17851 results for "the best way to get coins in fc 26 Navštivte Buyfc26coins.com Společnost známá transparentními transakcemi..CQ2q"

in 45.58 milliseconds.

• RNA-seq of iPSC-derived oligodendrocytes of individuals with and without t(1;11) translocation

  This dataset contains high-throughput RNA-sequencing of 14 samples, each sample comprising oligodendrocytes derived from human induced pluripotent stem cells, from individuals with and without a balanced t(1;11) translocation which substantially increases risk of major mental illness. 5 samples derive from 2 control individuals, and 9 samples from 3 individuals carrying the translocation. Libraries were prepared from each total-RNA sample using the TruSeq Stranded Total RNA with Ribo-Zero kit. Libraries were then sequenced using the NextSeq 500/550 High-Output v2 (150 cycle) Kit on the NextSeq 550 platform. Raw paired-end sequencing data is stored in two FASTQ files per sample.

  Dataset EGAD00001006341

• Ribosomal profiling on Epstein-Barr virus transformed B-lymphoblastoid cell lines

  Epstein-Barr virus-transformed B-lymphoblastoid cell lines from six individuals (HG00114, HG00282, NA12005, NA12044, NA12717 and NA12751) of the GEUVADIS Project were selected for ribosomal profiling. For each EBV-LCL, 20 million cells were treated with 2 μg/ml harringtonine and 100 μg/ml cycloheximide. After lysing cells in lysis buffer supplemented with 100 μg/ml cycloheximide, ribosome complexes were purified by density purification. Small RNA molecules were isolated using the NucleoSpin miRNA Kit (Bioke, Leiden, Netherlands), followed by RNA PAGE gel separation. Universal linkers were added after dephosphorylation. After reverse transcription, the cDNA was circularized and, after ribosomal RNA depletion, barcoded and sequenced on Illumina NextSeq 500.

  Dac EGAC50000000209

• EM-seq data from plasma cfDNA samples of ALS patients, control and C9-carriers

  This dataset contains targeted EM-seq data from 61 plasma cfDNA samples spanning 20 sporadic ALS, 10 C9orf72-ALS, 10 asymptomatic C9orf72 expansion carriers, and 21 non-disease controls. Libraries were prepared with the NEBNext Enzymatic Methyl-seq (EM-seq) kit, captured using the Twist Human Methylome Panel (3.98 M CpGs; 123 Mb), and sequenced on Illumina NovaSeq 6000 (150 bp paired-end; ~45× on-target depth) with unmethylated lambda DNA spike-in and a 20% PhiX balance library. The dataset includes per-sample gzipped FASTQ files (R1/R2) and minimal metadata.

  Dataset EGAD50000001808

• Longitudinal Transcriptomic Profiling of Endothelial Progenitor Cells in Post-COVID-19 Patients: Insights at 3 and 6-Months Post-SARS-CoV-2 Infection

  Raw transcriptomic data from endothelial cells of post-COVID patients and healthy controls. Samples were collected from post-COVID patients at 3 months (n = 6) and 6 months (n = 6) post-infection, as well as from healthy control individuals (n = 5). All post-COVID patients were hospitalized during the first wave of the pandemic. Among them, half developed pulmonary embolism (TEP; n = 6), while the other half did not (no TEP; n = 6).

  Dataset EGAD50000001452

• 10X single cell RNA- and feature barcode sequencing of 38 AML samples

  This dataset contains fastq-files from single cell 3' RNA- and feature barcode sequencing of AML samples using 10X technology (Chromium Single Cell 3ʹ Reagent Kit v3). In total, the dataset contains data from 38 AML samples from either bone marrow or peripheral blood, representing the following genetic subtypes: NPM1-mutated, myelodysplasia related, TP53-mutated, CBFB::MYH11, RUNX1::RUNX1T1, AML without class-defining mutations, and AML meeting criteria of two subtypes. The data consists of sequenced gene expression libraries from 38 samples and feature barcoding libraries covering a panel of 10-14 surface proteins for 34 samples.

  Dataset EGAD50000001577

• MIBC NAC2020 cohort RNA sequencing

  The dataset contains RNA sequencing data from N=48 transurethral resections of bladder tumours (TURBTs) from N=48 patients with muscle-invasive bladder cancer who were treated with neoadjuvant chemotherapy followed by radical cystectomy. All TURBTs originate from formalin-fixed paraffin embedded tissue. We used the Illumina TruSeq RNA exome kit, previously known as the TruSeq RNA Access Library Prep Kit. This kit converts total RNA into template molecules of known strand origin, followed by sequence-specific capture of coding RNA. All samples were run in an Illumina NovaSeq6000 instrument. Paired FASTQ files from all 48 patients are provided.

  Dataset EGAD50000001025

• Single cell resolution of human CNV body map (2019-10-02)

  12 tissues from the warm autopsy are selected for this project. Using 10X Chromium technology we will generate ~1000 single cell/nulei genomic libraries per tissue. Each tissue will be whole genome sequenced (~2 lanes per 1000 cells) on hiseq X10. per single cell we will generate CNV profile and we investigate the level of genomic heterogenity with in tissue and across different tissues. . This dataset contains all the data available for this study on 2019-10-02.

  Dataset EGAD00001005372

• Whole Genome Sequences of 18th century African descended individuals from Charleston, South Carolina.

  This study presents Whole Genome Sequencing results from the Anson Street African Burial Ground Project, which is a community-based initiative aimed at understanding the histories of 37 Ancestors in Charleston, South Carolina. Here we report fastq files for all 37 Ancestors. DNA was extracted at the University of Tennessee-Knoxville following Dabney et al. 2013, and dual index libraries prepared using a modified NEBNext Ultra II kit with partial USER enzyme digestion. Libraries were then enriched for human genomic DNA (MyBaits) and sequenced on Illumina Platforms.

  Dataset EGAD00001009643

• Blood plasma and FFPE derived total RNA seq dataset from DLBCL and PMBCL patients

  Blood plasma samples (n=168) and matched diagnostic formalin-fixed paraffin-embedded (FFPE) tissue samples (n=69) of DLBCL patients, PMBCL patients and healthy controls were collected between 2016-2021. Plasma samples were collected at diagnosis, at interim evaluation, after treatment, and in case of refractory or relapsed disease. RNA was extracted from 200 µl plasma using the miRNeasy serum/plasma kit and from FFPE tissue using the miRNeasy FFPE kit. RNA was subsequently sequenced on a NovaSeq 6000 instrument using the SMARTer Stranded Total RNA-seq pico v3 library preparation kit.

  Dataset EGAD00001011679

• A first-in-human clinical study of an allogenic iPSC-derived corneal endothelial cell substitute transplantation for bullous keratopathy

  iPSC-derived corneal endothelial cell substitutes recover pathological corneal edema. No adverse reactions are observed after one year follow-up. Gene mutations may appear despite whole genome sequencing of the master cell bank. This study contains WGS data.

  Study EGAS50000000672

• RNA-seq and ATAC-seq data for ex vivo expanded T cells

  This dataset contains bulk RNA-seq and ATAC-seq data generated from naïve CD8+ T cells isolated from PBMCs of three healthy donors and stimulated ex vivo under multiple conditions. The dataset comprises 30 samples in total, including 15 RNA-seq samples and 15 ATAC-seq samples. Paired-end sequencing was performed on the Illumina NovaSeq 6000 platform. Raw data are provided as gzipped paired FASTQ files.

  Dataset EGAD50000002471

• Transcriptome analysis of patient-derived Schwann cells isolated from human sural nerve biopsies

  This dataset contains the transcriptome analysis of human Schwann cell cultures obtained from sural nerve biopsies from six patients with polyneuropathies (N=3/patient, totalN=18) as well as the nerve fascicles from where they were isolated (N=1/patient, totalN=6). In addition, this dataset includes 8 samples out of commercial human Schwann cell cultures and one sample of a fibroblast culture, which serve as controls for further analysis.

  Dataset EGAD50000001021

• ICARUS-BREAST01 Dataset

  A phase II clinical trial (NCT04965766) of patritumab deruxtecan in 99 breast cancer patients. Whole-exome sequencing (WES) is available for 43 tumor samples and 43 blood samples collected at entry into the trial. RNA-squencing is available for 44 samples comprising 22 samples collected at entry into the trial and 22 samples collected during treatment (cycle 1 day 3, cycle 1 day 19, or cycle 2 day 3) from 22 patients.

  Dataset EGAD50000000773

• Expression array

  The whole study comprises of two patient cohorts. Screening cohort: 40 patients of Germany; validation cohort: 40 patients from Asia. Further, bile duct and CCA cell lines have been analyzed.
This dataset contains expression array data for 32 patients of the screening cohort with 8 of them having paired normal tissue plus an additional relapse tumor/normal pair of one of those 8 patients and a patient only with normal tissue. Data was generated on a HumanHT-12 v4 Bead Array (Illumina) and is stored in IDAT file format.

  Dataset EGAD00010002596

• The spatial organization of intratumor heterogeneity and evolutionary trajectories of metastasis in hepatocellular carcinoma

  A dataset consisting of Multi-regional Whole Exome Sequencing (WES) and Whole Genome Sequencing (WGS) data for 54 samples from 9 patients with hepatocellular carcinoma. The dataset includes 45 tumor samples and 9 normal blood samples. Selected somatic variants were validated by Sequenom. Patients covered are: Patient 1, Patient 2, Patient 3, Patient 4, Patient 5, Patient 6, Patient 7, Patient 8, Patient 9 and Patient 10.

  Dataset EGAD00001003138

• Exome sequencing of control DNA samples from patients with BPLL

  DNA extracted from sorted CD3+ cells (16 patients) was used for exome capture with the SureSelect V5 Mb All Exon Kit following the standard protocols. Paired-end sequencing (2 x 100 bp) was performed using HiSeq2000 sequencing instruments.The files are in FASTQ format.

  Dataset EGAD00001004411

• Whole exome sequencing data for Molecular Characterization of ETMRs

  This dataset contains exome sequencing data from 21 samples. Sequencing of samples using whole-exome sequencing was per- formed by creating libraries using the IlluminaTruSeq exome enrich- ment kit following the manufacturer’s instructions after size selection. Size selection was performed by fractionation using a Covaris ultra- sonicator and subsequent selection was performed using a 1.5% gel Pippin Prep cassette (Sage Science). One lane per sample has been sequenced resulting in 42 Fastq files (paired end).

  Dataset EGAD00001006210

• Multiple myeloma follow-up Dataset

  77 samples collected from 35 multiple myeloma patients. Each patient provided one healthy sample and one primary tumor sample and, in some cases, also samples collected after the progression of the disease.

  Dataset EGAD00001010161

• RNA-seq TPMs quantification for baseline tumor samples originating from IMpower150, and relevant clinical metadata

  This dataset includes full tumor transcriptomes from 558 advanced NSCLC tumors. These data originate from pre-treatment samples from a clinical trial for first-line non-small cell lung cancer (IMpower150). The patients in this trial were treated with the PD-L1 inhibitor atezolizumab +bevacizumab + chemotherapy or bevacizumab + chemotherapy or atezolizumab + chemotherapy.

  Dataset EGAD50000001814

• Bulk and Single-Nuclei RNA-seq with ATAC-seq of Breast Tumors Pre- and Post-Palbo ciclib/Endocrine Therapy

  This dataset comprises bulk and single-nuclei multiomic profiles from patients with ER+/HER2- early breast cancer enrolled in the NeoRHEA phase 2 trial. The bulk RNA-seq component includes 78 pre-treatment and 49 post-treatment tumor samples from 97 patients. The single-nuclei component includes matched pre- and post-treatment samples from 37 patients, totaling 63 samples analyzed by simultaneous snRNA-seq and snATAC-seq. Combined, the data contains bulk transcriptional profiles and single-nuclei gene expression/chromatin accessibility matrices for over 226,000 high-quality nuclei, encompassing tumor, immune, and stromal cells. Technologies used include Illumina NovaSeq 6000 for sequencing and the 10x Genomics Chromium platform (Multiome kit for single-nuclei, standard RNA library prep for bulk).

  Dataset EGAD50000002038

• GWAS on covid-19 severity and susceptibility in the province of Bergamo, Italy

  This is a case-control GWAS that involved the voluntary recruitment of inhabitants of the Bergamo province via an online questionnaire. We collected detailed clinical data and verified all information through personal interviews. Cases (severe COVID-19; G1) and controls (mild or asymptomatic COVID-19, G2; non-infected, G3) were matched by age, sex and risk factors

  Study EGAS00001007310

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma samples (99 FFPE tumor tissue derived DNA and 9 circulating tumor DNA) and corresponding germline DNA of 38 controls. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dac EGAC50000000261

• Genetic subtyping by Whole Exome Sequencing across Diffuse Large B Cell Lymphoma and Plasmablastic Lymphoma.

  Whole exome sequencing was performed from 108 Diffuse Large B Cell Lymphoma cases. A library containing whole exome regions was used to isolate the DNA for sequencing (SureSelect XT Human All Exon V6 (Agilent technologies)). Sequencing on a NovaSeq 6000 instrument (Illumina, paired end, 2x100, mean 566Gb per FlowCell) was performed.

  Dataset EGAD50000000546

• Next generation sequencing data of circulating tumor DNA and matched tumor tissues

  For each subject, genomic DNA from whole blood, circulating cell free DNA and tumor tissues (whenever possible) were performed targeting next generation sequencing on Illumina Miseq or Hiseq 4000 platforms. The sequencing results of whole blood were used to distinguish germline and somatic mutations. Specimens were collected from patients with different kinds of solid tumors, but most are lung cancer patients.

  Dataset EGAD00001003176

• Genomic Profiling of Advanced Pancreatic Cancer to inform therapy - RNA-Seq unmapped reads

  Genomics-Driven Precision Medicine for Advanced Pancreatic Cancer - Early Results from the COMPASS Trial - RNA-Seq unmapped reads

  Dataset EGAD00001003582

• Balanced Ependymoma

  We propose to definitively characterise the somatic genetics of a number of pediatric malignant tumours including ependymoma, high grade glioma and central nervous system primitive neurectodermal tumours through generation of comprehensive catalogues of somatic mutations by high coverage genome sequencing.

  Dataset EGAD00001000350

• Transcriptomic sequences of small intestinal Plasma cells from Celiac disease patients

  Transcriptomic sequences of small intestinal Plasma cell (PCs)s from Celiac disease patients. RNAseq data produced using Illumina paired-end (75bp) reads. Includes only raw data of sequences (fastq format). Samples from seven Celiac disease patients and four healthy controls. Samples from Celiac disease patients contain sub-groups of PCs that are either specific or not specific to autoantigen of the disease (TG2).

  Dataset EGAD00001004481

• Benchmarking CRISPR Whole-genome Drop-out Screen - B&S (2019-08-07)

  This study is a benchmarking exercise to explore potential source of variation between different CRISPR drop out libraries. . This dataset contains all the data available for this study on 2019-08-07.

  Dataset EGAD00001005233

• Whole exome sequencing of advanced gastric cancer

  To define the cellular characteristics of malignant ascites of advanced gastric cancer patients and search for therapeutic strategies, we obtained 5 malignant ascites and 1 cerebrospinal fluid from five patients with gastric cancer. We analyzed single-cell RNA-seq data of 180 cells from 4 malignant ascites and 1 cerebrospinal fluid metastasis using Fluidigm® C1™ System. Whole exome sequencing data was also generated from blood or tumor tissue.

  Dataset EGAD00001005740

• Single-nucleus Isoforms of Down Syndrome Brains (long-read)

  16 DS and Control brains samples were prepared using the 10X Genomics Single Cell 3' v3 kit. Pre-fragmented cDNA libraries were loaded onto a Pacific Biosciences Sequel II to sequence single-nucleus isoforms.

  Dataset EGAD00001008286

• BCG Molecular Subtyping

  Dataset for the paper: Non-muscle Invasive Bladder Cancer Molecular Subtypes Predict Differential Response to Intravesical Bacillus Calmette-Guérin

  Dataset EGAD00001010065

• Genomic and transcriptomic analysis of thymic epithelial tumors

  Thymic epithelial tumors (TETs), comprising various histologic types of thymomas and thymic carcinomas, originate from thymic epithelial cells. Each histologic type is typically associated with a distinct immune cell composition and clinical manifestation. A better understanding of the cellular origins and molecular pathways underlying this heterogeneity is needed to improve patient stratification and treatment. Here, we conducted an integrated genomic and transcriptomic analysis of 124 thymomas and 13 thymic carcinomas, including 20 newly sequenced cases combined with 117 cases from publicly available datasets. This approach stratified TETs into three subgroups with different possible origins: GTF2I-mutant (GTF2I-type) thymomas, copy number-altered (CN-type) thymomas, and thymic carcinomas.

  Study EGAS00001004227

• HOVON152 Trial shallow Whole Genome Sequencing

  Associated with Molecular profiling of HGBCL-DH-BCL2 patients treated in the HOVON-152 triaL. Targeted sequencing of 30 samples from 30 High-grade B-cell lymphoma patients. Targeted sequencing was used for identify genomic alterations associated with patient outcome.

  Dataset EGAD50000002094

• The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dataset EGAD50000001178

• GO29781 sequencing data

  Whole Exome Sequencing of baseline tumor and matched normal samples from patients in the GO29781 mosunetuzumab monotherapy trial.

  Dataset EGAD50000000214

• Small RNA sequencing of human oocytes and early embryos

  This dataset contains single-end fastq files for human oocytes (n=12), zygotes (n=5), and early embryos (n=10) sequenced with Illumina NextSeq500. The sequencing libraries were prepared from single oocytes, zygotes, and embryos in two batches.

  Dataset EGAD50000000227

• Comparison of the single-cell and single-nucleus hepatic myeloid landscape within decompensated cirrhosis patients

  In-patient comparison of single-cell RNA-sequencing (scRNA-seq) and single-nucleus (snRNA-seq) technologies and accompanying tissue processing protocols on transjugular liver biopsy from decompensated cirrhosis patients (n = 3).

  Dataset EGAD50000000105

• FASTQ files studied in Evaluation of the Efficacy and Safety of a Clinical Grade Human Induced Pluripotent Stem Cell-Derived Cardiomyocyte Patch: A Pre-Clinical Study

  This data set contains 16 paired fastq files (WGS) and 4 paired fastq files (WES).

  Dataset EGAD50000000274

• TB-DAR Genotyping Study

  Active TB patients (sputum smear-positive and GeneXpert-positive) recruited at the Temeke District Hospital in Dar es Salaam, Tanzania, as part of a prospective study that ran between November 2013 and June 2022.

  Dataset EGAD00010002507

• whole genome sequencing data of genomic heterogeneity of multiple synchronous lung cancer.

  Fastq data of genomics heterogeneity of multiple synchronous lung cancer. Whole-genome sequencing (WGS) were performed in 3 tumour samples, one regional lymph node metastasis sample and peripheral blood sample from the same patient with MSLCs.

  Dataset EGAD00001003458

• Cancer-Normal chronic myeloid leukaemia sequencing data for "A comparative analysis of algorithms for somatic SNV detection in cancer", Bioinformatics 29 (2013) 2223

  This dataset contains the fastq sequencing data collected from bone marrow DNA of a chronic myeloid leukaemia patient at time of diagnosis.

  Dataset EGAD00001000967

• Data set for pan.met study

  The dataset referenced by EGA Study ID EGAS00001004208 includes 20 human exome sequencing data and 11 human RNA sequencing data from tumor or normal tissues. Each sequencing data includes two pair-end short read files in fastq format.

  Dataset EGAD00001005957

• HEMa_LP

  This dataset contain WGBS sequencing result of HEMa_LP. The cells were cultured in Medium 254 supplemented with PMA-Free Human Melanocyte Growth Supplement-2 (HMGS-2) under 37°C,5% CO2.

  Dataset EGAD00001005486

• Analysis File for 87 Argentinean individuals

  VCF for 87 Argentinean samples. Only SNPs (no indels) that passed the Affymetrix QC. Data from Luisi et al. 2020. Plos One. Fine-Scale Genomic Analyses Of Admixed Individuals Reveal Unrecognized Genetic Ancestry Components In Argentina. Reference Allele column does NOT contain reference allele from genome assembly.

  Dataset EGAD00001006227

• Whole-genome-seqeuncing IMFT

  Whole-genome sequencing of IMFT tumor samples from 24 participants in the clinical phase II trial EORTC 90101 “CREATE” (CREATE IMFT cohort)

  Dataset EGAD00001007804

• PELICAN45 RNAseq Dataset

  RNAseq in cryostat-microdissected metastatic and primary prostate cancer tissues and matched noncancerous tissues from the same study subjects.

  Dataset EGAD00001009997

• Extensive patient-to-patient single nuclei transcriptome heterogeneity in pheochromocytomas and paragangliomas

  Pheochromocytomas (PC) and paragangliomas (PG) are rare neuroendocrine tumors of varied genetic makeup, associated with high cardiovascular morbidity and a variable risk of malignancy. We focused on PCPG tumors with germline SDHB and RET mutations, representing distinct prognostic groups with worse or better prognoses, respectively. We applied single-nuclei RNA sequencing (snRNA-seq) on tissue samples from 11 patients.

  Study EGAS00001006230

• Comparative transcriptomics reveal molecular convergence and divergence in parkinsonian disorders

  Elucidate the biological convergence and divergence across the parkinsonian spectrum. The study contains data processed at two different sites as well as Alzheimer's disease as an non-parkinsonian control. Specifically, Parkinson's disease (PD, N=448), dementia with Lewy bodies (DLB, N=80), multiple system atrophy (MSA, N=35), progressive supranuclear palsy (PSP, n=42), corticobasal degeneration (CBD, n=17), Alzheimer's disease (AD, N=72) and neurologically healthy controls (N=283). RNA-seq was carried out using ribosomal depletion.

  Study EGAS50000001815

• Targeted Sequencing of 173 genes

  Targeted sequencing of 173 genes in 2433 primary breast tumours. Data includes 2433 tumour samples, 523 adjacent normal (breast) samples and 127 blood samples. Libraries were prepared with Illumina's Nextera custom enrichment kit targetting all the exons of the most frequently mutated breast cancer genes. Libraries were multiplexed (48 libraries per lane) and sequenced on Illumina HiSeq 2000 (100bp paired-end reads). Somatic mutations were calling with a custom pipeline. We identified 40 mutation-driver (Mut-driver) genes, and determined associations between mutations, driver CNA profiles, clinical-pathological parameters and survival. We assessed the clonal states of Mut-driver mutations, and estimated levels of intra-tumour heterogeneity using mutant-allele fractions. The results emphasize the importance of genome-based stratification of breast cancer, and have important implications for designing therapeutic strategies. Referece: Pereira et al. (2016) The somatic mutation profiles of 2,433 breast cancers refines their genomic and transcriptomic landscapes. Nature Communications

  Dataset EGAD00001002115

• Germline variants in patients with rare cancers - control samples WGS and WES

  The control samples (mostly blood) of 351 samples (paired WGS and WES sequencing) are in this dataset. The WGS was in nearly all cases at an Illumina HighSeq X Ten with the Illumina TruSeq Nano DNA Kit. The WES mostly on Illumina HighSeq 4000 with the Agilent SureSelect V5 plus UTRs Kit.

  Dataset EGAD00001010047