16461 results for "sec+and+unspecified+malignant+neoplasm"

in 54.13 milliseconds.

• GINS3 fibroblast RNAseq

  The eukaryotic CDC45/MCM2-7/GINS (CMG) DNA helicase unwinds the DNA double helix during DNA replication. We report the identification of individuals presenting with a Meier-Gorlin syndrome (MGS) like phenotype, secondary to hypomorphic variants in the GINS3 gene.  To verify whether the GINS3 variant affected the transcriptome, RNA-seq was performed from 3 fibroblast cultures derived from a patient with compound heterozygous GINS3 variants, and 1 replicate of fibroblasts derived from each of the two parents.

  Study EGAS00001006038

• Whole-Exome Sequencing analyses in tamoxifen-associated endometrial cancer

  An increased incidence of endometrial cancer has been described for patients that have received tamoxifen to treat breast cancer. Using samples from endometrial tumors, isolated from surgivcal specimens of patients who previously received tamoxifen treatment for breast cancer, we aimed to identify whether there are specific somatic mutations enriched in this population, relative to endometrial tumors from the general population. For this, WES was performed on matched endometrial tumors and healthy tissue (n=21).

  Study EGAS00001006453

• Follicular lymphoma at diagnosis, treated in first line with immunochemotherapy

  We performed targeted NGS in Follicular lymphoma samples at diagnosis. Explored clinico-genetic correlations and assessed four clinical or clinicogenetic risk models (FLIPI, FLIPI-2, PRIMA-IP or m7-FLIPI-molecular score) in patients with symptomatic FL who received frontline immunochemotherapy. Out of 191 patients with FL grade 1-3a, 109 were successfully genotyped. Treatment consisted on rituximab (R) plus CVP/CHOP (72.5%) or R-bendamustine (R-B) (27.5%).

  Study EGAS00001006674

• Pre-diagnostic saliva microbiota of Finnish children with autoimmune diseases

  Pre-diagnostic saliva microbiota samples of Finnish children (aged 11/12 years). This is a case-control study, where case refers to the children who developed Type 1 DM or IBD later in life and control refers to the children who were free from these diseases. The aim of the study was to find biomarkers in saliva microbiota that may help us predict DM or IBD before the onset of these diseases.

  Study EGAS00001006949

• To_profile_the_landscape_of_sebaceous_tumours___RNA

  Sebaceous tumours are a rare cutaneous cancer with potential for aggressive behaviour. However, limited information is available on these cancers with few published cases. Here we wish to exome sequence these cancers to define the first genomic landscape for this malignancy. We will extract RNA from formalin-fixed, paraffin-embedded (FFPE) cores. Cores may be obtained from lesional and non-lesional tissues of primaries as well as matching metastases. The extracted RNA will be used for RNA sequencing.

  Study EGAS00001007803

• Maastricht IBS 16S data

  Maastricht IBS cohort with biobank aims to identify subgroups of IBS according to phenotypical and genotypical characterization. This dataset represents 16S amlicon sequencing of the gut microbiome of case samples and matched controls. Fecal DNA was extracted using the Qiagen AllPrep kit with bead-beating step. Sequencing of bacterial 16S gene, domain V4, was performed using the Illumina MiSeq platform.

  Dataset EGAD00001007074

• Peripheral immunoprofiling of stratifies COVID-19 patients based on disease-specific neutrophil signatures

  The SARS-CoV-2 pandemic has led to increasing numbers of COVID-19 patients all over the world. Aetiopathologies range from no symptoms, mild flu-like to severe cases succumbing to respiratory failure. Reports on a dysregulated immune system in the severe cases, showing similarities to cytokine release syndrome, calls for better characterization and understanding of the changes in the immune system as well as their variance across COVID-19 patients in order to be able to design according to host-directed therapies. Here, we profiled blood transcriptomes of 39 COVID-19 patients and 10 control donors. Enriched granulocyte signatures in whole blood samples were verified in granulocyte samples from 49 COVID-19 patients in a second cohort.

  Dataset EGAD00001006326

• Cholangiocarcinoma

  Arcagen is an EORTC/SPECTA pan-European project that aims to recruit 1000 rare cancer patients from different tumour domains of EURACAN. This study collected samples from advanced or metastatic rare cancer from patients older than 12, and analysed them using Foundation Medicine next-generation sequencing (NGS) panels (FoundationOne CDx for FFPE samples or FoundationOne Liquid CDx for blood samples). Here we are submitting two datasets that contain NGS files from gastrointestinal rare cancers (n=119): - Dataset 2 (87 patients): Intra-hepatic cholangiocarcinoma (n=47), Extra-hepatic, cholangiocarcinoma (n=16), Not specified Cholangiocarcinoma (n=9), Small bowel adenocarcinoma (n=6) and other rare GI cancer (n=9)

  Dataset EGAD00001008968

• Peripheral immunoprofiling of stratifies COVID-19 patients based on disease-specific neutrophil signatures

  The SARS-CoV-2 pandemic has led to increasing numbers of COVID-19 patients all over the world. Aetiopathologies range from no symptoms, mild flu-like to severe cases succumbing to respiratory failure. Reports on a dysregulated immune system in the severe cases, showing similarities to cytokine release syndrome, calls for better characterization and understanding of the changes in the immune system as well as their variance across COVID-19 patients in order to be able to design according to host-directed therapies. Here, we profiled blood transcriptomes of 39 COVID-19 patients and 10 control donors. Enriched granulocyte signatures in whole blood samples were verified in granulocyte samples from 49 COVID-19 patients in a second cohort.

  Dataset EGAD00001006671

• Lung cancer, healthy control and non-cancerous plasma cfDNA samples

  The dataset contains 106 lung cancer, 12 healthy control and 11 non-cancerous lesion plasma cfDNA sample. Shallow WGS was performed on an Illumina Novaseq S4 PE150bp. Samples are provided as raw reads without any prior processing.

  Dataset EGAD00001008321

• Whole genome, exome and RNA sequencing of TFCP2-rearranged rhabdomyosarcoma

  Whole genome, exome and RNA sequencing of TFCP2-rearranged rhabdomyosarcoma, 86 samples of paired fastq files, sequenced on: Illumina HiSeq 2500 using Agilent SureSelect WGS, Illumina HiSeq 2500 using Illumina TruSeq RNA, Illumina HiSeq 2500 using Agilent SureSelect v5 WES (+UTRs), Illumina HiSeq 4000 using Agilent SureSelect WGS, Illumina HiSeq 4000 using Illumina TruSeq stranded mRNA Kit, Illumina HiSeq 4000 using Agilent SureSelect v5 WES stranded mRNA Kit, Illumina NovaSeq 6000 using Illumina TruSeq Stranded mRNA, Illumina NovaSeq 6000 using Illumina TruSeq Nano DNA, Illumina HiSeq X Ten using TruSeq Nano DNA.

  Dataset EGAD00001010108

• Somatic mutation and clonal evolution in premalignant lung disease - WGS (2020-01-15)

  Cancer is a genetic disease caused by an accumulations of mutations, however many of these mutations have been identified in pathologically normal tissue. We aim to use laser-capture microscopy (LCM) to sample individual clones from the lung tissue of individuals with a variety of lung diseases (COPD, UIP, IPF, Emphysema, pulmonary hypertension). This will allow us to identify whether cancer-associated mutations appear in this normal tissue, assess the mutational burden present, and identify the mutational processes causing these mutations. Smoking is a large risk factor for developing many of these lung diseases so we are particularly keen to determining whether there is evidence of a smoking signature in these patients. . This dataset contains all the data available for this study on 2020-01-15.

  Dataset EGAD00001005786

• Blood Transcriptome Profiling Links Immunity to Disease Severity in Myotonic Dystrophy Type 1 (DM1)

  Here, we explore the molecular signatures in RNA sequencing data from blood associated with disease severity as measured in Myotonic dystrophy type 1 (DM1) patients with less than 400 CTG-repeat length size in the DMPK gene in blood. These DM1 patients participated in the OPTIMISTIC study. This approach involved stratifying those within the OPTIMISTIC study into different patient groups with different degrees of disease severity (as measured by the muscle-impairment rating scale (MIRS)) and assessed at baseline. Patients were divided into groups with mild (MIRS 1–2) and severe (MIRS 3–5) neuromuscular symptoms with different DMPK repeat length characteristics. Therefore these .Bam files are baseline samples from this study.

  Dataset EGAD00001010010

• RNA stability controlled by m6A methylation contributes to X-to-autosome dosage compensation in mamals

  In mammals, X-chromosomal genes are expressed from a single copy since males (XY) possess a single X chromosome, while females (XX) undergo X inactivation. To compensate for this reduction in dosage compared to two active copies of autosomes, it has been proposed that genes from the active X chromosome exhibit dosage compensation. However, the existence and mechanism of X-to-autosome dosage compensation are still under debate. Here, we show that X-chromosomal transcripts are reduced in m6A modifications and more stable compared to their autosomal counterparts. Acute depletion of m6A selectively stabilises autosomal transcripts, resulting in perturbed dosage compensation in mouse embryonic stem cells. We propose that higher stability of X-chromosomal transcripts is directed by lower levels of m6A, indicating that mammalian dosage compensation is partly regulated by epitranscriptomic RNA modifications.

  Dataset EGAD00001010194

• Paired WES and low coverage WGS of osteosarcoma

  Longitudinal genome-sequencing analysis of 12 patients with metastatic or refractory osteosarcoma. The study was approved at the University Hospital Basel, following the approval of the ethical committee for mutational analysis of anonymized samples (“Ethikkommission beider Basel” ref. 274/12). Informed consent was obtained from all 12 patients. All tumor samples were evaluated by an experienced bone pathologist to confirm the diagnosis. WES and low coverage WGS are aligned against the reference genome GRCh37. More details in the associated publication.

  Dataset EGAD00001007509

• single cell RNA-seq of bone marrow from infants with MLL-rearranged Acute Lymphoblastic Leukemia by single cell RNA-sequencing

  This dataset contains two experiments. 1) Single cell RNA-seq of diagnostic samples from patients with MLL-rearranged infant ALL that underwent relapse or not (samples ending in R relapsed, samples ending in N did not). For some of the patients, multiple indipendent plates were produced (each plate is a sample). 2) in vitro prednisolone exposure experiment. diagnostic bone marrow samples from patient 4662R were cultured for three days with and without prednisolone. Single cell experiments were conducted according to Muraro et al (cell systems, 2016, doi:10.1016/j.cels.2016.09.002). Cell barcodes and UMI sequences are embedded in the header of each fastq entry. Cell barcodes irrelevant to this experiment were removed before submission.

  Dataset EGAD00001005461

• Genomic characterisation of SDH deficient renal cell carcinoma - WGS

  SDH deficient renal cell carcinomas are a rare and recently defined subtype of kidney cancer, often associated with an inherited mutation in one of the SDH gene subunits. This dataset sought to understand the genomic events that underpin tumour formation, from putative cell of origin, characterisation of the tumour microenvironment, to the genomic evolution of these rare tumours. We performed whole genome and RNA sequencing of 4 patients with SDH deficient renal cell carcinomas, including one patient who had an additional paraganglioma. An addition patient in this cohort had the initial diagnosis revised to a clear cell renal cell carcinoma.

  Dataset EGAD00001008469

• Shallow whole genome sequencing

  This dataset contains a collection of tumour samples from high grade serous ovarian carcinoma patients with recurrent disease collected near the point of diagnosis as well as tumour samples collected after patient relapse upon or some time after study entry. The majority of diagnosis samples were preserved in neutral buffered formalin whereas the majority of post-relapse samples were preserved in universal molecular fixative (UMFIX, Sakura Finetek USA, Inc). DNA was extracted and whole genome sequencing libraries were prepared either using the TruSeq DNA Nano kit (Illumina) or the ThruPLEX DNA-Seq Kit (Takara Bio), which were respectively sequenced at low depth (~0.1-0.5X) on illumina HiSeq 2500 and HiSeq 4000 sequencing platforms. Sequenced reads were aligned to the GRCh37 reference genome (release hs37d5).

  Dataset EGAD00001011049

• A non-canonical lymphoblast in refractory childhood T cell leukaemia

  Refractory cancers may arise either through the acquisition of resistance mechanisms by cancer cells or represent distinct diseases. The origin of childhood T-cell acute lymphoblastic leukaemia (T-ALL) that does not respond to initial treatment, i.e. refractory disease, is unknown. Refractory T-ALL carries a poor prognosis and cannot be predicted at diagnosis. Here, we performed single cell mRNA sequencing of T-ALL from children who did or did not respond to initial treatment. We identified a transcriptionally distinctive blast population, exhibiting features of innate-like lymphocytes, as the major source of refractory disease. Evidence of such blasts at diagnosis heralded refractory disease across independent datasets and was associated with survival in a large, contemporary trial cohort. Our findings portray refractory T-ALL as a distinct disease. They may have immediate clinical utility.

  Dataset EGAD00001015381

• Single-cell antibody-derived tag sequencing data of peripheral blood mononuclear cells obtained from 30 ATL patients, 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Single-cell antibody-derived tag sequencing (scADT-seq) data of peripheral blood mononuclear cells (PBMCs) obtained from 30 ATL patients (34 samples including 4 sequential ones), 11 HTLV-1-infected asymptomatic carriers, and 4 healthy donors.

  Dataset EGAD00001007017

• Low coverage whole-genome sequencing of samples from the Cretan Greek isolate collection HELIC-MANOLIS

  Whole-genome sequencing at 1x of samples from the Cretan Greek isolate collection HELIC-MANOLIS. Genome-wide association studies of complex traits have been successful in identifying common variant associations, but a substantial heritability gap remains. The field of complex trait genetics is shifting towards the study of low frequency and rare variants, which are hypothesised to have larger effects. The study of these variants can be empowered by focusing on isolated populations, in which rare variants may have increased in frequency and linkage disequilibrium tends to be extended. This work focuses on an isolated population from Crete, Greece. Sequencing is very efficient in isolated populations, because variants found in a few samples will be shared by others in extended haplotype contexts, supporting accurate imputation.

  Dataset EGAD00001001637

• Variant calling analysis of cfDNA whole exome sequencing in neuroblastoma

  This dataset contains VCF files from a variant calling analysis of 19 neuroblastoma patients. WES or WGS data of the primary tumor were compared to WES cfDNA analysis at the time of diagnosis and at a 2nd timepoint (complete remission, partial remission, disease progression or relapse). For 4 patients, WGS of germline, tumor at diagnosis and tumor at relapse DNA was performed on Illumina HiSeq2500, with 100-bp paired-end reads. For the other patients, WES was performed using either an AgilentSureSelect Human All Exon v5 or a Roche Nimblegen SeqCap EZ Exome V3 kit on Illumina HiSeq2000, with 100-bp paired-end reads. SNVs observed in any of the primary tumors or cfDNA samples studied by WES were targeted using a capture sequencing panel at all intermediate time points.

  Dataset EGAD00001003803

• BAM files: Brain transcriptome of hereditary cerebral haemorrhage with amyloidosis–Dutch type (HCHWA-D)

  cDNA depleted RNA (500ng total RNA input) was fragmented to 150-200 nucleotides in first strand buffer for 3 minutes at 94°C. Random hexamer primed first strand was generated in presence of dATP, dGTP, dCTP and cTTP. Second strand was generated using dUTP instead of dTTP to tag the second strand. Subsequent steps to generate the sequencing libraries were performed with the KAPA HTP Library Preparation Kit for Illumina sequencing with minor modifications, i.e., after indexed adapter ligation to the dsDNA fragments, the library was treated with USER enzyme (NEB_M5505L) in order to digest the second strand derived fragments. After amplification of the libraries, samples with unique sample indexes were pooled and sequenced paired-end 2x50bp on a HiSeq2500 system following standard Illumina guidelines.

  Dataset EGAD00001003806

• RNA-seq of human iPSC-derived neurons to explore cellular phenotypes associated with schizophrenia.

  This dataset contains high-throughput RNA-sequencing of 12 samples, each sample comprising neural precursor cells derived from human induced pluripotent stem cells from individuals with and without the 16p13.11 microduplication (a copy number variant associated with a range of neurodevelopmental disorders). 4 samples derive from patients carrying the 16p13.11 microduplication, and 8 derive from unaffected family controls. RNA samples were processed to deplete rRNA using the TruSeq Stranded Total RNA with Ribo-Gold kit. Libraries were then sequenced using the NextSeq 500/550 High-Output v2 Kit on the Illumina NextSeq 550 platform, to produce 75 base pair paired-end sequencing reads at an average depth of around 100 million reads per sample. Raw sequencing reads data are stored in two FASTQ files per sample for these paired-end reads.

  Dataset EGAD00001004064

• Data distribution Statistics

  EGA Statistics Bibliography Growth Community Archive Distribution Catalogue Here, we show the amount of data distributed by the EGA. Data Distributed / Live EGA Data Distribution / Live SFTP Aspera HTSGET lineChartLive("svg#ega-dist-live", document.querySelector("#ega-figure-dist-live figcaption")); Data Distributed The below figure represents the cumulative EGA data distribution via the download clients(v2 and v3.x api versions) using HTTPS, FTP, and download boxes using ASPERA. You can see cumulative values by clicking "Cumulative". EGA Data Distribution //lineChart('#ega-data-distribution svg.stats', 'https://stats.ega-archive.org/distribution', // ['Amount of Distributed Data', ['Aspera', 'Download Clients', 'Total']]) curveChart('#ega-data-distribution', [ { domId: 'stats-aspera', label: 'Aspera', url: 'https://stats.ega-archive.org/distribution/aspera' }, { domId: 'stats-sftp' , label: 'SFTP', url: 'https://stats.ega-archive.org/distribution/sftp' }, //{ domId: 'stats-htsget', label: 'HTSGET', url: 'https://stats.ega-archive.org/distribution/htsget' }, { domId: 'stats-streamer' , label: 'Download Client', url: 'https://stats.ega-archive.org/distribution/streamer' }, { domId: 'stats-total' , label: 'Total', url: 'https://stats.ega-archive.org/distribution/total' } ] );

  Documentation about/statistics/distribution

• Bulk_sequencing_study_for_human_male_germline

  This study aims to understand the gene expression changes in male reproductive tissues during spermatogenesis using integrated multi-omics analysis. Different populations from testis biopsies, including spermatogonia stem cells, primary spermatocytes, secondary spermatocytes, spermatids and mature sperms, were sorted based on the DNA content. In addition to the G&T sequencing results for single cells, we sorted bulk samples for those populations for Nanoseq to detect the mutations at low error rate.

  Study EGAS00001005990

• Follow_up_for_second_tier_signals_from_the_arcOGEN_GWAS

  The arcOGEN UK nationwide consortium has been funded by the arc to undertake a genome-wide association scan in osteoarthritis. GWA genotyping has been carried out at the Sanger on the illumina 610k array. This replication study was desinged to follow-up second-tier signals from the arcOGEN GWS in 25 SNPs (1Sequenom iPLEX) with p<5x10^-6 on 6000 additional UK OA and control samples.

  Study EGAS00001001017

• Temporal Lobe Epilepsy and Retrotransposons

  Idiopathic (cryptogenic) epilepsy is a common, chronic group of brain disorders, affecting 1-2% of the US population, creating a significant public health problem because of the associated morbidity and mortality. One subtype of this complex group of brain disorders, temporal lobe epilepsy (TLE), is particularly burdensome, because a substantial fraction of patients do not respond to anticonvulsant medications. If the seizure focus can be localized by imaging and/or EEG, the TLE patient often elects to have a partial resection of the affected temporal lobe, because they have daily seizures, despite multiple pharmacotherapy regimens. Although genetic risk is thought to play a role in TLE, identification of common risk alleles has had limited success. In the past 5 years, data have accumulated to prove that neuronal embryogenesis is accompanied by activation of LINE1 (L1) retrotransposons (RTPs) to an unexpected degree, such that developing neurons may accumulate de novo L1 insertions. This results in a substantial mosaicism within populations of CNS neurons. While most of these somatic de novo L1s will have little effect on neuronal function (perhaps because they occur in gene deserts or in large introns or in genes not required for that cell's function), some may interfere with normal neuronal activity because they have inserted into a gene needed by that particular neuron for normal function. If one or more functional de novo L1s occur early in CNS development, all the daughter neurons that derive from that neuronal precursor will also carry the L1 insertion, perhaps leading to a dysfunctional population of neurons destined to become an epileptic focus. This study leveraged CNS tissue (obtained at craniotomy) from patients with intractable TLE, who have undergone a therapeutic partial resection of one temporal lobe. Using fluorescence-assisted cell sorting of temporal lobe neuronal nuclei, followed by high-throughput sequencing and alignment to the reference genome, detection of de novo L1s will be done. In this manner, it is expected that de-novo intragenic L1s, contributing to idiopathic TLE, will be discovered.

  Study phs002067

• Sequencing data for oesophageal and related samples - Normals release 3 (RNA)

  Dataset EGAD00001003902

• Sequencing data for oesophageal and related samples - Normals release 5 (RNA)

  Dataset EGAD00001005384

• Sequencing data for oesophageal and related samples - Normals release 2 (RNA)

  Dataset EGAD00001003838

• Sequencing data for oesophageal and related samples - Normals release 4 (RNA)

  Dataset EGAD00001004022

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• CRC cell line RNA-seq

  RNA-Seq data for C32, CACO2, CL11, HT29, SW403, SW948 MSS CRC cell lines and HCEC-1CT normal colon cell line

  Dataset EGAD50000000297

• 16SV4 ribosomal RNA gene sequencing data

  16SV4 ribosomal RNA gene sequencing data of GI samples and associated mixed community cultures collected from pediatric patients at risk for IBD.

  Dataset EGAD50000000485

• Roifman_DAC

  This Data Access Committee (DAC) will be set up to review applications, and render decisions for requests submitted to EGA to access data deposited into ega-box-1592 by Dr. Chaim Roifman at the Hospital for Sick Children in Toronto, Canada. Contact: Dr. Chaim Roifman. email:chaim.roifman@sickkids.ca

  Dac EGAC50000000243

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• Metabolic and molecular consequences of the TBC1D4 p.Arg684Ter variant in human skeletal muscle

  Skeletal muscle of Inuit homozygous carriers of the common Greenlandic TBC1D4 p.Arg684Ter variant is severely insulin resistant but have normal metabolic responses during exercise

  Dataset EGAD50000000059

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• RNA-seq (raw fastq files)

  RNA-seq data from lumbar spinal cord blocks from 10 ALS samples and Controls. Raw fastq files are provided in this dataset.

  Dataset EGAD50000000833

• Gastric Cancer sWGS

  Shallow Whole Genome Sequencing of two (2) Gastric Cancer samples from the same subject. sWGS was used for Copy number aberration analysis to assess clonal relationship of the collision of two independent EBV+ and EBV- tumors.

  Dataset EGAD50000000987

• Whole-genome array data for 42 Roma and 52 non-Roma from Czech Republic

  This dataset contains one VCF file with 94 individuals genotyped with the Human Origins Array.

  Dataset EGAD50000001103

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• WGS of PDO in depleted media

  Whole genome sequencing profiling of 7 PDAC patient-derived organoids (PDO) grown in a culture medium lacking both WNT3A and RSPO1- WGS unmapped reads, sequenced using NovaSeq 6000, 15x coverage 160 million reads per sample.

  Dataset EGAD50000000282

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Dataset RNA sequencing data of tumors from 85 patients with advanced or metastatic cancer treated with radio-immunotherapy

  RNA sequencing data from sequential biopsies obtained at baseline, week 3 (post-immuno, before SBRT), and week 7 (after SBRT)

  Dataset EGAD50000000958

• Young-Boost Whole Exome Sequencing (WES)

  Datasets associated with Young Boost Trial for Breast Cancer patients. Whole Exome Sequencing (WES) performed on 109 Samples (75 Tumor and 34 Normal). WES was performed to identify potential predictive biomarkers for treatment response.

  Dataset EGAD50000001171

• South African breast cancer GWAS genotype data in VCF format

  South African breast cancer GWAS genotype data for 2823 female African breast cancer cases. The data was generated using the H3Africa Custom microarray and genotyped on the Illumina HiScan instrument. The dataset is in VCF format.

  Dataset EGAD00010002732

• Dataset for "HPV integration induces gene fusions" (ONT)

  ONT whole-genome sequencing data for "HPV integration induces gene fusions" . We sequenced five HPV-positive head and neck cancer samples using Oxford Nanopore platform. The sequences was submitted in fastq format.

  Dataset EGAD50000001302