17084 results for "free coins in fc 26 Visit Buyfc26coins.com for latest FC 26 coins news..xwWa"

in 36.77 milliseconds.

• Single-cell RNA sequencing on 12346 single T cells from 14 non-small cell lung cancer (NSCLC) patients

  Deep single-cell RNA sequencing data for 12346 T cells from tumour, adjacent normal tissue and peripheral blood of treatment-naïve NSCLC patients

  Dataset EGAD00001003999

• Low-coverage Whole Genome Sequencing, normal adjacent colon NKI-AvL TGO series NGS-ProToCol

  The dataset "Low-coverage Whole Genome Sequencing, normal adjacent colon NKI-AvL TGO series NGS-ProToCol" includes 18 fastq files from single-end low-coverage WGS on Illumina HiSeq2500 for 18 snap-frozen normal adjacent colon tissues.

  Dataset EGAD00001004094

• Tam-seq of germline samples for HGSOC copy-number signatures study

  This dataset contains targeted amplicon sequencing of Germline DNA extracted from 56 blood samples. They were sequenced on Illumina HiSeq 2500 and aligned to human genome assembly GRCh37 (hg19)to produce 127 bam files (2-3 technical replicates per sample).

  Dataset EGAD00001004172

• Genetic and epigenetic characterization of adenoid cystic carcinoma

  Whole genome sequences of ACC primagrafts, Histone modification maps and transcription factor binding maps for ACC primagrafts and primary tumors. Processed ChIP-seq data is available on GEO under accession number GSE76465.

  Dataset EGAD00001001662

• SF4400 snRNA-Seq Primary GBM

  Single Nuclei RNA-Seq Primary High-grade Glioma. Gender Female Age 51. Single Nuclei RNA seq from high grade primary glioma sample. NovaSeq6000 was used for RNA seq. The files uploaded are bam files created with grch38 reference

  Dataset EGAD00001005399

• SF9259R snRNA-Seq Primary GBM

  Single Nuclei RNA-Seq Primary High-grade Glioma. Gender Male Age 73. Single Nuclei RNA seq from high grade primary glioma sample. NovaSeq6000 was used for RNA seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005401

• SF6996 snRNA-Seq Primary GBM

  Single Nuclei RNA-Seq Primary High-grade Glioma. Gender Female age 40. Single Nuclei RNA seq from high grade primary glioma sample. NovaSeq6000 was used for RNA seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005402

• SF11979 snRNA-Seq Primary GBM IDHR132H Wildtype Female

  Single Nuclei Primary GBM IDHR132H Wildtype. Female 76. Single Nuclei RNA seq from high grade primary glioma sample. NovaSeq6000 was used for RNA seq. The files uploaded are bam files created with grch38 reference.

  Dataset EGAD00001005430

• Sequencing files for "The Evolutionary Origins of Recurrent Pancreatic Cancer."

  Files from DNA sequencing from primary tumors and metastases from pancreatic cancer patients along with matched normal tissues. Sequencing files include those derived from whole exome sequencing as well as MSK-IMPACT sequencing.

  Dataset EGAD00001005779

• Exome sequencing of DLBCL samples with PMBL GE signature

  Tumor exomes for 15 DLBCL samples with PMBL GE signature, with 6 matching normal exomes and 1 pooled normal exome.

  Dataset EGAD00001007006

• RNA-seq dataset of Ewing and Ewing-like-sarcoma tumoroid biobank reveals distinct drug sensitivities: translocation makes the difference

  Creation of living organoid biobank for ewing and ewing-like sarcomas

  Dataset EGAD00001015419

• TXT_Cytof_15B

  Matrix of normal values from 39 marker CyTOF assay performed on longitudinal BMMC. FCS files from the CyTOF assay were normalized and concatenated using Fluidigm's CyTOF software and then de-multiplexed using Astrolabe Diagnostics, Inc., a commercial, cloud-based platform for single-cell analysis.

  Dataset EGAD00001011143

• DO NOT USE - Whole genome sequencing of SI-NETs from five patients

  Small intestine neuroendocrine tumor (SI-NET), the most common cancer of the small bowel, often displays a curious multifocal phenotype with several intestinal tumors centered around a regional lymph node metastasis, yet the typical path of evolution of these lesions remains unclear. Here, we determined the complete genome sequences of 37 tumors from 5 patients with multifocal SI-NET, allowing elucidation of phylogenetic relationships between multiple intestinal tumors and metastases in individual patients.

  Study EGAS00001004435

• HELIUS DAC The HELIUS data are owned by the Amsterdam University Medical Centers, location AMC in Amsterdam, The Netherlands. To allow sharing of microbiome data collected in HELIUS with (inter)national researchers, 16s rRNA sequence analysis has been stored at the European genome-phenome archive (EGA; accession code EGAD00001004106). This requires that access needs to be granted, also because the HELIUS data are stored with relevant phenotypical variables. Access is granted to all researchers affiliated with an internationally recognized research institution who request to use the HELIUS data within the EGA context, after having signed the data transfer agreement. Any researcher can request the data by submitting a proposal to the HELIUS Executive Board as outlined at http://www.heliusstudy.nl/en/researchers/collaboration, by email: heliuscoordinator at amsterdamumc dot nl. The HELIUS Executive Board will check proposals if they do not conflict with ethical approvals and informed consent forms of the HELIUS study.

  Dac EGAC00001000895

• GSA QCed data

  QC-ed data of 9,534 DDD Study participants, including 8,879 individuals with inferred GBR ancestry. Details of genotype QC can be found in https://www.medrxiv.org/content/10.1101/2023.04.20.23288860v1.full.pdf. Genome builds are indicated in the file name. Related individuals have not been removed. Of the 9,534 samples there are 3,148 mothers, 3,138 fathers and 3,248 probands, which form 3,099 trios. Of the 8,879 GBR samples, there are 2,931 mothers, 2,937 father and 3,011 probands, which form 2,788 trios. Most of the probands have been previously genoyped on the llumina HumanCoreExome BeadChip (EGAD00010001598) or the Illumina InfiniumCoreExome Beadchip (EGAD00010001600). All samples were genotyped on the Illumina Global Screening Array.

  Dataset EGAD00010002568

• The Genomic Landscape of Tuberous Sclerosis Complex (TSC)

  In this study, we characterized the genomic landscape of tuberous sclerosis complex (TSC), a rare genetic disease causing multisystem growth of benign tumors and other hamartomatous lesions. We analyzed 127 human tissues, including 111 TSC-associated samples and 16 non-TSC negative controls, using multiple genomic platforms including whole exome sequencing, targeted sequencing of known disease-causative loci (TSC1 and TSC2), mRNA sequencing, high-density SNP arrays, and DNA methylation arrays.

  Study phs001357

• Mutational Landscape of MCPyV-Positive and MCPyV-Negative Merkel Cell Carcinomas

  Merkel cell carcinoma (MCC) is an aggressive neuroendocrine carcinoma of the skin most commonly found on the sun-exposed skin of older Caucasian adults. Roughly one-third of patients with MCCs die of the disease; therefore, MCC is the most lethal skin cancer on a case-by-case basis. 49 cases were studied, and putative cancer driver gene mutations and tumor antigens in both MCPyV-negative and MCPyV-positive MCCs were identified.

  Study phs002515

• OICR: Molecular Pathological Epidemiology of Colorectal Cancer

  Colorectal cancer, the second most commonly diagnosed cancer, is a biologically heterogeneous disease. To characterize the molecular attributes of colorectal tumors, we conducted targeted sequencing at the Ontario Cancer Research Institution (OICR) of tumor and matched normal DNA samples from 2,542 colorectal cancer cases in the Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO) [phs001078] and the Colon Cancer Family Registry (CCFR). These consortia are based on cohort and population-based case-control studies.

  Study phs002050

• Autosomal Recessive PGM3 Mutations Link Glycosylation Defects to Atopy, Immune Deficiency, Autoimmunity, and Neurocognitive Impairment

  To define a genetic syndrome of severe atopy, elevated serum IgE, immune deficiency, autoimmunity, and motor and neurocognitive impairment, eight patients from two families who had similar syndromic features were studied. Whole exome sequencing was performed to identify disease-causing mutations. A disease segregated with a novel autosomal recessive mutations in a single gene, phosphoglucomutase 3 (PGM3). The result defines a new Congenital Disorder of Glycosylation.

  Study phs000809

• Single Cell Analysis Reveals Immune Dysfunction from the Earliest Stages of CLL that can be Reversed by Ibrutinib

  We applied single cell RNA sequencing to broadly characterize circulating immune cells co-existing with leukemic cells during natural chronic lymphocytic leukemia (CLL) progression. We used peripheral blood mononuclear cells from patients diagnosed from monoclonal B-lymphocytosis (MBL) and CLL at different time-points, and age-matched healthy donors (HDs). We analyzed the differences in cell type proportions and immune cell states between MBL/CLL patients and HDs and over time.

  Study phs002705

• Very Low Tumor Mutation Burden Identifies Inflamed Recurrent Glioblastomas Responsive to Cancer Immunotherapy

  A subset of available tumors (with matched blood) from patients enrolled in a phase I clinical trial testing a recombinant poliovirus, published by Desjardins et al. NEJM 2018 (PMID:29943666), were analyzed by whole exome sequencing and RNA-seq. It was discovered that low tumor mutation burden correlated with survival outcome, and also discovered that low tumor mutation burden correlated with higher inflammatory gene signatures by RNA-seq.

  Study phs002270

• Breast Cancer Family Registry Early-onset Breast Cancer GWAS

  In order to enhance our understanding of the genetic etiology of breast cancer, this study analyzed 1,265,548 Hapmap3 single-nucleotide polymorphisms (SNP) among a discovery set of 3,523 EOBC incident cases and 2,702 age-matched population control women, all of whom were age 50 or younger at enrollment. Subjects were recruited from the eight sites, some of which oversampled cases with a personal or family history of breast cancer.

  Study phs001589

• Integrated Genomic and Transcriptomic Analysis of Small Cell Lung Cancer Reveals Inter- and Intratumoral Heterogeneity and a Novel Chemotherapy-Refractory Subtype

  We integrated histology, transcriptome, exome, and treatment outcomes of small cell neuroendocrine cancer (SCNC) from a range of metastatic sites, revealing complex intra- and intertumoral heterogeneity of neuroendocrine (NE) differentiation and transcriptomic subtypes (ASCL1, NEUROD1, POU2F3, YAP1 and ATOH1). High NE SCNCs were more likely to benefit from replication stress-targeted therapies, in contrast to non-NE tumors which were more likely to respond to immune response-targeted therapies.

  Study phs002541

• A Multimodal Atlas of Human Brain Cell Types 2021 Data

  Human neocortical neurons display diverse morphology, physiology and gene expression profiles. We use a method called Patch-seq, where these three data modalities are assayed simultaneously from the same neuron, to understand how the genetic profile of human neocortical neuron types corresponds to their morphological and electrophysiological phenotypes. This dataset consists of transcriptome samples collected during Patch-seq recordings from layer 5 pyramidal neurons in the human middle temporal gyrus.

  Study phs002697

• DIGEST: Dietary Influences on Glucuronidation, a Cross-Sectional Study of Diet and Metabolism

  Plasma samples derived from a study population of control participants (DIGEST: Dietary Influences on Glucuronidation, a Cross-Sectional Study of Diet and Metabolism) were used to profile miRNA circulating in plasma. RNA was isolated from plasma samples using the Qiagen miRNeasy kit. Libraries were prepared using Illumina TruSeq Small RNA Library Prep Kit. Libraries were sequenced on a HiSeq. Data from this sequencing project will be available through dbGaP.

  Study phs003223

• Epigenetic Damage in Women Living in LA Food-Desert Zip Codes

  This study investigated the impact of insulin resistance on chromatin acetylation and inflammation. Blood samples were obtained from women consented to City of Hope Institutional Review Board (IRB)-approved COH Protocol#/Ref#:18306/158149. Women provided demographic information and completed a survey assessing diet, housing and medical history. BMI was obtained from medical records. HgbA1c was measured and cytokine arrays were used to measure serum TNFalpha, IL6, IL15, IL16, IL23, Leptin, and CXCL1.

  Study phs003522

• Circulating tumour DNA (ctDNA) data of High Grade Serous Ovarian Cancer Patients

  This study contains circulating tumour DNA (ctDNA) data derived from longitudinal plasma samples of High Grade Serous Ovarian Cancer (HGSC) patients belonging to the DECIDER study (NCT04846933). Ovarian cancer kills more than 40 000 women in Europe each year, and HGSC is the most common and most difficult to treat subtype of this disease. This study contains different sequencing datasets with samples from different stages during the treatment of the patients.

  Study EGAS50000000674

• Single-cell transcriptomic analyses of peripheral blood mononuclear cells, peritoneal fluid, and peritoneal metastases from patients with colorectal cancer

  The data published here contains single-cell RNA- sequencing (scRNAseq) on peripheral blood mononuclear cells (PBMC), peritoneal fluid (PF), and peritoneal metastases (PM). PBMC, PF and, where possible, PM was acquired from patients with colorectal cancer (CRC) and subjected to 3' scRNAseq using the 10X Genomics (Chromium Single Cell 3’ Reagent). Sequencing was performed in a paired-ended fashion on either the HiSeq4000 or the NovaSeq6000.

  Study EGAS50000000173

• Single-cell RNA-sequencing and cellular indexing of transcriptomes and epitopes of peripheral blood mononuclear cells and peritoneal fluid from patients with achalasia

  The data published here contains cellular indexing of transcriptomes and epitopes (CITE-seq) and single-cell RNA- sequencing (scRNAseq) data on patients with achalasia. Paired PBMC and PF were subjected to 3' scRNAseq and CITE-seq, respectively. All single-cell data was generated using the 10X Genomics (Chromium Single Cell 3’ Reagent) and sequenced in a paired-ended fashion on the NovaSeq6000.

  Study EGAS50000000174

• Whole genome sequencing of PDAC tissues an PDOs

  whole genome sequencing (WGS) on 48 PDOs (established from 39 tumors) and 4 tissues samples. The majority of PDOs were established from treatment-naive and localized tumors. Histopathologically, the majority of PDAC tumors from which PDOs were established displayed a conventional morphological pattern, with two containing squamous components (defined as adenosquamous), and one classified as a signet-ring tumour. 7 of the PDOs were grown in a culture medium lacking both WNT3A and RSPO1.

  Study EGAS50000000193

• Genomic Profiling of an anti-PD-L1 treated cohort of Newly Diagnosed GBM patients

  Checkpoint inhibitor therapy has limited efficacy in the outcomes of patients with glioblastoma (GBM). This study involves whole exome sequencing of newly diagnosed glioblastoma patients treated with concurrent atezolizumab, radiation therapy, and temozolomide. By analyzing 29 tumor-normal pairs, the study aims to explore the correlation between tumor genomics and the efficacy of PD-L1 blockade treatment outcomes and further identify which patients may benefit more from such therapy.

  Study EGAS50000000783

• ResolveCRPS study - RNA-fragment sequencing from snap-frozen skin biopsies

  Complex Regional Pain Syndrome (CRPS) is a disabling pain disorder with unclear cutaneous molecular mechanisms. To identify gene-expression signatures linked to pain intensity and disease progression, we profiled the local transcriptome of CRPS-affected skin. 42 patients agreed to skin biopsies from the CRPS-affected area, which underwent low-input total RNA-seq. Full experimental and bioinformatics protocols are provided in the associated publication and its supplementary material.

  Study EGAS50000001061

• Genetics and Pathobiology of Disorders of Keratinization

  The goal of this study was to identify potential drivers of disorders of keratinization in human. Individuals diagnosed with disorders of keratinization were recruited with no exclusion criteria. Saliva or blood samples were taken from consented patients or family members and DNA harvested immediately. Whole exome sequencing was performed (150-bp paired end reads) to 80X coverage via an Illumina NovaSeq 6000 sequencer. Identification of germline mutations was performed using GATK.

  Study phs004172

• scRNAseq of acute myeloid leukemia

  This study analyzes T-cell transcriptional state in acute myeloid leukemia (AML) and healthy donors. The goal of the study is to correlate T-cell transcriptional states abundances with response to chemotherapy. 12 samples (5 baseline and post-treatment, 2 baseline-only) from AML patients and 3 samples from healthy donors were collected and sequenced on Illumina platforms. The files were created using the GRCh38 reference through CellRanger count (10xGenomics).

  Study EGAS50000000357

• Whole genome sequencing data of pediatric TCF3::PBX1 acute lymphoblastic leukemia

  TCF3::PBX1 leukemia is a rare subtype of B-cell acute lymphoblastic leukemia (B-ALL), occurring in approximately 3–5% of pediatric cases. It results from a chromosomal translocation t(1;19)(q23;p13), generating the TCF3::PBX1 fusion gene, which disrupts normal transcriptional regulation and contributes to leukemogenesis. Although historically associated with poor prognosis, contemporary risk stratification and intensified therapy have significantly improved outcomes, and both 5-years DFS and OS are nowadays ≥ 0.96.

  Study EGAS50000001257

• Single nuclei RNA sequencing on Primary and Maladaptive FSGS patient samples

  We used single-nucleus RNA-sequencing to identify differentially expressed transcriptional signatures in kidney biopsies of well-phenotyped primary vs. maladaptive FSGS patients. We included cryopreserved kidney biopsy cores from adult patients with newly diagnosed primary FSGS (n = 9, all nephrotic), maladaptive FSGS (n = 9, not nephrotic), proteinuric controls (PLA2R-positive membranous nephropathy, n = 3), and healthy controls (n = 4). We identified 120,751 high-quality nuclei, including 2,471 podocytes and 1,574 parietal epithelial cells (PECs).

  Study EGAS50000001070

• Discovery of genetic factors associated with thiopurine-induced severe adverse events

  Despite NUDT15 variants showing significant association with thiopurine-induced adverse events (AEs) in Asians, it remains unclear whether additional genetic variants should be tested to predict AEs. To clarify it, we performed a genome-wide association study to discover additional variants associated with thiopurine-induced severe AEs, alopecia and leukopenia. GWASs of these AEs were performed with 1221 Japanese patients with inflammatory bowel disease using population-optimized genotyping array and imputation.

  Study JGAS000661

• Broad utility of ultrasensitive analysis of ctDNA dynamics across solid tumors treated with immunotherapy

  Plasma ctDNA sequencing data from samples collected from a pan-cancer cohort of patients with advanced-stage disease treated with IO therapies. This study highlights the broader applicability of ultrasensitive ctDNA as a biomarker across cancer types and immunotherapy modalities. Here, we applied a whole-genome, tumor-informed approach to study ctDNA in 202 advanced-stage cancer patients treated at VHIO. This study captures the plasma sequencing data from the project.

  Study EGAS50000001271

• ecDNA copy number heterogeneity

  Neuroblastoma exhibits significant inter- and intra-tumour genetic heterogeneity and varying clinical outcomes. Here, we used DNA and RNA sequencing from the same single cells in cell lines and neuroblastoma patients to investigate these effects. We reveal extensive intercellular ecDNA copy number heterogeneity. We also provide direct evidence of how this heterogeneity influences the expression of cargo genes, including MYCN and its downstream targets, and the overall transcriptional state of neuroblastoma cells.

  Study EGAS50000000509

• RNA sequencing of untreated head and neck cancer patient-derived xenografts (PDXs) and matched patient tumor tissue.

  RNA sequencing was performed on untreated patient tumor tissue and matched patient-derived xenograft (PDX) models of primary head and neck squamous cell carcinoma (HNSCC). The aim of this analysis was to characterize the transcriptional landscape of the tumors in the in vivo setting. 117 total samples were sequenced with paired reads on 10 lanes from different flowcells. They were loaded as 2400 separate files to maintain the data as it was received from BGI - each sample is therefore composed of 5 separate EGAN with 4 files each, adding a 0.1 - .. - 0.5 to each BioSample ID to generate sample aliases. All R1 (and R2, separately) files referring to a BioSample ID should be concatenated to obtain fastq files corresponding to single patients or PDXs.

  Dataset EGAD50000002278

• Whole-exome sequencing (WES) analysis of untreated head and neck cancer patient-derived xenografts (PDXs) matched patient tumor tissue and normal mucosa tissue.

  WES analysis was performed on untreated patient tumor/normal mucosa tissue and matched patient-derived xenograft (PDX) models of primary head and neck squamous cell carcinoma (HNSCC) to investigate the preservation of tumor-specific genomic alterations in the in vivo context. 183 total samples were sequenced with paired reads on 8-10 lanes from different flowcells. They were loaded as 3538 separate files to maintain the data as it was received from BGI - each sample is therefore composed of 5 separate EGAN with 2-4 files each, adding a 0.1 - .. - 0.5 to each BioSample ID to generate sample aliases. All R1 (and R2, separately) files referring to a BioSample ID should be concatenated to obtain fastq files corresponding to single patients or PDXs.

  Dataset EGAD50000002325

• Whole exome sequencing of Zimbabwean patients with suspected Mendelian disorders

  This study presents whole exome sequencing data from Zimbabwean individuals with suspected Mendelian disorders, including sickle cell disease, Fanconi anemia, haemophilia, and muscular dystrophy. The dataset includes both affected individuals and family members to support inheritance-based analyses. Variant calling was performed using the Illumina DRAGEN pipeline, with downstream variant prioritisation and interpretation conducted using the Zi-Mendelian bioinformatics pipeline. This study supports rare disease genomics and precision medicine efforts in African populations.

  Study EGAS50000001708

• IgCaller

  IgCaller is a python program designed to fully characterize the immunoglobulin (IG) gene rearrangements and oncogenic translocations in lymphoid neoplasms from whole-genome sequencing (WGS) data. Using a cohort of 331 patients comprising different subtypes of B-cell neoplasms, we demonstrate that IgCaller identifies both heavy and light chain rearrangements providing additional information on their functionality, somatic mutational status, class switch recombination, and oncogenic IG translocations. We provided here IG reads of the previously unpublished WGS.

  Study EGAS00001004298

• Exome_sequence_of_probands_in_Barrett_s_oesophagus_families

  Barrett?s oesophagus is common in the UK affecting 2 % of the population. Family history has beenrecorded among the 4000 Barrett's cases collected so far and have 241 families. Among them wehave assessed 6 multiplex families with proven Barrett?s and defined as having 1 pro band and atleast 3 affected first degree members. We propose to exome sequence the probands of these sixfamilies to assess the presence of pathogenic rare coding variants.

  Study EGAS00001000531

• High Altitude Pulmonary Hypertension

  The Central Asian Kyrgyz highland population provides a unique opportunity to address genetic diversity and understand the genetic mechanisms underlying hypoxia-induced high altitude pulmonary hypertension (HAPH). While a significant fraction of the population is unaffected, there are susceptible individuals who display HAPH in the absence of any lung, cardiac or hematologic disease. We report herein the analysis of the whole genome sequencing of healthy individuals compared with HAPH patients and other controls.

  Study EGAS00001003171

• Whole_Genome_Sequencing_of_JK_Family

  In collaboration with Dr David Savage, we have identified a patient with a very unusualphenotype, lacking almost all visceral fat, but showing a massive accumulation of white fattissue behind her neck and significantly elevated liver fat.Whole exome sequencing of the proband and her unaffected parents and brother has beenrun previously, however no causative variant has been found and the sequencing coveragewas generally poor. We propose to conduct whole genome sequencing of all 4 familymembers at a depth of 30X.

  Study EGAS00001001323

• UROMOL 2020 - RNA-seq data

  The molecular landscape in non-muscle-invasive bladder cancer (NMIBC) is characterized by large biological heterogeneity with variable clinical outcomes. Here, we performed a large integrative multi-omics analysis of patients diagnosed with NMIBC (n=834). Transcriptomic analysis identifies four classes (1, 2a, 2b and 3) reflecting tumor biology and disease aggressiveness. Both transcriptome-based subtyping and the level of chromosomal instability provide independent prognostic value beyond established prognostic clinicopathological parameters.

  Study EGAS00001004693

• Whole-genome sequencing analysis of low-grade astrocytomas within the ICGC PedBrain Tumor Project

  In order to investigate the full range of genetic alterations contributing to the tumourigenesis of low-grade astrocytoma, we have conducted a next-generation sequencing-based analysis on a large series of matched tumor-normal pairs. This study, conducted by the International Cancer Genome Consortium PedBrain Tumor Project (ICGC PedBrain, http://www.pedbraintumor.org/), has revealed multiple new insights into the biological basis of this tumor entity.

  Study EGAS00001000381

• Whole_genome_sequencing_of_a_Grem1_mutant_human_tumour

  The BMP antagonist Grem1 has been shown to be associated with a rare human polyposissyndrome (HMPS). We have shown that there is a 40KB duplication on chrom 15 found insome patients with HMPS. Traditional serrated adenomas (rare sporadic polyps) share somemorphological features with HMPS polyps and it has long been hypothesised that they are thesporadic version of HMPS polyps. We have obtained of one of theselesions and in this project we aim to characterise this tumour.

  Study EGAS00001000562

• WGS and WES of pediatric osteosarcoma

  Despite being the most common childhood bone tumor, the genomic characterization of osteosarcoma remains incomplete. Very few metastatic cases have been sequenced to date, a required step to better understand the progression and evolution of this tumor. Here, we present an integrative analysis of whole genome and whole exome sequencing (WGS and WES) of a cohort of primary and metastatic pediatric osteosarcoma, in order to identify recurrent genomic alterations between and within patients.

  Study EGAS00001003342

• APCDR AGV Project: Whole genome sequencing of 3 African populations (curated data)

  The African Genome Variation Project (AGVP) provides a resource to help design, implement and interpret genomic studies in sub-Saharan Africa (SSA) and worldwide. The AGVP represents dense genotypes from 1,481 and whole genome sequences (WGS) from 320 individuals across SSA. As part of the AGVP we sequenced 3 African populations; Baganda from Uganda (4x), Zulu from South Africa (4x), Gumuz, Wolayta, Oromo, Somali and Amhara from Ethiopia (8x).

  Study EGAS00001000960

• SOFT_study___sequencing_premenopausal_breast_cancer

  Our project will examine the role of PIK3CA mutations and their sensitivity to endocrine therapies and its role, with the addition of complete ovarian suppression. We plan to test our hypotheses using tumour samples collected from patients enrolled in the SOFT/IBCSG24-02 clinical study (Suppression of Ovarian Function Trial – (NCT00066690). SOFT is a phase III trial that randomised 3066 premenopausal women to evaluate if adding ovarian suppression to adjuvant endocrine therapy will improve clinical outcomes.

  Study EGAS00001000983

• CML_blast_phase_rearrangement_screen

  Genomic libraries (500 bps) will be generated from total genomic DNA derived from 10 Chronic Myeloid Leukemia in blast phase samples and subjected to a total of two lanes of 50 bp, paired end sequencing on the llumina HiSeq. Paired reads will be mapped to build 37 of the human reference genome to facilitate the generation of genome wide copy number information, and the identification of novel rearranged cancer genes and gene fusions

  Study EGAS00001000191

• Whole genome sequencing of patients affected by acute intermittent porphyria

  Acute intermittent porphyria (AIP) is an hereditary rare metabolic disorder of incomplete penetrance, affecting the biosynthesis of heme. IAP is an autosomal dominant disorder, resulting in a substantial reduction of the activity of the hydroxymethylbilane synthase coding gene (HMBS). Most HMBS mutation carriers are asymptomatic and only between 10% and 20% of patients present acute attacks of the associated symptoms. Here, we sequenced whole genomes of 16 AIP patients.

  Study EGAS00001004999

• Multi-omics profiling of paired primary and recurrent glioblastoma patient tissues

  Despite maximal therapy with surgery, chemotherapy and radiotherapy, glioblastoma multiforme (GBM) patients have a median survival of only 15 months. Almost all patients inevitably experience symptomatic tumor recurrence. A hallmark of this tumor type is the large heterogeneity between patients and within tumors itself which relate to failure of standardized tumor treatment. In this study, tissue samples of paired primary and recurrent GBM tumors were investigated to identify individual factors related to tumor progression.

  Study EGAS00001004345

• Genes___Health_imputed_genotype_dataset

  Genes & Health is a cohort of British Bangladeshi and British Pakistani individuals. In the Feb2020 data freeze, 28,022 individuals were genotyped on the Illumina Infinium Global Screening Array v3 chip (with the additional Multi-Disease variants). Imputation was performed using the Michigan Imputation Server with the GenomeAsia pilot reference panel, which contains 1,739 genomes and 642 from them are from South Asian groups. This dataset contains imputed SNPs with imputation accuracy >0.3 and MAF >0.1%.

  Study EGAS00001005373

• Single-cell RNA sequencing of 6 follicular lymphoma tumors

  Follicular lymphoma (FL) is an indolent cancer of mature B-cells but carries increased risk of transformation to a more aggressive histology over time. We present here comprehensive profiling both tumor and immune compartments in 6 diagnostic FL biopsies by single-cell RNA sequencing. This confirmed results from 155 FL tumors characterized by mass cytometry (CyTOF) which revealed two distinct evolutionary trajectories with disparate risk of transformation and alternate biologies.

  Study EGAS00001005257

• UROMOL 2020 - SNP data

  The molecular landscape in non-muscle-invasive bladder cancer (NMIBC) is characterized by large biological heterogeneity with variable clinical outcomes. Here, we performed a large integrative multi-omics analysis of patients diagnosed with NMIBC (n=834). Transcriptomic analysis identifies four classes (1, 2a, 2b and 3) reflecting tumor biology and disease aggressiveness. Both transcriptome-based subtyping and the level of chromosomal instability provide independent prognostic value beyond established prognostic clinicopathological parameters.

  Study EGAS00001004862

• EXCEED Study

  EXCEED is a longitudinal population-based cohort which facilitates investigation of genetic, environmental and lifestyle-related determinants of a broad range of diseases and of multiple morbidity through data collected at baseline and via electronic healthcare record linkage. Recruitment has taken place in Leicester, Leicestershire and Rutland since 2013 and is ongoing, with approximately 10,000 participants aged 30-69 to date. The population of Leicester is diverse and additional recruitment from the local South Asian community is ongoing.

  Study EGAS00001003499

• Pre-activated anti-viral innate immunity in the upper airways controls early SARS-CoV-2 infection in children

  We investigated 10 female and 14 male SARS-CoV-2 positive children (age range: 0.8 to 18 years). Based on the WHO guidelines, 15 patients were classified as having mild COVID-19, while 7 children were classified as moderate COVID-19 cases. Two children were asymptomatic. 8 female and 10 male SARS-CoV-2 negative children were included as controls (age range: 4 to 16). 12 SARS-CoV-2 positive female and 9 male adults were included ( age range: 27 - 76) together with 13 female and 10 male SARS-CoV-2 negative adult controls (age: 24 - 77). 10 adult COVID-19 patients had mild disease, while 12 had moderate COVID-19. We performed single-cell RNA sequencing experiments.

  Dataset EGAD00001007969

• Single cell transcriptomic data of human gut macrophages

  Cellular suspensions (∼15000 cells, with expected recovery of ∼7500 cells) of sorted CD45+ HLA-DR+ CD14+ macrophages from colonic mucosa and muscularis propria were loaded on the 10X Chromium Controller instrument (10X Genomics) according to the manufacturer’s protocol using the 10X GEMCode proprietary technology. All samples from individual patients were loaded in one batch. The Chromium Single Cell 3´ v2 Reagent kit (10X Genomics) was used to generate the cDNA and prepare the libraries, according to the manufacturer’s protocol. The libraries were then equimolarly pooled and sequenced on an Illumina NextSeq500 using HighOutput flow cells v2.5. A coverage of 400M reads per sample was targeted, in order to obtain 50 000 reads per cell. The raw data were then demultiplexed and processed with the Cell Ranger software (10X Genomics) v2.1.1.

  Dataset EGAD00001007765

• Single nuclei sequencing of early, late-term, and early-onset pre-eclamptic decidua and villi.

  Hypertensive disorders in pregnancy, of which the multisystem syndrome pre-eclampsia is the most severe, leading to preterm delivery, maternal mortality, and life-long complications. To elucidate early disease dynamics, we present the first spatio-temporal study comparing single-nuclei transcriptomes of human preterm pre-eclamptic placentae and healthy controls, contextualizing this in a comprehensive study including early and late gestational placentae. This study includes early placentae samples from the fetal part (villi; n=10), maternal part (Decidua; n=3), late placentae samples from healthy pregnancies, villi (n=6), decidua (n=4), and late placentae samples from early-onset preeclamptic pregnancies, villi (n=5) and decidua (n=5).

  Dataset EGAD00001008273

• Disease specific alterations in the olfactory mucosa of patients with Alzheimer’s disease

  The sample AD_Library_1, AD_Library_2 and Control_Library were run on a Chromium Chip B with the Chromium Single Cell 3′ Library & Gel Bead Kit v3 kit (10x Genomics, CA, USA) . The 3’ gene expression libraries were sequenced at an approximate depth of 50,000 reads per cell using the NovaSeq 6000 S1 (Illumina, San Diego, CA, USA) flow cells. Cell Ranger v.3.0.2 was used to analyze the raw base call files. FASTQ files and raw gene-barcode matrices were generated and aligned human genome GRCh37 (hg19). The samples were integrated in R v.4.0.3 and generated Seurat objects, two related to AD samples and one to control samples, were analyzed using the Seurat package v.4.0.3 to perform downstream analysis, clustering of the cells and differential expression.

  Dataset EGAD00001008560

• Genomic Evolution of Breast Cancer Metastasis and Relapse

  Recurrent breast cancer is almost universally fatal. We characterize 170 patients locally relapsed or distant metastatic cancers using massively parallel sequencing. We identify that the relapse-seeding clone disseminates late from the primary tumor. TP53 and AKT1 appear to be enriched in ER-positive cancers predisposed to relapse. Mutation acquisition continues at relapse as the same mutation signatures continue to operate and new signatures, such as that caused by radiotherapy appear de novo. In 49% of cases we identify drivers mutations private to the relapse and these are sampled from a wider range of cancer genes, including SWI-SNF complex and JAK-STAT signaling.

  Dataset EGAD00001002696

• Genomic characterisation of SDH deficient renal cell carcinoma - WGS

  SDH deficient renal cell carcinomas are a rare and recently defined subtype of kidney cancer, often associated with an inherited mutation in one of the SDH gene subunits. This dataset sought to understand the genomic events that underpin tumour formation, from putative cell of origin, characterisation of the tumour microenvironment, to the genomic evolution of these rare tumours. We performed whole genome and RNA sequencing of 4 patients with SDH deficient renal cell carcinomas, including one patient who had an additional paraganglioma. An addition patient in this cohort had the initial diagnosis revised to a clear cell renal cell carcinoma.

  Dataset EGAD00001008469

• RNAseq data of polyA+ RNA from Leukocytes from 624 individuals of the ProgeNIA cohort.

  We sequenced the polyA+ fraction of the RNA of the leukocytes from 624 sardinian individuals with RNAseq. Prior to library preparation we added either ERCC ExFold RNA Spike-In. An average of 60M reads per samples with 51 bp paired-end reads were generated on a HiSeq 2000 (Illumina). Sequencing reads were then aligned using STAR-2.2.0c2 to the h37d5 reference genome supplemented with the ERCC spike-ins sequences. We further provided an exon-exon junction database that we generated from the GENCODE v14 annotation. In order to remove a contamination from a parallel experiment, we discarded any reads that mapped to the genomic regions of CBLB (chr3:105370773-105592330) and BCL11A (chr2:60672555-60784156). Filtered aligned reads (bam format) are shared.

  Dataset EGAD00001003102

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• A non-canonical lymphoblast in refractory childhood T cell leukaemia

  Refractory cancers may arise either through the acquisition of resistance mechanisms by cancer cells or represent distinct diseases. The origin of childhood T-cell acute lymphoblastic leukaemia (T-ALL) that does not respond to initial treatment, i.e. refractory disease, is unknown. Refractory T-ALL carries a poor prognosis and cannot be predicted at diagnosis. Here, we performed single cell mRNA sequencing of T-ALL from children who did or did not respond to initial treatment. We identified a transcriptionally distinctive blast population, exhibiting features of innate-like lymphocytes, as the major source of refractory disease. Evidence of such blasts at diagnosis heralded refractory disease across independent datasets and was associated with survival in a large, contemporary trial cohort. Our findings portray refractory T-ALL as a distinct disease. They may have immediate clinical utility.

  Dataset EGAD00001015381

• Direct transcriptional consequences of somatic mutation in breast cancer

  The disordered transcriptomes of cancer encompass direct effects of somatic mutation on transcription; co-ordinated secondary alterations in transcriptional pathways; and increased transcriptional noise. To catalogue the rules governing how somatic mutation Overall, 59% of 6980 exonic substitutions were expressed. Compared to other classes, nonsense mutations showed lower expression levels than expected with patterns characteristic of nonsense-mediated decay. 14% of 4234 genomic rearrangements caused transcriptional abnormalities, including exon skips, exon reusage, fusion transcripts and premature poly-adenylation. We found productive, stable transcription from sense-to-antisense gene fusions and gene-to-intergenic rearrangements, suggesting that these mutation classes may drive more transcriptional disruption than previously suspected. Systematic integration of transcriptome with genome data therefore reveals the rules by which transcriptional machinery interprets somatic mutation.

  Dataset EGAD00001002236

• Massive parallel RNA sequencing of highly purified mesenchymal cells derived from bone marrow specimens of 10 healthy donors

  Highly purified mesenchymal cells (CD45-/7AAD-/CD235a-/CD31-/CD271+/CD105+) were prospectively FACS-isolated from bone marrow specimens of 10 healthy donors (HDs). This data set is used as a baseline control to observe the differences between gene expression profiles (GEPs) of pre-leukemia cases (45 low-risk myelodysplastic syndrome, 4 Shwachman-Diamond and 3 Diamond-Blackfan anemia patients) and gene expression patterns observed in a normal, healthy context. Through differential expression and gene set enrichment analysis we determined that inflammatory signaling pathways are significantly more active in mesenchymal cells of pre-leukemia cases compared to their healthy counterparts. Finally, we determined through statistical modelling of healthy donor's GEPs which pre-leukemia cases have significantly more active inflammatory signaling and demonstrated a strong relation to survival statistics.

  Dataset EGAD00001002659

• Shot-gun stool metagenomics and colorectal cancer risk.

  This study aims to identify metagenomics biomarkers in colorectal cancer (CRC). The study includes 156 samples of shot-gun stool metagenomics, corresponding to 51 patients with CRC, 54 patients with high-risk adenoma, and 51 healthy controls. The sequencing libraries were prepared with 2 µg of total DNA using the Nextera XT DN Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing was performed at 150 nucleotides, paired-end, using an Illumina HiSeq 4000 platform.

  Study EGAS00001007025

• sWGS of Pap test smears from healthy donors and HGSOC patients and matched tumor tissue

  Shallow whole genome sequencing was performed on Pap test smears considering at least 10 M reads per sample. The cohort consists of 77 samples from healthy women, i.e. no tumor diagnosis, and 65 samples from women with a diagnosis of high-grade serous ovarian cancer (HGSOC) taken months or years before diagnosis. 44 primary tumor samples matched to the respective HGSOC patients were sequenced in the same manner as the Pap test smears.

  Study EGAS00001007084

• The genomic landscape of recurrent ovarian high grade serous carcinoma: the BriTROC-1 study

  The BriTROC-1 study, spanning 15 centres across the United Kingdom, is a prospective observational project investigating putative causes of relapse in high-grade serous carcinoma (HGSC). Potential genomic changes associated with disease recurrence are examined by studying paired tumour samples collected from patients at diagnosis and after relapse after receiving platinum based chemotherapy. Shallow whole genome sequencing and targeted amplicon sequencing are used to identify copy number aberrations and short variants respectively.

  Study EGAS00001007292

• Multiomic Sequencing of Paired Primary and Metastatic Small Bowel Carcinoids

  Small bowel carcinoids are insidious tumors that often have metastatic spread at the time of diagnosis. Limited studies on the mutational landscape of carcinoids indicate that the tumors have a relatively low mutational burden. Loss of chromosome 18q and loss of CDKN1B have been reported in a minority of tumors. The development of targeted therapies will depend upon the identification of mutations that drive the pathogenesis and metastasis of carcinoid tumors.

  Study EGAS00001006988

• The Gut Microbiome of liver transplant recipients – Cross-sectional + Longitudinal (renal and liver)

  TransplantLines is designed as a single-center, prospective cohort study and biobank including all different types of solid organ transplant recipients as well as living organ donors. In the TransplantLines gut microbiome study the gut microbiome of solid organ transplant recipients is characterized and linked to clinical phenotypes. This batch contains the cross-sectional data from liver transplant recipients and longitudinal data from renal and liver transplant recipients.

  Study EGAS00001006258

• EGAD00010000628

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000628

• EGAD00010000630

  The TEENAGE study target population comprised adolescent students aged 13 to 15 years attending the first three classes of public secondary schools located in the wider Athens area of Attica.

  Dataset EGAD00010000630

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• GCAT| WGS Structural Variants Catalog V1

  This resource contains the SV annotations using the AnnotSV tool. The description of annotations can be found in AnnotSV web page https://lbgi.fr/AnnotSV/ or GCAT-BSC web page: http://cg.bsc.es/GCAT_BSC_iberianpanel

  Dataset EGAD00010002152

• Pre-neoplastic liver colonization by 11p15.5 altered mosaic cells in young children with hepatoblastoma

  Dataset EGAD00001009669

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• PacBio data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 16 samples sequenced in pools on SMRT Cells 25M on a PacBio Revio instrument. One unaligned BAM file per sample is provided.

  Dataset EGAD50000000798

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Spatially resolved targetted sequencing of colorectal cancers

  Sequencing of laser-capture micro dissected colorectal tumour glands using a targeted capture panel. Tumours were previously subjected to WGS in the parent EPICC study. UMI-resolved aligned bam files, aligned to hg38.

  Dataset EGAD50000001650

• A distinct monocyte cellular state links systemic immune dysregulation to pulmonary impairment in long COVID

  single cell multiome dataset (snRNA-seq + snATAC-seq) from PBMC of patients with long COVID disease.

  Dataset EGAD50000001729

• Triple-negative breast cancer sequencing data

  Single-cell RNA sequencing and spatial transcriptomic sequencing data associated with manuscript 'Ectopic NMDAR expression in cancer unmasks germline-encoded autoimmunity'

  Dataset EGAD50000002266

• Analysis of the lung gene expression profile in COPD

  Samples obtained from patients with COPD and from controls by bronchoscopy from the lung were subjected to RNA seq.

  Study EGAS00001001472

• Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina

  Study the sub-continental origins of African, European and Native American genetic ancestries of Argentinean populations.

  Study EGAS00001004492

• The mutational landscape of skin tumours in CYLD cutaneous syndrome

  This dataset contains genomic and transcriptomic profiling of skin samples (74) from patients with CYLD cutaneous syndrome

  Dataset EGAD00001005305

• The transcription factor GABP selectively binds and activates the mutant TERT promoter in cancer

  Dataset contains Exome-seq and RNA-seq from 2 GBM patients, as well as RNA-seq from the derived cultured cells (GNS).

  Dataset EGAD00001001359

• analysis of T cell receptor repertoirs

  Full information about the T cell receptor (CR) variable regions found in the sequences of the vdj region. Columns: barcode is_cell contig_id high_confidence length chain v_gene d_gene j_gene c_gene full_length productive cdr3 cdr3_nt reads umis raw_clonotype_id raw_consensus_id

  Dataset EGAD00001008109

• Whole exome sequencing of trio with primary immunodeficiency (IL2RB)

  Whole exome paired-end sequencing data was performed on a trio (patient + parents) who has primary immunodeficiency to identify the genetic cause of the immunodeficiency. Analysis revealed a novel homozygous mutation in IL2RB.

  Dataset EGAD00001004963

• FFPE CPA Accreditation Study

  FFPE CPA accreditation of genome-scale sequencing in routinely collected formalin-fixed paraffin-embedded (FFPE) cancer specimens versus matched fresh-frozen samples using targeted pulldown capture prior to Illumina sequencing.

  Dataset EGAD00001000678

• RNA-Seq of human CD4 Treg cells

  This dataset maps gene expression regulation in human primary regulatory CD4+ T cells (Tregs). It includes whole transcriptome data for141 samples. The final quality filtered set included 123 individuals with RNA-seq data.

  Dataset EGAD00001004830

• PacBio sequence data

  PacBio sequencing data of HKCI-2, HKCI-C1, HKCI-C2, HKCI-C3, HKCI-4, HKCI-9, HKCI-11, HKCI-5A and MIHA. All the data (9 samples) were saved in pacbio hdf5 format.

  Dataset EGAD00001004475

• Biological and Therapeutic Implications of a Unique Subtype of NPM1 Mutated AML (RNAseq Data)

  This dataset contains 91 RNAseq paired reads, in fastq format. Samples were collected from fresh bone marrow and peripheral blood sample from AML patients.

  Dataset EGAD00001006669

• Triple Negative BC RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001339

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853