16624 results for "sec+and+unspecified+malignant+neoplasm"

in 33.82 milliseconds.

• ICGC-LIRI-JP Release 15

  RIKEN collection WGS reads for 321 HCC and blood matched samples from 158 donors submitted to ICGC for release 15

  Dataset EGAD00001000808

• Metastatic breast cancer targeted gene screen (2014-09-24)

  The samples will be sequenced for a targeted panel of cancer relevant genes (n ~ 370) and analysed for somatic mutations. This dataset contains all the data available for this study on 2014-09-24

  Dataset EGAD00001001018

• IBDCA_Edinburgh

  In this experiment we have sequenced tumour normal pairs from patients presenting with CRC who have a prior history of inflammatory bowel disease. The idea is to identify driver mutations, new genes and novel pathways associated with the development of these malignancies.

  Dataset EGAD00001001330

• WGS on patients 5-7, study of metastatic prostate cancer

  Data from the study of subclonal metastatic expansion in prostate cancer. Whole genome shotgun sequencing of six samples, tumour and whole blood, from the three additional patients whose somatic variants were examined in depth.

  Dataset EGAD00001001344

• Metastatic Breast Cancer Whole Genome

  We propose to definitively characterise the somatic genetics of Metastatic breast cancer through generation of comprehensive catalogues of somatic mutations in Metastatic breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000899

• Metastatic breast cancer targeted gene screen (2017-05-11)

  The samples will be sequenced for a targeted panel of cancer relevant genes (n ~ 370) and analysed for somatic mutations. This dataset contains all the data available for this study on 2017-05-11.

  Dataset EGAD00001003330

• Genomic Landscape of Chordoid Glioma

  This data set consist genomic information of 10 Chordoid Glioma samples: - Exome sequencing: 10 tumors and matched normal DNA for four of them (BAM files) - RNAseq : 10 tumors (fastq files) - CNV array: 9 tumors (IDAT files)

  Dataset EGAD00001004112

• Transposome Bisulfite Sequencing

  DNA belonging to 16 tumour/normal samples were treated with bisulfite, then up to 5 different bisulfite PCRs were performed in each one of the samples. Amplicons form the same sample were pooled and submitted to sequencing on a MiSeq platform.

  Dataset EGAD00001001028

• Genomic alteration in Korean Young Age Diffuse Gastric Cancers

  To identify recurrent somatic alterations in this unique subset of gastric cancers, whole exome and SNP6 analyses were performed using frozen cancer tissue. The somatic mutation analyses were also performed using blood of the same patients.

  Dataset EGAD00001001984

• Data files for PCGP SJACT RNASEQ

  This dataset contains RNA-Seq files for the SJACT cohort associated with the paper "Genetic landscape of pediatric Adrenocortical Tumor". In this paper, we analyse 37 adrenocortical tumours (ACTs) by whole-genome, whole-exome and/or transcriptome sequencing.

  Dataset EGAD00001002680

• BLUEPRINT DNA methylation profiles of human hematopoietic progenitors

  DNA methylation was analyzed for stem/progenitor cell types and terminally differentiated cell types of the human blood lineage (HSC, MPP, CMP, MEP, GMP, CLP, MLP0, MLP1, MLP2, MLP3, MK, CD4+ Tcell, CD8+ Tcell, Bcell, NK, Neut, Mono).

  Dataset EGAD00001002732

• Exome sequencing of 7-member healthy family (father, mother, their three biological daughters and monozygotic twin sons)

  The dataset contains exome sequencing data of seven healthy family members, all in FASTQ format. The samples were taken from peripheral blood mononuclear cells. Furthermore, corresponding proteomics data are available as well.

  Dataset EGAD00001004949

• EGAS00001003405 combined RNA, WES, WGS data of 16 gastrointestinal tumor patients

  50 samples of 16 individuals with Gastrointestinal Tumor. Patients were sequenced in various combinations of WGS, Exome and RNA sequencing.

  Dataset EGAD00001005113

• Prognostic markers of DNA methylation and NGS sequencing in progressive glioblastoma from the EORTC-26101 trial

  These dataset contains NGS data from 380 samples from the EORTC-26101 clinical trial for patients with progressive glioblastoma.

  Study EGAS00001007421

• RNA Dataset

  The RNA dataset includes 5 samples analyzed with the Oncomine Comprehensive Assay (OCA) panel. After library preparation, sequencing was performed on the Ion Torrent S5 System, generating FASTQ files. The analysis captures gene fusions and splice variants relevant to oncogenic processes. (idem)

  Dataset EGAD50000002502

• Raw BulkRNA sequencing data

  BulkRNA sequencing Human Strand Specific mRNA (WOBI) 40M reads was performed by Novogene (Netherlands) using the NovaSeq X Plus Series (PE150, Q30≥85%) sequencing platform and strategy. 24 samples were included in the study, requiring 12 G of raw data per sample.

  Dataset EGAD50000001848

• Sequence variation of rs774984872G>T

  This dataset contains the genotypes status of rs774984872G>T, a loss of function variant in ANGPTL8. 8 individuals had the reference allele (G/G), 5 were heterozygous (G/T) and 1 was a knock out (T/T).

  Dataset EGAD50000002135

• Whole-genome sequencing of endometrial cancer plasma circulating DNA

  This dataset contains whole-genome sequencing data generated from plasma cell-free DNA of dMMR endometrial cancer patients. Sequencing was performed on Illumina platforms to an average depth of approximately 10× and the dataset includes raw sequencing reads in FASTQ format.

  Dataset EGAD50000002263

• Multi-modal spatial characterization of tumor-immune microenvironments identifies targetable inflammatory niches in diffuse large B-cell lymphoma

  This dataset includes NGS data of large B-cell lymphoma, including bulk RNAseq data of 71 biopsies and germline WES data of 70 biopsies.

  Dataset EGAD50000001641

• mFAST-SeqS

  mFAST‑SeqS, or modified Fast Aneuploidy Screening Test‑Sequencing System, is a streamlined and cost-effective approach to estimate the fraction of ctDNA in blood samples by detecting genome-wide aneuploidy in cfDNA

  Dataset EGAD50000001670

• Targeted next-generation sequencing of plasma samples

  Targeted next-generation sequencing was performed on circulating cell-free DNA extracted from plasma samples of patients in the Neo-Pembro trial. For each patient, circulating cell-free DNA from the baseline plasma sample was extracted and sequenced using the AVENIO Expanded Kit v2.

  Dataset EGAD50000001415

• This dataset contains the cram files from the whole Exome sequencing

  Exome Sequencing of Healthy and M. Heamophilum Infected Participants

  Dataset EGAD50000001565

• scWGS profile, paediatric acute lymphoblastic leukemia ALL40

  Single cell sequencing using the direct nuclear tagmentation and RNA sequencing (DNTR-seq) method was performed on the diagnostic bone marrow sample (ALL40). This dataset consists of the DNA (scWGS) profile from 384 cells. Two fastq files are associated with each cell identifier.

  Dataset EGAD50000001774

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• WES dataset

  Associated with Molecular biomarkers in progression from refractory celiac disease to the lethal cancer variety enteropathy associated T cell lymphoma (EATL) Study. Whole Exome Sequencing (WES) of 63 samples. WES analysis done to detect mutations and copy number aberration predictive for progression from RCD to EATL.

  Dataset EGAD50000001164

• NICHE - RNA-seq of MMR proficient early stage colon cancers

  The dataset includes 29 FASTQ files from single-end total RNA sequencing on Illumina HiSeq2500 and 66 files from 33 paired-end RNA sequencing samples on Novaseq 6000 for 31 pMMR colon cancer patients.

  Dataset EGAD50000001248

• Integrated Multiomics Uncovers Distinct Macrophage Alterations in Human Metabolic dysfunction-Associated Steatohepatitis Progression

  We report single-nuclei RNA sequencing data (n=18) from human livers in metabolic dysfunction-associated steatotic liver disease (MASLD) patients. there are 5 MASH, 4 MASL, 5 control obese and 4 control lean samples.

  Dataset EGAD50000001129

• CAIRO2 - Whole Exome Sequencing (WES)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Whole Exome Sequencing (WES) of 64 metastatic colorectal cancer (mCRC) from CAIRO2 trial. WES data was used for mutational analysis.

  Dataset EGAD50000001140

• CAIRO2 - Shallow Whole Genome Sequencing (sWGS)

  Long-term Survival Update and Extended RAS Mutational Analysis of the CAIRO2 Trial: Addition of Cetuximab to CAPOX/Bevacizumab in Metastatic Colorectal Cancer. Shallow Whole Genome Sequencing (sWGS) of 52 metastatic colorectal cancer (mCRC) samples from CAIRO2 trial. sWGS was used for mutational analysis.

  Dataset EGAD50000001141

• Whole Exome Sequencing (WES) data of PERFECT trial

  Whole exome sequencing (WES) data of patients with resectable esophageal adenocarcinoma treated with neoadjuvant atezolizumab and chemoradiation (PERFECT). 78 matched samples (Tumor-Normal) from 39 patients with resectable esophageal adenocarcinoma of the PERFECT trial. Whole exome sequencing performed for mutation detection analysis.

  Dataset EGAD50000001153

• Genetic architecture of disease in Greenland is shaped by demographic history, fine-structure, and selection - MEGA chip data

  This file set has 1478 Greenlandic individuals scored on the Illumina MEGA array (1,748,250 sites). The data is in PLINK bed/bim/fam format. The individuals originate from the B2018 population survey.

  Dataset EGAD50000000934

• Whole Transcriptome Sequencing Data of prDLBCL

  We used sequenced 30 prDLBCL samples using RNA-seq to evaluate possible fusion events and to get expression profiles.

  Dataset EGAD50000000592

• Raw ONT R9 data: Rapid brain tumor classification from sparse epigenomic data

  This dataset contains 75 Nanopore sequencing experiments using a MinION sequencer and R9 flow cells from 51 patient biopsies. Gzipped tar files containing all fast5 files per sample are provided.

  Dataset EGAD50000000832

• RNAseq data of metastatic breast cancer samples

  Paired-end RNA sequencing data from 28 metastatic breast cancer samples. Sequencing was performed on the Illumina NovSeq 6000 and HiSeq 4000 using TruSeq Stranded mRNA Kit.

  Dataset EGAD50000000818

• Bulk transcriptomic analyses of monocyte-derived dendritic cells treated with CES1i

  The data published here contains bulk RNA-sequencing (RNAseq) data as obtainedfrom monocyte-derived dendritic cells in treated with/without LPS and with/without CESi (WWL113). Sequencing was performed in a paired-ended fashion on the NovaSeq6000.

  Dataset EGAD50000000344

• Resistance to selective FGFR2 inhibitors across FGFR2-driven malignancies

  18 patients were biopsied at resistance to an FGFR inhibitor with tumor WES and/or WTS performed to identify resistance mechanisms to selective FGFR2 inhibitors across FGFR2-driven malignancies.

  Dataset EGAD50000000439

• TRACERx NSCLC - whole genome sequencing for ctDNA study

  Data used in "An ultra-sensitive and specific ctDNA assay provides novel pre-operative disease stratification in early stage lung adenocarcinoma"

  Dataset EGAD50000000452

• WES data for genomic determinants of response and resistance to inotuzumab in B-ALL

  Whole exome sequencing data for 69 samples with B-cell acute lymphoblastic leukemia

  Dataset EGAD50000000097

• Bulk BCR NGS data from early breast tumours from patients during neoadjuvant therapy

  Bulk B Cell Receptor high-throughput sequencing data across 25 serial breast tumour biopsies obtained from 10 patients during neoadjuvant therapy. The samples were sequenced on an Illumina MiSeq instrument and their raw FastQ files deposited here.

  Dataset EGAD50000000356

• PREDO_EGA_methylation_data_and_gestation_ages

  This data set contains two data files. First data file (file name: PREDO_GA_EGA_methylation_data.csv) includes methylation data from 485512 sites accross human genome from 96 individuals acquired from Illumina 450K -chip. The other data file (file name: PREDO_GA_EGA_phenotypes.csv) contains the gestation ages and the genders of the 96 samples.

  Dataset EGAD00010001003

• CAfGEN2 Phenotype dataset

  CAfGEN2 phenotype data from 97 samples Uganda, Botswana and Eswatini.

  Dataset EGAD00001015820

• Data for noninvasive lung cancer subtyping study

  This dataset included cfMethyl-Seq data of 15 plasma cfDNA samples from 15 lung cancer patients and RRBS data of 58 lung tumor tissue samples from 58 lung cancer patients. The data were generated following the standard protocols.

  Dataset EGAD00001015344

• Sequencing data for oesophageal and related samples - Abbas et al (RNA)

  Data supporting: "Mutational signature dynamics shaping the evolution of oesophageal adenocarcinoma" Abbas et al (RNA for 197 samples)

  Dataset EGAD00001011269

• Bulk RNA from sorted CD8+ T cells after 48h co-culture with human Mito-DsRed MSCs.

  For human samples, total cellular RNA was isolated from post-sorted Mito+ and Mito CD8+ cells using the RNeasy Mini Kit (Qiagen). Stranded RNA libraries were created using SMARTSeq Stranded.

  Dataset EGAD00001011082

• CTCF ChIP-seq of human acute leukemias

  CTCF ChIP-seq of 39 primary samples derived from human acute leukemias, namely AML, T-ALL and mixed myeloid/lymphoid leukemias with CpG Island Methylator Phenotype (CIMP).

  Dataset EGAD00001011059

• SEF tumor sequencing data

  This dataset contains samples from 8 patients with Sclerosing epithelioid fibrosarcoma. All 8 samples have whole exome tumor data and tumor RNAseq data. 3 samples also have matched normal dna sequence data.

  Dataset EGAD00001011100

• multi-region sequencing of tumor samples from PDAC patients

  This study includes 542 of multi-region sampled whole exome sequencing data from 83 pancreatic cancer patients in 6 individual experiments : Kras wildtype, local recurrence, treatment-naive (MetomeV2), radiotherapy plus chemotherapy (Radome), chemotherapy-only group (Treatome) and Proj_B-100-478.

  Dataset EGAD00001011109

• ExHiBITT – Exploring Host microBIome inTeractions in Twins – a colon multiomic cohort study

  The objective of the colonoscopy study is to carry out the 16s sequencing of colon biopsies and faecal samples provided in ExHiBITT study to compare potential fluctuations in the microbiota of different sites.

  Dataset EGAD00001010936

• sWGS of cfDNA from metastatic CRC patients

  Paired end shallow whole genome sequencing (sWGS) data (FASTQ) for the identification of genomewide somatic copy number alterations (SCNA) and the estimation of tumor fractions.

  Dataset EGAD00001010293

• scRNA-seq dataset for AD and Pso patients

  This dataset contains scRNA-seq fastq files to the paper entitled "Single-cell profiles reveal distinctive immune response in atopic dermatitis in contrast to psoriasis". The details of experiment setup was described in the paper.

  Dataset EGAD00001010106