Phenotype Categories Please see phd001138.1 for a detailed description of how AREDS participants' final AMD phenotype was categorized. User's Guide for AREDS Phenotype Data A detailed User's Guide for the AREDS phenotype data is available. This User's Guide is meant to be a comprehensive document which explains the complexities of the AREDS data. It is recommended that all researchers using AREDS phenotype data make use of this User's Guide.

  Study phs000001

• Human Companion Data for 'A Transcriptomic Atlas of Mouse Cerebellar Cortex Reveals Novel Cell Types'

  In this study, we used single-nucleus RNA-seq to comprehensively define the cell specialization of the mouse cerebellar cortex and vermis. We focused in particular on two interneuron populations—the unipolar brush cells (UBCs) and the molecular layer interneurons (MLIs), identifying continuous variation within the former population, and a new discrete axis of variation in the latter. Human postmortem tissue was used to demonstrate that these specializations are evolutionarily conserved in primates. Together, these findings provide the first comprehensive cellular atlas of the cerebellar cortex, and outline a methodological and conceptual framework for the integration of molecular, morphological, and physiological ontologies for defining brain cell types.

  Study phs002414

• PGRN-Leducq: Identification of the KCNE1 D85N Polymorphism as a Possible Modulator of Drug-Induced Torsades de Pointes

  The goal of this study was to search for genetic variants that could be responsible for modifying the risk of drug-induced long QT syndrome (diLQTS). diLQTS is a relatively common adverse drug event and has been a leading cause for drug relabeling and withdrawal from the market. Our hypothesis, that variants in genes which regulate electrical properties in the heart modify the risk of diLQTS, was tested by genotyping patients of European descent at 1424 single nucleotide polymorphisms (SNPs) in 18 candidate genes. We found that the SNP KCNE1 D85N was highly predictive of diLQTS with an odds ratio of 9.0 (95% confidence interval: 3.5-22.9).

  Study phs000617

• A Phase II Study: CRS207/GVAX Plus Anti-PD1 and Anti-CTLA4 Recruits Mesothelin- and KRAS-Specific T cells into PDAC

  This study examined immunologic correlatives from a phase II study evaluating CRS207/GVAX vaccines in combination with anti-PD1 and anti-CTLA4 in metastatic pancreatic cancer (NCT03190265). Arm A received CRS207/GVAX with anti-PD1 and anti-CTLA4 therapy; Arm B received CRS207 with anti-PD1 and anti-CTLA4 therapy. Patients undergoing treatment in this trial had peripheral blood mononuclear cells (PBMCs) and tumor tissue biopsied serially at pre-treatment and on-treatment timepoints. Single-cell RNA/TCR sequencing was employed on PBMCs. Bulk RNA/TCR sequencing was employed on tumor tissues. We identified treatment-enriched inflammatory pathways as well as T cell repertoires.

  Study phs003798

• Proteomic Characterization of Intrahepatic Cholangiocarcinoma Identifies Risk-Stratifying Subgroups, Proteins Associated with Time-To-Recurrence, and mTOR Effector Molecule EIF4A1 as a Druggable Therapeutic Target

  Using mass spectrometry-based proteomics, we analyzed two independent cohorts comprising 80 and 62 treatment-naive ICC tumors, 67 adjacent non-malignant tissues, and 9 patient-derived xenografts (PDX). In the first cohort, we identifed two subclusters with distinct times-to-recurrence (TTR). A 4-protein classifier trained on our data cohort accurately stratifies these ICC clusters in the Dong et al. dataset (2022) and in our independent second cohort, revealing similar associations between proteomic motifs and clinical outcomes. The Translation regulator EIF4A1 emerges as a therapeutic target, as its inhibition with novel drug eFT226 significantly reduces tumor growth in an ICC PDX model.

  Study EGAS50000001343

• SCI-MAP: Single Cell Microgel embedded iPS-cells to map molecular variability of cell differentiation using a systems biology approach

  In the SCI-MAP project we will map cell states encountered across a previously established 49 day in vitro chondrogenic differentiation protocol. We do this to optimise the differentiation process for therapeutic and in vitro modelling ends. We collect epigenetic open chromatin and phenotypic transcriptome data to determine cell states and so performed single nucleus sequencing in two modalities: RNA- and ATAC-sequencing. Data was collected in a time series experiment at 7 points: Days 0, 3, 6, 8, 14, 21, and 49, starting with the first pilot data from day 21 (D21) then the actual experiment time series 1 (TS1) of days 0, 3, 6, 8, 14, and 49.

  Study EGAS50000001756

• The European Bank for Induced Pluripotent stem cells (EBiSC) is designed to address the increasing demand by iPSC researchers for quality-controlled, disease-relevant research grade iPSC lines, data and cell services.In this study Whole Genome Sequencing was performed on a selection of lines from the project.

  Induced pluripotent stem (iPS) cells have the potential to significantly advance drug development and health research, yet collections of stem cells are scattered across the world, their quality cannot always be guaranteed, and accessing them is often difficult. The goal of EBiSC is to establish a European iPS cell bank that will be the ‘go-to’ resource for the characterisation, storage and distribution of high quality iPS cells. Ultimately, EBiSC will become an independent organisation, distributing high quality iPS cells on a not-for-profit basis to scientists worldwide.

  Study EGAS00001002755

• Identification and functional characterisation of a rare MTTP variant underlying familial non-alcoholic fatty liver disease

  We identified a rare causal variant in MTTP, c.1691T>C p.I564T (rs745447480) encoding microsomal triglyceride transfer protein (MTP) causing progressive non-alcoholic fatty liver disease with cirrhosis and hepatocellular carcinoma unrelated to metabolic syndrome, without manifestations of abetalipoproteinemia, in a four generation family with South Asian ancestry. Variant-expressing hepatocyte-like-cells (HLCs) derived from human induced pluripotent stem cells generated from homozygous donor skin fibroblasts had lower lipoprotein ApoB secretion, compared to wild type cells. Cytoplasmic triglyceride accumulation in HLCs triggered endoplasmic reticulum stress, secretion of pro-inflammatory mediators, production of reactive oxygen species, delineating the progression of disease associated with homozygosity for MTTP p.I564T

  Study EGAS00001005254

• EGA submission account terms

  Submission account terms Each EGA submission account has a dedicated submission box. To ensure continued service to all submitters EGA submission boxes should not exceed 8Tb in size, and cannot exceed 12Tb. Those that are near to or exceeding this value will be monitored on a weekly basis by the helpdesk team and the submitter will be contacted and guidance provided accordingly on completing their metadata registration. You will be able to register your metadata associated with the files in your submission account via EGA Submitter Portal, Webin or the EGA REST API. EGA also requests that metadata is submitted within 60 days of upload data to a submission box. When we detect files that are over 60 days old in a submission box we will notify the submitter requesting that metadata be submitted or the files removed from the submission box. It is important to note that data is not archived at the EGA until the metadata describing the files has been associated and the archival process has completed. It is only when associated metadata has been submitted that the archival process into EGA is fully triggered. EGA removes files from the submission box once they have been successfully archived, so no action is required by a submitter to remove successfully archived files. Files over 90 days old will be deleted from the submission box unless EGA Helpdesk has been contacted and confirmed an exemption with the submitter.

  Documentation submission/terms

• 33 patients with Monoclonal Gammopathy of Undetermined Significance (MGUS)

  Monoclonal gammopathy of undetermined significance (MGUS) is a premalignant precursor of multiple myeloma (MM) with a 1% risk of progression per year. Although targeted analyses have shown the presence of specific genetic abnormalities such as IGH translocations, RB1 deletion, 1q gain, hyperdiploidy or RAS genes mutations, little is known about molecular mechanism of malignant transformation. We have performed whole exome sequencing together with SNP array analysis in 33 flow-cytometry separated abnormal PC samples of MGUS patients to describe somatic gene mutations and chromosome changes at the genome-wide level. Non-synonymous mutations (NS-SNVs) and copy number alterations (CNAs) were present in 97.0% and in 63.6% of cases, respectively. Importantly, the number of somatic mutations was significantly lower in MGUS compared to MM (p<10-4) and we have identified 6 myeloma significantly mutated genes which are KRAS, NRAS, DIS3, HIST1H1E, EGR1 and LTB in the MGUS dataset. We also found a positive correlation with increasing chromosome changes and somatic mutations. IGH translocations were present in 27.3% of cases comprising t(4;14), t(11;14), t(14;16) or t(14;20) and were in a similar frequency to MM, which corresponded with primary lesion hypothesis. Data from this study showed MGUS is a genetically comprehensive disease, however overall genetic instability is significantly lower compared to MM.

  Dataset EGAD00001001901

• Phenome-wide scanning identifies multiple diseases and disease severity phenotypes associated with HLA variants

  We discover numerous associations between human leukocyte antigen (HLA) variation and a comprehensive set of phenotypes derived from electronic health records.

  Study phs001949

• BipEx_ODonovan_Cardiff

  "BipEx_EGAS000010058452_ODonovan_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000130

• BipEx_Craddock_Cardiff

  "BipEx_EGAS00001005845_Craddock_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,458 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000135

• BipEx_Reif_Wurzburg

  "BipEx_EGAS00001005858_Reif_Wurzburg Bipolar Disorder Exomes. This research project was a collaboration between University Hospital Frankfurt and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 823 Bipolar case/control samples from collaborators in Germany. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000145

• Inhibition of Cbl-b restores effector functions of human intratumoral NK cells

  This study investigates the efficacy of a Cbl-b inhibitor compound in enhancing and reinvigorating the activity of human dysfunctional NK cells.

  Study EGAS50000000574

• BipEx_McQuillin_London

  "BipEx_EGAS00001005851_McQuillin_London Bipolar Disorder Exomes. This research project was a collaboration between University College London, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 3,046 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000136

• BipEx_Blackwood_Edinburgh

  "BipEx_EGAS00001005843_Blackwood_Edinburgh Bipolar Disorder Exomes. This research project was a collaboration between University of Edinburgh, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 932 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000134

• BipEx_Ophoff_Amsterdam

  "BipEx_EGAS00001005853_Ophoff_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between UCLA and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,026 Bipolar case/control samples from collaborators in the Netherlands and UCLA. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000137

• MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model

  This is the DAC for the study "MethylBERT enables read-level DNA methylation pattern identification and tumour deconvolution using a Transformer-based model" of Pavlo Lutsik (DKFZ B370/KU Leuven, pavlo.lutsik@kuleuven.be) and Clarissa Gerhauser (DKFZ B370, c.gernauser@dkfz.de)

  Dac EGAC50000000497

• BipEx_Corvin_TCD

  BipEx_EGAS00001005844_Corvin_Dublin Bipolar Disorder Exomes. This research project was a collaboration between Trinity College Dublin, Ireland and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 191 Bipolar case/control samples from collaborators in Ireland. Genomic DNA from each sample was sequenced to a mean depth of 20x.

  Dac EGAC50000000131

• BipEx_Ouwehand_Cambridge

  "BipEx_EGAS000010058454_Ouwehand_Cambridge Bipolar Disorder Exomes. This research project was a collaboration between Cambridge University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 2,873 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000138

• BipEx_Posthuma_Amsterdam

  "BipEx_EGAS00001005857_Posthuma_Amsterdam Bipolar Disorder Exomes. This research project was a collaboration between VU and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 943 Bipolar case/control samples from collaborators in the Netherlands. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000143

• scMultiome analysis of human tongue cancer organoids

  We performed single-cell Multiome analysis (10X Genomics) of a uniquely established human tongue cancer organoids, including both chemo-sensitive organoids and chemotherapy resistant organoids.

  Study JGAS000606

• BipEx_Owen_Cardiff

  "BipEx_EGAS000010058455_Owen_Cardiff Bipolar Disorder Exomes. This research project was a collaboration between Cardiff University, UK and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 1,106 Bipolar case/control samples from collaborators in UK. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000139

• Long-read methylation analysis of breast cancer using the enzymatic base conversion and the nanopore sequencing

  Long-read methylation analysis by a nanopore sequnecer PromethION was performed using breast samples collected from breast cacner patients.

  Study JGAS000265

• BipEx_Adolfsson_Umea

  "BipEx_EGAS00001005842_Umea University Bipolar Disorder Exomes. This research project was a collaboration between Umea University, Sweden and the Stanley Center at the Broad Institute. In this project we sequenced and analyzed the whole exomes of 924 Bipolar case/control samples from collaborators in Sweden. Genomic DNA from each sample was sequenced to a mean depth of 20x."

  Dac EGAC50000000133

• Nanopore sequencing of FSHD, BAMS and healthy control fibroblast cell lines

  The goal was to resolve the complex genetic and epigenetic structures of D4Z4 alleles, a macrosatellite whose desilencing results in FSHD.

  Study EGAS50000001065

• Whole genome sequencing of ATCWGS42

  WGS of patient ATCWGS42, a patient who responded to BRAF/MEK targeted therapy but relapsed. This folder includes multi-region sequencing from the patient.

  Study EGAS50000001489

• An immune response network associated with blood lipid levels

  Genome-wide genotyping was performed on a population-based cohort from the capital region of Finland using the Illumina 610-Quad SNP microarray

  Study EGAS00000000086

• PFA ependymoma cancer study

  Sequencing data related the PFA ependymoma study (Michealraj et al., Cell 2020), a lethal glial malignancy of the hindbrain found in babies and toddlers.

  Study EGAS00001004312

• BAM files of mapped reads from scDNAsequencing

  scDNAseq at low coverage of samples with different levels of ploidy: Low, High, Near and diploid (normal) plus a pool of Healthy HSPCs cells

  Study EGAS50000000019

• Tumor reactive γδ T cells contribute to a complete response to PD-1 blockade in a Merkel cell carcinoma patient

  Single cell RNA and TCR sequencing of gamma delta T cells from two Merkel cell carcinoma patients

  Study EGAS50000000102

• WHOLE GENOME SEQUENCING OF CLEAR CELL RENAL CELL CARCINOMA IN VHL PATIENT

  This submission contains Whole Genome Sequencing data of six ccRCCs, four cysts and one blood DNA sample of a VHL patient.

  Study EGAS50000000295

• Single-nucleus RNA-sequencing of normal adrenal cortex and adrenocortical tumors

  This study reports a single-nucleus transcriptome atlas of steroid, stromal and immune cells in 38 human normal adrenals and adrenocortical tumors.

  Study EGAS50000000585

• non-malignant plasma cfRNA

  Dataset contains mRNA capture sequencing data from plasma of 125 different human donors: 88 patients with a non-malignant disease and 37 cancer-free controls. Samples were sequenced on a NovaSeq X and sequencing data is provided in FASTQ format.

  Dataset EGAD50000001806

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• Whole Exome Sequencing of Bipolar cases and controls on a cohort from Umea, Sweden

  Whole Exome Sequencing of 924 Bipolar cases and matched controls performed at the Broad Institute on a cohort from Umea, Sweden. The exome used Twist capture and samples were sequenced on Illumina HiSeqX machines producing cram files

  Dataset EGAD50000000470

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• Stability of kidney organoids in culture

  A whole genome mutation analysis of cortical kidney tissue, an early passage kidney organoid culture derived from the kidney tissue sample, and a late passage of the same organoid culture.

  Dataset EGAD00001003805

• Genetics of Microcephalic Osteodysplatics Primordial Dwarfism

  This project aims to find causal variants in 50 patients diagnosed with Microcephalic Osteodysplastic Primordial Dwarfism (MOPD), of presumed recessive inheritance performing whole exome sequencing to ~50x mean depth.This is a collaboration with Prof A. Jackson, MRC Human Genetics Unit, Edinburgh

  Dataset EGAD00001000342

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Melanoma C32 ENU resistance to Combination Therapy

  This study involves mutagenizing C32, a melanoma cell line, with ENU to identify those mutations which engender resistance to a targeted treatment.

  Dataset EGAD00001002234

• Immunopeptidomics of colorectal cancer organoids reveals a sparse HLA class I neoantigen landscape and no increase in neoantigens with interferon or MEK-inhibitor treatment

  Whole exome sequencing data from a series of 5 patient derived organoids (PDOs) established from metastatic colorectal cancers (CRCs).

  Dataset EGAD00001005357

• Synchronous Colorectal Cancer genome sequencing

  Here, we performed a characterisation of 12 tumours and matched normal samples from 3 syCRC patients by whole genome sequencing: Patient A (tumours A1 and A2), Patient B (tumours B1-B5), and Patient C (tumours C1-C5). Somatic SNVs, indels and stuructural variants were called.

  Dataset EGAD00001006131

• RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  RNA-Seq data for manuscript titled: A sporadic Alzheimers blood-brain barrier model for developing ultrasound-mediated delivery of Aducanumab and anti-Tau antibodies

  Dataset EGAD00001008670

• WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  WGS and WES data for manuscript titled: ctDNA as a biomarker of progression in oesophageal adenocarcinoma

  Dataset EGAD00001008554

• Variants from a subset of genes from WES of adult AML patient samples

  Dataset comprises one vcf file containing variants from a list of genes (DNA repair and metabolism associated genes) subset from WES of an adult AML cohort. The cohort contains 145 patient samples. WES was performed using Illumina platform.

  Dataset EGAD00001008700

• Capture-based NGS

  Capture-based NGS obtained using the "all-CLL" panel (also known as SOPHiA DDM (TM) Community CLL Clonality Solution). Library preparation was performed following SOPHiA GENETICS recommendations using 200 ng genomic DNA. Libraries were sequenced on a MiSeq instrument (2x300 bp, Illumina) aiming at a mean coverage of 1,000x.

  Dataset EGAD00001011151

• Research Program on Genes, Environment and Health (RPGEH)

  The Kaiser Permanente Research Program on Genes, Environment, and Health (RPGEH) is a resource developed to facilitate research on genetic and environmental factors on common diseases and healthy aging. The RPGEH resource links biospecimens, health surveys, and comprehensive electronic medical records on broadly consented adult members of Kaiser Permanente Medical Care Plan, Northern California Region (KPNC). KPNC is an integrated health care delivery system with a membership of approximately 3.3 million people in northern California. The membership of KPNC is representative of the general population in the 14 county area in which facilities are located, although extremes of income are underrepresented. At the end of 2013, the RPGEH resource included: (1) demographic and behavioral surveys from over 430,000 participants; (2) biospecimens (DNA, serum, plasma, and/or saliva) from over 204,000 participants, including over 13,000 pregnant women; (3) genome-wide genotype data (70 billion SNP genotypes) on over 100,000 participants, including the Genetic Epidemiology Research on Adult Health and Aging (GERA) cohort; and (4) the longitudinal electronic medical records of the participants. The RPGEH was developed beginning in 2005 at the Division of Research of Kaiser Permanente Northern California by Catherine Schaefer (Director), Neil Risch (Co-Director), Lisa Croen, Eric Jorgenson, Lawrence Kushi, Charles Quesenberry, Sarah Rowell, Carol Somkin, Stephen Van den Eeden, Larry Walter, and Rachel Whitmer. Funding of the RPGEH was provided to C. Schaefer (PI) and N. Risch (co-PI) by the Wayne and Gladys Valley Foundation, The Ellison Medical Foundation, the Robert Wood Johnson Foundation, Kaiser Permanente Northern California, and the Kaiser Permanente National and Regional Community Benefit Programs. The GERA cohort was funded by a grant from NIH to RPGEH and UCSF (RC2 AG036607; C. Schaefer and N. Risch, PIs). At the time of the award of the RC2 project in late 2009, the RPGEH had established a cohort of about 140,000 individuals who had answered a detailed survey, provided saliva samples for extraction of DNA, and given broad consent for the use of their data in studies of health and disease. Survey and Cohort Recruitment. Initially, the RPGEH developed electronic disease registries to enable identification of phenotypes, using algorithms applied to EMR data. In 2007, the RPGEH mailed a four page survey to 1.9 million adult (≥ 18 years old) members of KPNC who had been members for two years or more, to obtain data on demographic and behavioral factors complementary to the clinical data in the EMR. The survey materials included a cover letter introducing the RPGEH, a two page list of Frequently Asked Questions, and the survey, which included questions on demographic factors such as education, race-ethnicity, income and marital status, dietary factors, physical activity, smoking, and alcohol consumption, as well as reproductive history and reproductive health. Members whose electronic medical records indicated a preference for written communications in Chinese or Spanish received survey materials both in English and a Chinese or Spanish translation. Approximately 400,000 completed surveys were returned. Saliva Sample Collection. Beginning in July 2008, respondents to the survey were asked to sign and return a consent form and authorization for use and disclosure of protected health information. The consent form authorized broad use of biospecimens, survey data, and data from participants' electronic health records for use in studies of genetic and environmental influences on health and disease. Respondents who returned completed consent forms were mailed (Oragene) saliva collection kits; more than 132,000 saliva samples were collected in two years. Completed saliva kits were scanned and archived in a temporary biorepository at the KPNC Division of Research. In late 2009, the RPGEH began collection of saliva samples from the California Men's Health Study (CMHS), a cohort that had been previously assembled in 2002-2003 and had been excluded from the RPGEH survey mailing with the intent of later adding CMHS participants to the assembled RPGEH cohort. The CMHS was developed to facilitate research on prostate cancer and other conditions in older men; the study protocol is described in Enger, et al., 2006. It enrolled and surveyed more than 40,000 men in KPNC, ages 45-69 years, who were members of KPNC during 2002-2003. CMHS men completed two mailed surveys with demographic and behavioral data similar to that of the RPGEH. The data on analogous variables were reconciled and integrated with the data derived from the RPGEH cohort for use in the RPGEH resource. By 2011, RPGEH collected approximately 15,400 saliva samples from men participating in the CMHS. RPGEH Access and Collaborations Website and Procedures. The RPGEH maintains a web portal for inquiries and applications for collaboration and access to data. The url is: https://rpgehportal.kaiser.org/. RPGEH has an application process and an Access Review Committee that reviews applications for collaboration and use. For more information, please contact RPGEH through the website.

  Study phs000788

• The Genetic Architecture of Smoking and Smoking Cessation

  This study includes samples from two projects: Collaborative Genetic Study of Nicotine Dependence (COGEND; PI: Laura Bierut) and University of Wisconsin Transdisciplinary Tobacco Use Research Center (UW-TTURC; PI: Timothy Baker). Data are available for an additional 1420 COGEND subjects through the Study of Addiction: Genetics and Environment (SAGE), dbGaP study accession phs000092. The majority of these subjects are independent from the current study, but there is a small amount of overlap between the two samples (n=29 subjects) for quality control purposes. It should be noted that the case definition in the SAGE study is DSM-IV alcohol dependence. The case definition in the current study is nicotine dependence by a current score of 4 or greater on the Fagerström Test for Nicotine Dependence (FTND). The overall goal of this project is to identify and characterize genetic variants that contribute to the development of nicotine dependence, related smoking behaviors, and smoking cessation. The COGEND sample includes unrelated cases and controls for a genetic association study of nicotine dependence. Cases are defined by a commonly used definition of nicotine dependence, a current score of 4 or more (maximum score of 10) on the Fagerström Test for Nicotine Dependence (FTND). Control status is defined as an individual who smoked at least 100 cigarettes during their lifetime, yet never became dependent (lifetime FTND=0). By selecting controls who smoked, those genetic effects that are specific to nicotine dependence can be examined. The UW-TTURC sample includes nicotine dependent smokers from three smoking cessation studies. Subjects had to smoke at least 10 cigarettes per day (confirmed smoking by an alveolar carbon monoxide (CO) level greater than 9) and report being motivated to quit smoking. Participants were excluded based on evidence of psychosis history, clinically significant depression symptoms, other severe mental illness, or contraindications to smoking cessation medications. COGEND: COGEND was initiated in 2001 as a three-part program project grant funded through the National Cancer Institute (NCI; PI: Laura Bierut). The three projects included a study of the familial transmission of nicotine dependence, a genetic study of nicotine dependence, and a study of the relationship of nicotine dependence with nicotine metabolism. The primary goal is to detect, localize, and characterize genes that predispose or protect an individual with respect to heavy tobacco consumption, nicotine dependence, and related phenotypes and to integrate these findings with the family transmission and nicotine metabolism findings. The primary design is a community based case-control family study. Nicotine dependent cases and non-dependent, smoking controls were identified and recruited from Detroit and St. Louis. In addition, one sibling for each case and control subject was recruited in a subset of the sample. More than 54,000 subjects aged 25-44 years were screened by telephone; more than 3,100 subjects were personally interviewed; and more than 2,900 subjects donated blood samples for genetic studies. UW-TTURC: The UW-TTURC was initiated in 2001 as a study of nicotine dependence and smoking cessation treatment. The second round of UW-TTURC was initiated in 2005 as a study of efficacy of smoking cessation and long term outcomes. Nicotine dependent smokers seeking cessation treatment were identified and recruited from Madison and Milwaukee, WI. Over 9,000 adult smokers were screened by telephone; 2,575 individuals were enrolled and randomized to treatment conditions that involved use of different smoking cessation medications. Participants from the UW-TTURC smoking cessation clinical trials had the option of participating in a genetic substudy, and approximately 2,000 donated blood samples for genetic studies. The goal of the genetic studies of smokers seeking cessation treatment is to detect, localize, and characterize genes that predispose or protect an individual with respect to heavy tobacco consumption, nicotine dependence, and related phenotypes including cessation, withdrawal, and relapse. Both studies (COGEND and UW-TTURC) include measures of basic socio-demographic variables, including age, sex, race/ethnicity, family income, and educational attainment. Information on nicotine dependence, as assessed by the Fagerström Test for Nicotine Dependence (FTND) is available for all subjects. In addition, participants also completed the Nicotine Dependence Syndrome Scale (NDSS; Shiffman et al., 2004) and the Wisconsin Inventory of Smoking Dependence Motives (WISDM-68; Piper et al, 2004). Coding for both individual variables and indices has been standardized across studies. All subjects were assessed in person by trained research assistants. This study is part of the Gene Environment Association Studies initiative (GENEVA, http://www.genevastudy.org) funded by the trans-NIH Genes, Environment, and Health Initiative (GEI). The overarching goal is to identify novel genetic factors that contribute to the genetic architecture of smoking through large-scale genome-wide association studies of two well-characterized cohorts. Genotyping was performed at the Johns Hopkins University Center for Inherited Disease Research (CIDR). Data cleaning and harmonization were done at the GEI-funded GENEVA Coordinating Center at the University of Washington.

  Study phs000404

• NHLBI TOPMed: The Jackson Heart Study (JHS)

  Since there is a greater prevalence of cardiovascular disease among African Americans, the purpose of the Jackson Heart Study (JHS) is to explore the reasons for this disparity and to uncover new approaches to reduce it. The JHS is a large, community-based, observational study whose 5306 participants were recruited from among the non-institutionalized African-American adults from urban and rural areas of the three counties (Hinds, Madison, and Rankin) that make up the Jackson, MS, metropolitan statistical area (MSA). Jackson is the capital of Mississippi, the state with the largest percentage (36.3%) of African Americans in the United States. The JHS design included participants from the Jackson ARIC study who had originally been recruited through random selection from a drivers' license registry. Approximately six months before the JHS was to begin, an amendment to the federal Driver's Privacy Protection Act was passed that changed the level of consent for public release of personal information from driver's license lists from an "opt out" to an "opt in" basis. The Mississippi Highway Patrol was no longer able to release a complete listing of all persons with driver's licenses or state identification cards, which prevented its use in the JHS. New JHS participants were chosen randomly from the Accudata America commercial listing, which provides householder name, address, zip code, phone number (if available), age group in decades, and family components. The Accudata list was deemed to provide the most complete count of households for individuals aged 55 years and older in the Jackson MSA. A structured volunteer sample was also included in which demographic cells for recruitment were designed to mirror the eligible population. Enrollment was opened to volunteers who met census-derived age, sex, and socioeconomic status (SES) eligibility criteria for the Jackson MSA. In addition, a family component was included in the JHS. The sampling frame for the family study was a participant in any one of the ARlC, random, or volunteer samples whose family size met eligibility requirements. Eligibility included having at least two full siblings and four first degree relatives (parents, siblings, children over the age of 21) who lived in the Jackson MSA and who were willing to participate in the study. No upper age limit was placed on the family sample. Known contact information was obtained during the baseline clinic examination from the index family member with a verbal pedigree format to identify name(s), age(s), address (es), and telephone number(s). Recruitment was limited to persons 35-84 years old except in the family cohort, where those 21 years old and above were eligible. Only persons who otherwise met study criteria but were deemed to be physically or mentally incompetent by trained recruiters were excluded from study eligibility.1 1 Wyatt SB, Diekelmann N, Henderson F, Andrew ME, Billingsley G, Felder SH et al. A community-driven model of research participation: the Jackson Heart Study Participant Recruitment and Retention Study. Ethn Dis 2003; 13(4):438-455 (PMID: 14632263).

  Study phs000964

• Methylation biomarker study of magnesium deficiency and colorectal cancer

  Five US studies using the Mg tolerance test, the "gold standard" test of Mg status, indicated that >50% participants had Mg deficiency. In our ongoing US trial, we have found a similar result. In growing recognition of the importance of Mg in human health, very recently, Mg was selected by the US Federal Dietary Reference Intake (DRI) Committee to update the DRI. In US and other populations at high risk of Mg deficiency, high Mg intake has been linked to reduced risk of colorectal neoplasia, insulin resistance, metabolic syndrome, type 2 diabetes, and cardiovascular disease (CVD). Conversely, in populations not at high risk of Mg deficiency, high Mg intake has been related to increased risk of total mortality (e.g. total cancer, colorectal cancer, and CVD), particularly when calcium intake is low. These observations suggest that the associations between high Mg intake and disease risks may completely differ by the underlying Mg status. Due to major limitations, the Mg tolerance test is not used in conventional clinical practice and rarely used in research. Instead, serum Mg is used for clinical diagnosis. However, serum Mg performs very poorly at identifying those with Mg deficiency. There is a great need to develop implementable, sensitive, and specific biomarkers which can be easily used for identifying people with Mg deficiency. Without such a marker, it is impossible to develop effective strategies that minimize adverse effects by targeting those who, as a result of Mg deficiency, are at risk of common diseases. It is known that DNA methylation changes are inducible by environmental exposures, including nutrients, and reversible when the exposure disappears. There are two major types of cytosine modifications in DNA, 5-hydroxymethylcytosine (5-hmC) and 5-methylcytosine (5-mC). 5-mC is often associated with suppressed gene expression. 5-hmC, generated by the oxidation of 5-mC, is specifically enriched in expressed genes and plays a critical role in activating and/or maintaining gene expression. However, current epigenomic profiling platforms cannot distinguish 5-hmC from 5-mC. Just recently, our collaborator, Dr. Chuan He (HHMI Investigator), established a novel and state of the art technique, TAB-Seq and TAB-Array protocol, which can separate 5-hmC from 5-mC in the genome. Our pilot studies indicate that Mg intake or treatment significantly affects methylation capacity, 5-mC and 5-hmC biomarkers. Our findings suggest blood leukocyte 5-hmC/5-mC biomarkers may serve as more sensitive biomarkers to identify Mg deficiency than serum Mg. Thus, a comprehensive epigenome-wide association study (EWAS) may help to identify the most sensitive 5-hmC/ 5- mC biomarkers for Mg deficiency. We propose to identify 5-hmC/5-mC biomarkers for Mg deficiency by a 4- phase EWAS study in the "Personalized Prevention of Colorectal Cancer Trial [PPCCT, R01CA149633; PI, Dai and Yu]" with a total of 240 participants. Mg tolerance test will be used as the gold standard. Finally, using newly identified biomarkers, we will evaluate if 12-week Mg treatment reduces TRPM7 expression, essential in Mg homeostasis and colorectal carcinogenesis, in rectal tissues only among those with Mg deficiency.

  Study phs002037

• INCLUDE: The Epidemiology of Transient Leukemia in Newborns with Down Syndrome

  The INCLUDE (INvestigation of Co-occurring conditions across the Lifespan to Understand Down syndromE) Project is an NIH-wide collaboration that seeks to improve health and quality-of-life for people with Down syndrome. The INCLUDE Project Data Coordinating Center and partners created the INCLUDE Data Hub, a centralized data resource that allows access to large-scale clinical and multi-omics datasets specific to Down syndrome and supports collaborative, cloud-based analysis to accelerate scientific discoveries related to Down syndrome and its co-occurring conditions.Down syndrome (DS) is associated with a remarkably high risk of childhood acute myeloid leukemia (AML), with an approximately 500-fold increased risk of the rare subtype acute megakaryoblastic leukemia. Though largely treatable, a proportion of myeloid leukemia in DS (ML-DS) patients relapse with dismal survival. ML-DS is preceded by a preleukemia, transient abnormal myelopoiesis (TAM), which presents clinically at birth and is driven by somatic truncating mutations in the erythro-megakaryocytic transcription factor gene GATA1. Up to 15% of DS newborns have TAM, and this can be fatal in up to 20% of cases. A further 10-15% of newborns with DS harbor subclonal GATA1 mutations with clinically silent disease (i.e., Silent TAM). Of the DS newborns with either TAM or Silent TAM (i.e., transient leukemia), up to 15% will acquire additional somatic mutations and progress to ML-DS. We predict that germline variation modifies the risk of developing somatic truncating GATA1 mutations, the first step towards ML-DS, however this has yet to be examined. To address this, the main aim of this X01 study is to perform the first genetic association study of GATA1 mutations in DS, through whole-genome sequencing (WGS) of 470 DS newborns in the Oxford Down Syndrome Cohort Study (ODSCS). Targeted sequencing of GATA1 has already been performed in the 470 DS newborns in the ODSCS, with 130 (28%) confirmed to harbor a somatic truncating GATA1 mutation. We will perform a genome-wide association study (GWAS) of GATA1 mutations to assess genetic variation genome-wide, in particular focusing on variants in candidate genes on the trisomic chromosome 21, RUNX1, ERG, ETS2, and DYRK1A, which have previously been associated with upregulation of GATA1. We will also carry out a chromosome X-wide association study (XWAS) to investigate genetic variation at the GATA1 gene, which resides on chromosome X. WGS data will also enable us to assess the potential role of copy number variation in the risk of transient leukemia in DS. Discovering genetic risk factors for GATA1 mutations in DS may reveal targets for new targeted therapies for TAM, and also inform the etiology of ML-DS as well as AML in the non-DS population. Finally, the ODSCS includes rich phenotypic data for the 470 DS newborns, including clinical diagnosis of TAM and other hematologic complications, complete blood counts, maternal pregnancy complications, and information on congenital heart disease and other birth defects. Thus, whole genome sequencing data in DS newborns from the ODSCS will provide a rich resource for the DS research community.

  Study phs002982

• RNA Expression in Diverse Donor Derived Dermal Fibroblasts Correlates with Reprogramming to Pluripotency

  The cohort used in this study includes 36 African American (17 female, 19 male) and 36 White American (19 female, 17 male) individuals. The total cohort has a median age of 32 years, with a range of 20-64 years. The African American cohort has a median age of 34, with a range of 21-52 years. The White American cohort has a median age of 31, with a range of 20-64 years. Primary dermal fibroblast lines were derived from skin biopsies obtained from adult individuals at the NIEHS under institutional review board approved protocol human subjects 10-E-0063, "Sample Collection Registry for Quality Control of Biological and Environmental Specimens and Assay Development and Testing protocol" (ClinicalTrials.gov #NCT01087307). All participants gave written informed consent for tissue donation. Donor sex, age, and ancestry were voluntarily self-reported. Fibroblast cells were reprogrammed via lentiviral transduction using six transcription factors contained in three plasmids (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M). Reprogramming efficiency was determined by alkaline phosphatase staining of triplicate 10cm reprogrammed dishes containing colonies, which were then scanned. The saved images were analyzed with ImageJ 1.51h (Wayne Rasband, National Institutes of Health, USA) to count colonies, using color threshold adjusted and binary converted images of each dish. Triplicate plates were averaged and reported as colony counts or percent reprogramming efficiency ((# of colonies/250,000) x100). The African American cohort had reprogramming efficiencies ranging from 0.06-1.37%, with a median of 0.655%. The White American cohort had reprogramming efficiencies ranging from 0.02-1.13%, with a median of 0.455%. Our goal was to define transcriptomic heterogeneity that could be contributing to differences in reprogramming efficiency between individuals and between groups. Total RNA was obtained from dermal fibroblasts and matched iPSCs. For each sample, 500 ng total RNA was used as input for preparation of whole transcriptome rRNA depleted libraries. An adapter-ligated library was prepared with the KAPA HyperPrep Kit (KAPA Biosystems, Wilmington, MA) using Bioo Scientific NEXTflex™ DNA Barcoded Adapters (Bioo Scientific, Austin, TX, USA) according to KAPA-provided protocol. Sequencing was performed using an Illumina HiSeq 2500 following Illumina-provided protocols for 2x150 bp paired-end sequencing. Each transcriptome was sequenced to a target depth of 125 million reads. The following mean raw reads were obtained: African American dermal fibroblasts= 129,571,450; White American dermal fibroblasts= 131,939,505; African American iPSCs= 132,501,335; White American iPSCs= 134,394,164. Raw reads were aligned to hg19 using the STAR alignment tool (https://github.com/alexdobin/STAR). The following mean aligned reads were obtained: African American dermal fibroblasts= 123,315,343; White American dermal fibroblasts= 125,178,035; African American iPSCs= 123,148,312; White American iPSCs= 123,886,992. Reprinted from L. C. Mackey et al., Epigenetic Enzymes, Age, and Ancestry Regulate the Efficiency of Human iPSC Reprogramming. Stem Cells 36, 1697-1708 (2018), with permission from Wiley. Reprinted from L. S. Bisogno et al., Ancestry-dependent gene expression correlates with reprogramming to pluripotency and multiple dynamic biological processes. Science Advances 6 (47) (2020) (PMID: 33219026), with permission from AAAS.

  Study phs002341

• Treatment Options for Type 2 Diabetes in Adolescents and Youth (TODAY)

  The National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) of the National Institutes of Health (NIH) has sponsored a consortium of investigators to conduct a clinical treatment trial, Treatment Options for type 2 Diabetes in Adolescents and Youth (TODAY). The primary objective of the TODAY trial is to compare the efficacy of three treatment arms on time to treatment failure based on glycemic control. The secondary aims are to:compare and evaluate the safety of the three treatment arms;compare the effects of the three treatments on the pathophysiology of type 2 diabetes (T2D) with regards to beta cell function and insulin resistance, body composition, nutrition, physical activity and aerobic fitness, cardiovascular risk factors, microvascular complications, quality of life, and psychological outcomes;evaluate the influence of individual and family behaviors on treatment response; andcompare the relative cost effectiveness of the three treatment arms.The three treatment regimens are: (1) metformin alone, (2) metformin plus rosiglitazone, and (3) metformin plus an intensive lifestyle intervention called the TODAY Lifestyle Program (TLP). The study recruits patients over a three-year period and follows patients for a minimum of two years. Patients are randomized within two years of the diagnosis of T2D.

  Study phs002447

• Genome Variation among HIV-Resistant People with Hemophilia

  Rare individuals are highly resistant to infection with human immunodeficiency virus (HIV). Studies of candidate genes resulted in the discovery of a 32bp deletion in the CC-chemokine receptor 5 gene (CCR5Δ32), which rendered this critical co-receptor for primary HIV infection to be non-functional. Pharmacologic and vaccine-induced blockade of CCR5 is being pursued to treat and prevent HIV infection and other conditions. The allele frequency of CCR5Δ32 among persons of European ancestry is approximately 10%. CCR5Δ32/Δ32 homozygotes are almost totally resistant to HIV infection. People with severe hemophilia A require frequent replacement with clotting Factor VIII (FVIII) to control hemorrhage. Prior to the discovery of HIV in 1984 and licensure of recombinant FVIII in the late 1980s, people with severe hemophilia A were treated with plasma-derived FVIII and thus were intensively exposed to HIV. Only 5% of such patients were not infected with HIV. Of these, approximately 1/3 were CCR5Δ32/Δ32 homozygotes. The remaining 2/3 of these people who were highly resistant to HIV remain unexplained. This project seeks to discover genome variations among people who are highly resistant to HIV infection. Such variation is likely to serve as a target for reducing the morbidity and incidence of HIV.

  Study phs000445

• Gene Expression Signatures Characterized by Longitudinal Stability and Inter-Individual Variability Delineate Baseline Phenotypic Groups with Distinct Responses to Immune Stimulation

  RNA sequencing (RNAseq) of peripheral blood lymphocytes was used to develop a means to assess immune function in a way that can be used in discovery science and applied to patients individually in clinical settings. The premise is that profiles of RNA present in immune cells is reflective of the combined influence of genetic and environmental variation on immune potential of individuals and that this potential can be tapped to understand human immunity in a variety of biological contexts. CD4+ cells were isolated from fresh whole blood via positive magnetic bead selection and cell lysates were prepared using Qiazol (QIAGEN) and stored at -80ºC for 3 to 8 months. RNA was extracted in batches for cDNA library preparation and RNA-Seq. For this study, we developed standard operating procedures for handling human blood samples and determined: a) the best way to enrich for CD4+ T cells from whole blood and yield high quality RNA, b) the sensitivity of this RNA profiling strategy, and c) the reproducibility of generated immune profiles from healthy subjects. We then developed bioinformatics processes to establish immune response signatures and immune response phenotypes within cohorts of individuals.

  Study phs001512

• Identification and Molecular Characterization of Somatic Mutations in Malformations of Cortical Development

  Genetic mutations causing disease may be inherited, newly acquired in parental gametes and present in the zygote or acquired as somatic events at some point in development after fertilization. The burden and localization of an acquired mutation depend on when the mutation arises. As is the case for inherited genetic variation, there is accumulating evidence that somatic mutations can lead to severe tissue-specific disease. Malformations of cortical development (MCD) represent a group of disorders characterized by a range of morphological and structural abnormalities of the cerebral cortex reflecting errors in embryonic cortical development. MCD are associated with intellectual disability, as well as refractory epilepsy, and may require the surgical removal of the affected tissue. Inherited gene mutations involved in neuronal development explain only a fraction of MCD cases. In this project we sought to evaluate the hypothesis that somatic mutations disrupt embryonic cortical development and are responsible for a substantial fraction of MCD. Using high coverage next generation sequencing of protein-coding regions in DNA extracted from abnormal brain tissue and unaffected tissue (leukocytes) from patients with three forms of MCD, we sought to identify somatic mutations within each patient with MCD. Exome sequence data from study participants are provided to facilitate research into the genetic underpinnings of MCD.

  Study phs002128

• TNF-induced dynamic regulation of mRNA stabilome in rheumatoid arthritis fibroblast-like synoviocytes

  During rheumatoid arthritis (RA), TNF activates fibroblast-like synoviocytes (FLS) inducing in a temporal order a constellation of genes, which perpetuate synovial inflammation. Although the molecular mechanisms regulating TNF-induced transcription are well characterized, little is known about the impact of mRNA stability on gene expression and the impact of TNF on decay rates of mRNA transcripts in FLS. To address these issues we performed RNA sequencing and genome-wide analysis of the mRNA stabilome in RA FLS. We found that TNF induces a biphasic gene expression program: initially, the inducible transcriptome consists primarily of unstable transcripts but progressively switches and becomes dominated by very stable transcripts. This temporal switch is due to: a) TNF-induced prolonged stabilization of previously unstable transcripts that enables progressive transcript accumulation over days and b) sustained expression and late induction of very stable transcripts. TNF- induced mRNA stabilization in RA FLS occurs during the late phase of TNF response, is MAPK-dependent, and involves several genes with pathogenic potential such as IL6, CXCL1, CXCL3, CXCL8/IL8, CCL2, and PTGS2. These results provide the first insights into genome-wide regulation of mRNA stability in RA FLS and highlight the potential contribution of dynamic regulation of the mRNA stabilome by TNF to chronic synovitis.

  Study phs001371

• National Eye Institute (NEI) Exfoliation Genotyping Study

  The overall goal of our research is to elucidate the pathogenesis of exfoliation syndrome and the associated glaucoma, making it possible to implement effective screening and prevention strategies and to develop novel therapies. Cases genotyped for this project are from the Nurses Health Study (NHS), the Health Professionals Follow-up Study (HPFS), the Women's Genome Health Study (WGHS), the Massachusetts Eye and Ear Infirmary (MEEI), Mayo Clinic, the University of Iowa, the University of Miami and Duke University Medical Center. Exfoliation syndrome (XFS) is a common condition that is a major risk factor for high-tension open-angle glaucoma, pre-mature cataract formation, and increased risk of complications during cataract surgery. Previous studies suggest that exfoliation syndrome and the related glaucoma (XFG) are genetically complex, and one gene, LOXL1, has been identified as a major genetic risk factor. LOXL1 variants are found in up to 98% of affected patients; however, these same variants are also present in up to 80% of unaffected individuals, indicating that additional genetic and/or environmental factors are necessary for disease development. Samples genotyped for this study are a case set (1,096 samples) and 24 pedigrees (98 samples). Controls for association analyses are selected from the NEIGHBORHOOD study.

  Study phs001053

• Longitudinal Study of Urea Cycle Disorders

  Individuals with Urea Cycle Disorders (UCD) cannot remove ammonia, a waste product, from the blood. The purpose of this study is to conduct a longitudinal investigation of the natural history, morbidity, and mortality in people with UCD. This study will look at how people with a UCD grow and develop over time and how often they get sick. The research questions are: What is the prevalence of specific morbid indicators of disease severity, including hyperammonemia, developmental disabilities, and various long-term kidney and liver effects? What is the fatality rate associated with the various forms of UCD? What are the correlations between various biomarkers and disease severity and progression? What is the safety and efficacy of currently used and new UCD therapies? This is a longitudinal study of individuals with urea cycle disorders. Those participating in this study will be evaluated every three to twelve months, depending age and time of diagnosis. Participants two years of age and younger that were diagnosed with UCD within the first four weeks of life will be evaluated every three months. Those who are over two years of age or were diagnosed after four weeks of age will be evaluated every six months. Participants older than 18 years of age will be evaluated once every year.

  Study phs000577

• Identification of Targetable FGFR Gene Fusions in Diverse Cancers

  In this study, patients with advanced cancer across all histologies were enrolled in our IRB approved clinical sequencing program, called MI-ONCOSEQ, to go through an integrative sequencing which includes whole exome sequencing of the tumor and matched normal, and transcriptome sequencing. Four index cases were identified which harbor gene rearrangements of FGFR2 including two cholangiocarcinoma cases, a metastatic breast cancer case, and a metastatic prostate cancer case. After extending our assessment of FGFR rearrangements across multiple tumor cohorts, including TCGA, we identified FGFR gene fusions with intact kinase domains of FGFR1, FGFR2, or FGFR3 in cholangiocarcinoma, breast cancer, prostate cancer, lung squamous cell cancer, bladder cancer, thyroid cancer, oral cancer, glioblastoma, and head and neck squamous cell cancer. All FGFR fusion partners tested exhibit oligomerization capability, suggesting a shared mode of kinase activation. Overexpression of FGFR fusion proteins in vitro induced cell proliferation, and bladder cancer cell lines that harbors FGFR3 fusion proteins exhibited enhanced susceptibility to pharmacologic inhibition in vitro and in vivo. Due to the combinatorial possibilities of FGFR family fusion to a variety of oligomerization partners, clinical sequencing efforts which incorporate transcriptome analysis for gene fusions are poised to identify rare, targetable FGFR fusions across diverse cancer types.

  Study phs000602

• Germline hypomorphic CARD11 mutations in severe atopic disease

  We described five patients from four unrelated families who had severe atopic dermatitis and susceptibility to mild skin viral infections. Some patients also exhibited other allergic symptoms such as asthma and food allergy. We performed targeted sequencing for affected patients A-I of family A and B-I of family B, whole exome sequencing for D-I, D-II.1 and healthy mother D-II.3 of family D, and whole genome sequencing for C-I and healthy mother C-II.2 of family C. We identified three different novel damaging missense mutations of CARD11 (GeneID:84433) in patients A-I (L194P), B-I (R975W), and C-I (E57D). In patients D-I and D-II.1, a dup183_196 (p.K196_V197insMKEERDSYNDELVK) mutation was found in the coil-coil domain of the protein. These mutations act as dominant negatives impeding the scaffolding function of the wild type protein, which leads to downstream NF-kB and mTORC1 signaling defects after TCR stimulation. Sanger sequencing later identified the corresponding CARD11 mutations in the affected family members (C-II.1, D-II.2) that are not included in the dbGaP submission. Hypomorphic CARD11 dominant negative mutants are novel causes of severe atopic disease.

  Study phs001369

• NHLBI TOPMed - NHGRI CCDG: Pakistan Risk of Myocardial Infarction Study (PROMIS)

  The Pakistan Risk of Myocardial Infarction (PROMIS) study is a retrospective multicenter case-control cohort study of individuals with and without coronary heart disease from Pakistan. Multiple biological samples have been collected from the participants including DNA, plasma, serum, and whole blood. The goal of the study is to recruit 20,000 cases and 20,000 controls of Pakistani descent. Eligible cases were individuals aged 30-80 who presented to the emergency department of a participating recruitment center in Pakistan with clinical symptoms consistent with a myocardial infarction (MI), ECG changes consistent with MI, elevated troponin levels consistent with MI, and no prior history of cardiovascular disease. Controls were individuals of Pakistani descent who did not have a self-reported history of cardiovascular disease. This site hosts data generated via NHLBI's TOPMed program and NHGRI's Common Disease Genomics (CCDG) program. Both whole exome and whole genome data are presented here, namely 4,211 whole genomes from TOPMed, 3,859 whole genomes from NHLBI supplemental funds, 1,136 whole genomes and 16,855 whole exomes from CCDG. Please note that there is additional legacy whole exome data (7,298 subjects) also generated via NHGRI funds as part of the MIGen Exome Sequencing project that can be found in dbGaP at phs000917.

  Study phs001569

• Imaging: Hispanic Community Health Study/Study of Latinos (HCHS/SOL)

  The Hispanic Community Health Study/Study of Latinos (HCHS/SOL) is a multi-center epidemiologic study in Hispanic/Latino populations to determine the role of acculturation in the prevalence and development of disease, and to identify risk factors playing a protective or harmful role in Hispanics/Latinos. The study is sponsored by the National Heart, Lung, and Blood Institute (NHLBI) and six other institutes, centers, and offices of the National Institutes of Health (NIH). The goals of the HCHS/SOL include studying the prevalence and development of disease in Hispanics/Latinos, including the role of acculturation, and identifying disease risk factors that play protective or harmful roles in Hispanics/Latinos. A total of 16,415 persons of Cuban, Dominican, Mexican, Puerto Rican, Central American, and South American backgrounds were recruited through four Field Centers affiliated with San Diego State University, Northwestern University in Chicago, Albert Einstein College of Medicine in the Bronx area of New York, and the University of Miami. Seven additional academic centers serve as scientific and logistical support centers. Study participants aged 18-74 years took part in an extensive clinic exam and assessments to ascertain socio-demographic, cultural, environmental and biomedical characteristics. Annual follow-up interviews are conducted to determine a range of health outcomes.

  Study phs003963

• Comprehensive gene analysis of colorectal cancer cases

  Colorectal cancer is the third most common morbidity and the fourth leading cause of cancer death in the world.To characterize the mutation profiles of colorectal cancer with liver metastasis,we performed both whole-exosome sequencing and RNA sequencing for 12 cases of colorectal cancer with liver metastasis (group A) and 16 cases of colorectal cancer without liver metastasis (group B). As a result of driver mutation search by Mutsig pipeline, PTEN was identified as a significant mutant gene in group A alone.ADAMTS10,NELL1 and RXFP3 were identified as candidate genes for metastasis by MuTect,SID and VarScan pipeline.Furthermore, in all samples, the copy number of chromosomes 1p,4,7,8,13,15, 17p,18,20 and 22q were significantly abnormal. Chromosomes 1p,4,15,18,17p,22q were deleted and chromosomes 7, 8,13 and 20 were amplified by CNV.Pathway analysed revealed Wnt/Ca2+ and PCP pathway was involved in metastasis of cl cancer.9 kinds of fusion genes were identified in deFuse pipeline. Among them, ADAP1 fusion genes were identified in 2 samples, and ADAP1 fusion genes were further identified in 3 samples by our in-house algorithm. It is suggested that new fusion genes present in such multiple samples may be involved in the development of colorectal cancer.

  Study JGAS000128

• Development of New Diagnostics, Therapeutics, and Prevention Methods for Personalized Medicine Based on Comprehensive Cancer-Related Gene Exome Analysis and Information Analysis Using Cancer Specimens Stored in TMDU Biobank.

  Biobanked tumor samples are a valuable resource in real-world solid tumor research. Panel-based genomic profiling enables the identification of clinically significant alterations that inform personalized diagnostic and treatment decisions. This study aimed to characterize the genomic landscape of solid tumors collected through the TMDU Biobank by summarizing mutational, copy number, and gene fusion alterations in a large and diverse patient cohort. This dataset contains summary-level genomic information from 1,996 tumor samples analyzed by ACT Genomics and ACT med using the ACTOnco Comprehensive 440-Gene Cancer Panel. Data provided includes (1) gene-level mutation counts, (2) a summary of copy number alterations, and (3) a summary of detected fusion events. Clinical attributes such as ICD-10 codes, age group, sex, tumor mutational burden (TMB), and microsatellite instability (MSI) status were included at the aggregate level. Summary statistics were generated from three source tables (gene, sample, and copy number data) using standardized processing rules. Due to contractual and ethical considerations, individual-level mutation locations and raw sequence data are not included; only summary-level information is provided. This dataset will support future research in tumor-type-specific genomic patterns, molecular characterization of solid malignancies, and precision oncology.

  Study JGAS000863

• The last addition to the list of clonal evolution studies in the EGA

  Tumours of different types may arise from a single cell with at least one malignant mutation. Accumulation of subsequent hits generates lineages of cells with different cancer transformation power; thus, every clone follows an autonomous evolution, and several clones may co-exist into the same solid or liquid tumour. Clonal evolution studies are not new: the conceptual power of this approach has been recognized since the early ’80, especially in leukaemia patients. Nonetheless, these studies greatly benefit from recent technological improvements -machineries and protocols-, which enable ever-increasing sequencing depth, allowing the detection of low frequency variants and consequently more tumour clones. Note: the figure belongs to the original paper and is owned by the authors. Researchers at the University of Kyoto in Japan, have indeed used state of the art knowledge to investigate the clonal evolution of chronic myeloid leukemia (CML) in a large panel of patients. CML progresses from a majoritarian benign chronic phase into an often fatal blast crisis phase. It is nowadays known that blast crisis are triggered by genetic instability and disrupted DNA repair, which lead to accumulation of DNA mutations. The use of thyrosine kinase inhibitors targeting the Philadelphia chromosome have enormously improved the treatment of blast crisis, nonetheless resistant patients are still a medical challenge. Yotaro Ochi and collegues used Whole Exome Sequencing of paired chronic phase and blast crisis samples to depict the genetic landscape of progression from the first to the second stage of the disease (as illustrated in their figure). Their results were published in Nature Communication on this May 2021. They used a dataset previously deposited at the EGA (EGAS00001003071) and their new generated data have been made available under accession number EGAS00001005075. Their analysis of the occurring mutations contribute to understanding the mechanisms of CML evolution and therefore develop a protocol for early management of patients with a TKI resistance signature. Up to date, the EGA hosts 99 clonal evolution studies, developed in several cancer types, including myeloma, renal carcinomas and ovarian cancer, in addition to various leukaemia subtypes, where this approach has been more widely applied and produced important results and seminal papers. From a pan-cancer point of view, the definition of tumour architecture through clonal evolution studies is instrumental to unravel the mechanisms of disease progression and treatment-resistance insource. At the EGA, we are honoured to contribute to exciting and important science advances with our service!

  Blog the-last-addition-to-the-list-of-clonal-evolution-studies-in-the-ega

• Ethiopia_Genome_Project__high_coverage_

  The Ethiopian area stands among the most ancient ones ever occupied by human populations and their ancestors. Particularly, according to archaeological evidences, it is possible to trace back the presence of Hominids up to at least 3 million years ago. Furthermore, the present day human populations show a great cultural, linguistic and historic diversity which makes them essential candidate to investigate a considerable part of the African variability. Following the typing of 300 Ethiopian samples on Illumina Omni 1M (see Human Variability in Ethiopia project, previously approved by the Genotyping committee) we now have a clearer idea on which populations living in the area include the most of the diversity.This project therefore aims to sequence the whole genome of 300 individuals at low (4-8x) depth belonging to the six most representative populations of the Ethiopian area to produce a unique catalogue of variants peculiar of the North East Africa. Furthermore 6 samples (one from each population) will also be sequenced at high (30x) depth to ensure full coverage of the diversity spectrum.The retrieved variants will be of great help in evaluating the demographic dynamics of those populations as well as shedding light on the migrations out of Africa.

  Study EGAS00001000237

• Biallelic mutations in the ubiquitin ligase RFWD3 cause Fanconi anemia

  The WD40-containing E3 ubiquitin ligase RFWD3 has been recently linked to the repair of DNA damage by Homologous Recombination (HR). Here we show that an RFWD3 mutation within the WD40 domain is connected to the genetic disease Fanconi anemia (FA). An individual revealed congenital abnormalities characteristic for FA. Cells from the patient, carrying the compound heterozygous mutations c.205_206dupCC and c.1916T>A in RFWD3, show increased sensitivity to DNA interstrand cross-linking agents in terms of increased chromosomal breakage, reduced survival and cell cycle arrest in G2 phase. The cellular phenotype is mirrored in genetically engineered human and avian cells by inactivation of RFWD3 or by introduction of the patient-derived missense mutation, and is rescued by expression of wildtype RFWD3 protein. HR is disrupted in RFWD3 mutant cells, caused by impaired relocation of mutant RFWD3 to chromatin and defective physical interaction with RPA. Rfwd3 knockout mice exhibit increased embryonic lethality, are sub-fertile, show ovarian and testicular atrophy and have a reduced life span in which they resemble other FA mouse models. Although mutation was detected in a single child with FA yet, we propose RFWD3 as a novel FA gene, FANCW, supported by cellular paradigm systems and an animal model.

  Study EGAS00001002440

• APOBEC3 mutagenesis drives therapy resistance in breast cancer

  Acquired genetic alterations commonly drive resistance to endocrine and targeted therapies in metastatic breast cancer, however the underlying processes engendering these diverse alterations are largely uncharacterized. To identify the mutational processes operant in breast cancer and their impact on clinical outcomes, we utilized a well-annotated cohort of 3,880 patient samples with paired tumor-normal sequencing data. The mutational signatures associated with apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3 (APOBEC3) enzymes were highly prevalent and enriched in post-treatment compared to treatment-naïve hormone receptor-positive (HR+) cancers. APOBEC3 mutational signatures were independently associated with shorter progression-free survival on antiestrogen plus CDK4/6 inhibitor combination therapy in patients with HR+ metastatic breast cancer. Whole genome sequencing (WGS) of breast cancer models and selected paired primary-metastatic samples demonstrated that active APOBEC3 mutagenesis promoted resistance to both endocrine and targeted therapies through characteristic alterations such as RB1 loss-of-function mutations. Evidence of APOBEC3 activity in pre-treatment samples illustrated a pervasive role for this mutational process in breast cancer evolution. The study reveals APOBEC3 mutagenesis to be a frequent mediator of therapy resistance in breast cancer and highlights its potential as a biomarker and target for overcoming resistance.

  Study EGAS50000000875

• Reconstructing oral cavity tumor evolution through brush biopsy

  Oral potentially malignant disorders (OPMDs) with genomic alterations have a heightened risk of evolving into oral squamous cell carcinoma (OSCC). Currently, genomic data are typically obtained through invasive tissue biopsy. However, brush biopsy is a non-invasive method that has been utilized for identifying dysplastic cells in OPMD but its effectiveness in reflecting the genomic landscape of OPMDs remains uncertain. This pilot study investigates the potential of brush biopsy samples in accurately reconstructing the genomic profile and tumor evolution in a patient with both OPMD and OSCC. We analyzed single nucleotide variants (SNVs), copy number aberrations (CNAs), and subclonal architectures in paired tissue and brush biopsy samples. The results showed that brush biopsy effectively captured 90% of SNVs and had similar CNA profiles as those seen in its paired tissue biopsies in all lesions. It was specific, as normal buccal mucosa did not share these genomic alterations. Interestingly, brush biopsy revealed shared SNVs and CNAs between the distinct OPMD and OSCC lesions from the same patient, indicating a common ancestral origin. Subclonal reconstruction confirmed this shared ancestry, followed by divergent evolution of the lesions. These findings highlight the potential of brush biopsies in accurately representing the genomic profile of OPL and OSCC, proving insight into reconstructing tumor evolution.

  Study EGAS50000000602

• Mutational Patterns in Metastatic Cutaneous Squamous Cell Carcinoma

  Cutaneous squamous cell carcinoma (cSCC) from the head and neck typically metastasizes to the lymph nodes of the neck and parotid glands. When a primary is not identified, they are difficult to distinguish from metastases of mucosal origin and primary salivary gland SCC. Ultraviolet radiation causes a mutation pattern that predominantly features cytosine to thymine transitions at dipyrimidine sites and has been associated with cSCC. In this study, we used whole genome sequencing data from 15 cSCC metastases and show that a UV signature mutation is pervasive across the cohort and distinct from mucosal SCC. The mutational burden was exceptionally high and concentrated in some regions of the genome, especially insulator elements (mean 162 mutations / Mb). We therefore evaluated the likely impact of UV-induced mutations on the dipyrimidine rich binding site of the main human insulator protein, CCCTC-binding factor (CTCF), and the possible implications on CTCF function and the spatial organization of the genome. Our findings suggest that mutation signature analysis may be useful in determining the origin of metastases in the neck and the parotid gland. Furthermore, UV-induced DNA damage to insulator binding sites may play a role in the carcinogenesis and progression of cSCC.

  Study EGAS00001003370

• Ethiopia_Genome_Project__low_coverage_

  The Ethiopian area stands among the most ancient ones ever occupied by human populations and their ancestors. Particularly, according to archaeological evidences, it is possible to trace back the presence of Hominids up to at least 3 million years ago. Furthermore, the present day human populations show a great cultural, linguistic and historic diversity which makes them essential candidate to investigate a considerable part of the African variability. Following the typing of 300 Ethiopian samples on Illumina Omni 1M (see Human Variability in Ethiopia project, previously approved by the Genotyping committee) we now have a clearer idea on which populations living in the area include the most of the diversity.This project therefore aims to sequence the whole genome of 300 individuals at low (4-8x) depth belonging to the six most representative populations of the Ethiopian area to produce a unique catalogue of variants peculiar of the North East Africa. Furthermore 6 samples (one from each population) will also be sequenced at high (30x) depth to ensure full coverage of the diversity spectrum.The retrieved variants will be of great help in evaluating the demographic dynamics of those populations as well as shedding light on the migrations out of Africa.

  Study EGAS00001000238

• The_Genomic_Advances_in_Sepsis__GAinS__RNA_seq

  Sepsis is defined as life-threatening organ dysfunction caused by a dysregulated host response to infection. This cohort comprises a subset of patients enrolled in the Genomic Advances in Sepsis (GAinS) study, an established biobank of adult sepsis patients. Patients with sepsis due to community acquired pneumonia or faecal peritonitis were recruited from 34 hospitals across the UK from 2005-2018, with samples for functional genomics and detailed clinical information collected on the first, third and/or fifth day following ICU admission. RNA was extracted from leukocytes isolated at the bedside using LeukoLOCK kits. We have previously identified sepsis response signatures (SRSs), transcriptomic endotypes that are associated with differential early mortality (Davenport et al, Lancet Respir Med, 2016; Burnham et al, AJRCCM, 2017) and response to treatment in a clinical trial (Antcliffe et al, AJRCCM, 2018). We generated RNA sequencing data on 903 samples, including 134 samples repeated from our previously released microarray data. Libraries were prepared using NEB Ultra II Library Prep kits (Illumina) and sequenced on a NovaSeq 6000. Reads were aligned to the reference genome (GRCh38) using STAR and gene counts quantified using featureCounts (annotation Ensembl v99). Counts were TMM-normalised and log-transformed. Following QC, processed data were available on 864 samples from 667 unique patients.

  Study EGAS00001003772

• This project aims to study human memory capacity, including short-term memory and long-term memory, systematically via genome-wide association studies

  Development of high-throughput genotyping platforms provides an opportunity to identify new genetic elements related to complex cognitive functions. Taking advantage of multi-level genomic analysis, here we studied the genetic basis of human short-term (STM, n=1,620) and long-term (LTM, n=1,526) memory functions. Heritability estimation based on single nucleotide polymorphism showed moderate heritability of short-term memory but very low heritability of long-term memory. In a two-step genome-wide association study, the markers rs13151012 and rs1558360 passed genome-wide significance (p < 5×10-8) in digit-span STM task and for the first principal component shared by two STM tasks; however, none of them survived the replication. In turn, we selected the ten most significant single nucleotide polymorphisms (SNPs) for replication tests. Among them, a SNP near ZFAT was significantly associated with STM performance in another independent population of 2,789; a polymorphism within BCAT2 was significantly associated with LTM in another independent population of 1,865. Furthermore, we performed a pathway analysis based on the current genomic data and found six pathways significantly associated with STM capacity and one pathway associated with LTM capacity.

  Study EGAS00001002875

• Adult-type Granulosa Cell Tumour of the Ovary

  A recurrent mutation in FOXL2 (c.402C>G; p.C134W) is present in over 95% of adult-type granulosa cell tumours (AGCTs). In contrast, various loss-of-function mutations in FOXL2 lead to the development of blepharophimosis, ptosis and epicanthus inversus syndrome (BPES). BPES is characterized by an eyelid malformation often accompanied with primary ovarian insufficiency but not granulosa cell tumours. Two recent studies suggest that FOXL2 C402G is a gain or change-of-function mutation with altered DNA-binding specificity. Another study proposes that FOXL2 C402G is selectively targeted for degradation inducing somatic haploinsufficiency suggesting its role as a tumour suppressor. The latter study relies on data indicative of an FOXL2 allelic imbalance in AGCTs. Here we present RNA-seq data as genetic evidence that no real allelic imbalance is observed at the transcriptomic level in AGCTs. Additionally, there is no loss of protein expression in tumours harboring the mutated allele. These data and other features of this mutation as compared to other oncogenes and tumour suppressor genes argue strongly against FOXL2 being a tumour suppressor in this context. Given the likelihood that FOXL2 C402G is oncogenic, targeting the variant protein or its downstream consequences is the most viable path forward to identifying an effective treatment for this cancer.

  Study EGAS00001005414