21147 results for "Buy fc 26 coins Buyfc26coins.com is EA Sports official for FC 26 coins The process was smooth and quick..ivNx"

in 354.98 milliseconds.

• BASIS RNA Sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001341

• Recurrent somatic JAK-STAT mutations within a RUNX1-mutated pedigree

  Whole-exome sequencing of a RUNX1-mutated pedigree, including samples from mother, father and four offsprings. Recurrent somatic JAK-STAT mutations were found among the diseased individuals.

  Dataset EGAD00001002240

• Somatic genetic basis of Wilms' tumour

  We investigated the somatic genetic basis of Wilms' tumour and found complex phylogenetic relations between tumours

  Dataset EGAD00001005135

• Targeted sequencing of patients with neurodegenerative diseases

  A targeted gene panel that covers coding, noncoding, and short tandem repeat regions improves the diagnosis of patients with neurodegenerative diseases

  Dataset EGAD00001005114

• Genome-wide identification of distinct miRNA-mRNA target regulation pairs in Non-Hodgkin lymphomas: a report from the ICGC MMML-Seq consortium

  We obtained miRNA profiles by miRnome sequencing from ICGC MMML-Seq patients diagnosed with Burkitt lymphoma, diffuse large B-cell lymphoma and follicular lymphoma and provide evidence of subtype-specific miRNA expression differences. We describe differentially expressed, mutated, edited and not previously annotated miRNAs. Addditionally, by performing argonaute-2 photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation (PAR-CLIP) experiments, we obtained a set of biochemically-validated miRNA binding sites and identified miRNA-mRNA interaction pairs with a negative correlation in patient RNASeq data.

  Study EGAS00001001394

• WTCCC case-control study for Breast cancer - Combined Controls

  WTCCC genome-wide case-control association study for Breast cancer (BC) - Combined Controls.

  Study EGAS00000000025

• cfDNA dataset with expanded panel for cfDNA cohort

  Cell free DNA sequencing data for 9 samples with expanded panel across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000667

• PPGL RNA-Seq dataset 2

  Dataset includes fastq files for RNA-Seq experiments for tumor samples of PPGL patients. Single end reads fastq files are available for 81 different samples

  Dataset EGAD50000000019

• Phenotype, genotype, and transcriptome data from three South Eastern Bantu groups in the SABR study

  Phenotypic data, whole genome sequencing, blood RNA-seq, imputed variant calls, cell type estimates, gene expression levels, splicing measurements, and analysis covariates from South African Blood Regulatory (SABR) resource participants, which includes South Eastern Bantu-speaking groups.

  Dataset EGAD50000001477

• Whole genome sequencing data of tumor/normal pairs from 20 patients with hepatoblastoma

  This dataset provides whole genome sequencing data of tumor/normal pairs from 20 patients with hepatoblastoma using the illumina Novaseq sequencing system. It includes 40 samples (20 normals and 20 hepatoblastoma tumors). Our comprehensive analysis identified somatic mutations, structural variations, copy number variations and non-coding variants in hepatoblastoma.

  Dataset EGAD00001003914

• cfDNA dataset with whole genome sequencing for cfDNA cohort

  Cell free DNA sequencing data for 13samples with whole genome sequencing across multiple cancer types for cfDNA cohort

  Dataset EGAD50000000666

• RNASeq files for Klco PanAML data

  RNASeq files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011294

• WGS files for Klco PanAML data

  WGS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011295

• WXS files for Klco PanAML data

  WXS files for paper titled "Proposal of a new genomic framework for categorization of pediatric acute myeloid leukemia associated with prognosis"

  Dataset EGAD00001011296

• Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic adenocarcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004708

• Genome and transcriptome sequence data from a adenocarcinoma of the liver patient

  Genome and transcriptome sequence data from a adenocarcinoma of the liver patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001004706

• Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the esophagus patient

  Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the esophagus patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001005835

• Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the lung patient

  Genome and transcriptome sequence data from a metastatic squamous cell carcinoma of the lung patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001005850

• Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Re-aligned BAM files for manuscript titled Discrepancies in Tumour Mutation Burden (TMB) reporting from sequential Endobronchial ultrasound trans bronchial needle aspiration (EBUS TBNA) samples within single lymph node stations for Copy Number Variant Calling.

  Dataset EGAD00001012638

• Identifying the Genetic Basis of Variably Protease-Sensitive Prionopathy (VPSPr)

  Design: Sequencing of cases onlyMolecular technologies: Exome sequencing and custom targeted sequencing of PRNPAims: Identify modestly penetrant, high odds ratio variants conferring risk of variably protease-sensitive prionopathy (VPSPr)Population: n=67 autopsy-confirmed VPSPr cases, United States, 1997-2021Principal findings: Association to PRNP M129V replicated, no other causal variants identifiedData available: Raw sequencing data and metadata

  Study phs004012

• PBMC scRNA-seq data using 10X Genomics platform

  Matrices of counts from single-cell RNA-seq data and single-cell CITE-seq data collected from 16 patients enrolled in GO30103 trial, and the cell level annotation. Specifically, PBMCs at C1D1, C1D15 (2 weeks after treatment), C2D1 (3 weeks after treatment) and C4D1 (9 weeks after treatment) were collected and subject to 10x Genomics protocol. Associated metadata also included.

  Dataset EGAD50000000370

• Gene Fusion Discovery through RNA Sequencing of Human Glioblastoma Stem Cell Lines

  We used massively parallel, paired-end sequencing of expressed transcripts (RNA-seq) to detect novel gene fusions in short-term cultures of glioma stem-like cells freshly isolated from nine patients carrying primary glioblastoma multiforme (GBM). The culture of primary GBM tumors under serum-free conditions selects cells that retain phenotypes and genotypes closely mirroring primary tumor profiles as compared to serum-cultured glioma cell lines that have largely lost their developmental identities.

  Study phs000505

• Transcriptome Sequencing of Cancer Cell Lines

  In this study we will sequence the transcriptome of Verified Cancer Cell lines. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000359

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - patient metadata files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - patient metadata files (Mutographs)

  Dataset EGAD00001015387

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - structural variation vcf files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - structural variation vcf files (Mutographs)

  Dataset EGAD00001015389

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - copy number variants (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - copy number variants (Mutographs)

  Dataset EGAD00001015390

• The complexity of tobacco smoke induced mutagenesis in head and neck cancer - filtered vcf files (Mutographs)

  The complexity of tobacco smoke induced mutagenesis in head and neck cancer - filtered vcf files (Mutographs)

  Dataset EGAD00001015388

• Myeloproliferative Neoplasms (MPN) Targeted Gene Screen

  Pulldown experiments will be performed on a number of patients with Myeloproliferative Neoplasms (MPN). The pulldown will be a bespoke design targeting known mutations, this pulldown will be sequenced and analysed to inform prevalence of mutations and to inform to the possibility of use as a diagnostic tool.

  Dataset EGAD00001000652

• Matched Pair Cell Line Tumour RNAseq

  In this study we will sequence the transcriptome of Verified Matched Pair Cancer Cell line tumour samples. This will be married up to whole exome and whole genome sequencing data to establish a full catalog of the variations and mutations found.

  Dataset EGAD00001000630

• De novo metastatic prostate cancer cohort

  Fastq files from RNA sequencing of normal and tumor samples from 16 patients from the de novo metastatic prostate cancer cohort.

  Dataset EGAD50000002381

• AVENIO mutation analysis

  Mutation analysis in cfDNA from plasma and urine (stored under different storage conditions) from CRC patients using the AVENIO Expanded Kit

  Dataset EGAD50000001588

• Enzymatic methylation sequencing of intestinal metaplasia

  We perform genome-wide EM-seq of 14 patients with concurrent matched normal, dysplasia and early gastric samples from South Korea. The dataset contains cram files from 38 samples.

  Dataset EGAD50000001538

• Single cell transcriptomes from vascularized human retinal organoids

  Both control and vascularized organoids were processed using the 10x Chromium 3' RNA method. Sequencing reads were aligned with STARsolo.

  Dataset EGAD50000001216

• Tanzania dietary intervention study 2019-2020

  We performed a dietary intervention study comparing western diet, traditional diet and the supplementation of fermented banana beverage in a cohort of 66 individuals (22 in each study arm).

  Dataset EGAD50000000457

• H3K27me3 Cut&Tag on beta cells

  H3K27me3 Cut&Tag datasets in human pancreatic islets and the EndoC-bH1 cell line

  Dataset EGAD50000000463

• H3Africa SIREN GWAS Stroke

  3421 Samples from Nigeria and Ghana, genotyped with the Illumina NestSeq 500

  Dataset EGAD00010002551

• RNA sequencing

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001000285

• Long-read sequence data from two carriers of a predisposing structural variant

  This dataset contains PacBio long-read sequence data from two individuals with a chr9p.21 structural variant and two controls. Sequences were aligned againt the human reference genome HG38.

  Dataset EGAD50000002155

• Epigenetic subtypes of neuroblastoma - RNAseq

  In the absence of recurrent gene mutations, evidence accumulates that epigenetic deregulation plays a prominent role in neuroblastoma biology. Here we provide RNAseq profiles in 71 primary and relapse neuroblastoma samples.

  Dataset EGAD00001006286

• Whole genome sequencing of the healthy breast

  Whole genome sequencing of 29 donors of healthy mammary tissue. BAM files of stromal and epithelial DNA are included.

  Dataset EGAD00001006402

• RNA-seq

  Bulk RNA-seq data of 8 RNA samples were generated. Libraries were prepared using the Stranded mRNA Library Prep, Ligation Kit (Illumina) following manufacturer’s recommendations and sequenced on a NextSeq 2000 (2x50 bp, Illumina).

  Dataset EGAD00001010308

• BASIS RNAseq

  We propose to definitively characterise the somatic genetics of ER+ve, HER2-ve breast cancer through generation of comprehensive catalogues of somatic mutations in 500 cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001264

• Xenograft BC WGS Dataset

  We propose to definitively characterise the somatic genetics of breast cancer through generation of comprehensive catalogues of somatic mutations in breast cancer cases by high coverage genome sequencing coupled with integrated transcriptomic and methylation analyses.

  Dataset EGAD00001001336

• Copy number profiling using PlasmaSeq

  In order to establish copy number profiles from the various samples we prepared libraries and subjected them to whole-genome sequencing at a shallow sequencing depth (0.1x)

  Dataset EGAD00001000761

• Human normal brain bulk RNA-seq

  We profiled 43 normal human adult brain and 11 normal human fetal brain specimens by bulk RNA-seq. The raw fastqs are provided.

  Dataset EGAD00001005130

• Molecular Profiles of BRCA1-Associated Ovarian Cancer Treated by Platinum-Based Therapy

  Whole-exome sequencing data from Illumina NextSeq 500. It consists of 88 paired-end FASTQ files from 44 primary, residual, relapsed tumors and normal samples from the blood.

  Dataset EGAD00001005470

• WTCCC case-control study for Ankylosing Spondylitis - Combined Controls

  WTCCC genome-wide case-control association study for Ankylosing Spondylitis (AS) - Combined Controls.

  Study EGAS00000000019

• WTCCC case-control study for Autoimmune Thyroid Disease - Combined Controls

  WTCCC genome-wide case-control association study for Autoimmune Thyroid Disease (ATD) - Combined Controls.

  Study EGAS00000000021

• Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Whole Genome Sequencing Reveals Potential Therapeutic Strategy for Monomorphic Epitheliotropic Intestinal T-cell Lymphoma

  Study EGAS00001003876

• RNASeq files for Stewart-MATCH

  RNASeq files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015475

• WXS files for MATCH paper

  WXS files for paper titled "Preclinical Pediatric Molecular Analysis for Therapy Choice (MATCH)"

  Dataset EGAD00001015484

• Clonal fitness inferred from timeseries modeling of single cell cancer genomes

  Progress in defining genomic fitness landscapes in cancer by copy number alterations (CNA) has been impeded by lack of single cell and timeseries sampling. We generated 42,000 single cell whole genomes (scWGS) from breast epithelium and primary triple negative breast cancer (TNBC) patient-derived xenografts (PDX) collected during multi-year time series. Using a Wright-Fisher population genetics model, we inferred reproducible CNA-defined clonal fitness dynamics induced by TP53 mutation and cisplatin chemotherapy, with accurate forecasting of experimentally enforced clonal competition dynamics. Drug treatment in three long-term serially passaged TNBC PDX resulted in cisplatin resistant clones that had shown low fitness in the untreated setting. By contrast high fitness clones from treatment naive controls were eradicated reflecting an inversion of the fitness landscape. Upon drug release selective pressure dynamics were reversed indicating a fitness cost of treatment resistance. Taken together, our findings reveal clonal fitness dynamics linked to CNA and therapeutic resistance in polyclonal tumours.

  Study EGAS00001004448

• DOGMA-seq data and analysis

  Data and analysis of DOGMA-seq assay of Lin- sorted live cells from bone marrow tissue of 12 patients with MDS or AML (before treatment with 5-azacytidine). Data files are paired-end reads in FASTQ format from the Illumina NovaSeq 6000 sequencer. Analysis files are outputs from Cellranger ARC: .h5 peaks and genes matrix file, atac_fragments.tsv.gz file and its index. Samples with ADT assay have analysis files from kallisto, bustools, and kite: ADT_features.txt, ADT_barcodes.txt, ADT_matrix.mtx.

  Dataset EGAD50000001377

• DAC for Melanoma Exome Dataset for Identification of Mutated Epitopes

  Dac EGAC00001000546

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002208

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002844

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003086

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001003058

• Exome and RNA sequencing data from 32 ocular and extraocular sebaceous carcinomas

  Sebaceous carcinomas (SeC) are cutaneous malignancies that, in rare cases, metastasize and prove fatal. Here we report whole exome sequencing on 32 SeC, revealing distinct mutational classes that explain both cancer ontogeny and clinical course. A UV-damage signature predominated 10/32 samples, while 9 were instead defined by microsatellite instability (MSI) mutations. UV-damage SeC exhibited poorly differentiated, infiltrative histopathologycompared to MSI signature SeC (p = 0.003), features previously associated with dissemination. Strikingly, UV-damage SeC transcriptomes and anatomic distributionclosely resembling those of cutaneous squamous cell carcinomas (SCC), implicating sun-exposed keratinocytes as a cell of origin. Like SCC, this UV-damage subclass harbors a high somatic mutation burden with >50 mutations/Mb, predicting immunotherapeutic response. In contrast, ocular SeC acquire far fewer mutations without a dominant signature, but show frequent truncating mutations in the ZNF750 epidermal differentiation regulator. Our data exemplify how different mutational processes convergently drive histopathologically related but clinically distinct cancers.

  Study EGAS00001002869

• Whole genome sequencing

  This dataset contains whole genome sequencing data from 22 samples of FACS-purified bone marrow CD34+ haematopoietic stem and progenitor cells and matched hair follicle controls collected from individuals undergoing hip replacement surgery. Additionally, it contains whole genome sequencing data from unseparated bone marrow mononuclear cells, CD3-CD34- bone marrow mononuclear cells, and peripheral blood granulocytes of the same 14 samples. Haematopoietic samples were sequenced to a target coverage of 90-120x; 19 of them were re-sequenced to a total target coverage of 270x. Hair follicle controls were sequenced to a target coverage of 30x.

  Dataset EGAD00001015178

• Patient-Parent trio sequencing for 100 sporadic ID patients

  Single end short-read (50 bp) SOLiD 4 sequencing data for 300 individuals, constituting 100 patient-parent trios. For more details please read; http://www.nejm.org/doi/full/10.1056/NEJMoa1206524

  Dataset EGAD00001000680

• Helmholtz Centre for Infection Research, Centre for Individualised Medicine

  Dac EGAC00001002303

• DAC for Sarcopenia HNSCC

  Data access committee for Sarcopenia HNSCC study

  Dac EGAC50000000420

• Djerroudi et al., E-cadherin inactivation shapes tumor microenvironment specificities in invasive lobular carcinoma

  Invasive lobular breast carcinoma (ILC) shows specific stromal features, T lymphocyte infiltration (TIL) being associated with poor prognosis. Here, we reveal the involved mechanism by performing single cell RNA sequencing, combined immunohistochemistry, deconvolution of bulk RNA sequencing from large retrospective ILC series, and functional assays using primary cells. We show that ILC accumulate FAP+ inflammatory cancer-associated fibroblasts (iCAF) through a previously undescribed mechanism mediated by E-cadherin/CDH1 on CAF plasticity. Indeed, CDH1 inactivation in ILC cancer cells prevents differentiation of iCAF into myofibroblastic CAF (myCAF), leading to iCAF accumulation. In turn, iCAF increase TIL infiltration and shape their spatial organization in ILC. Subsequently, CDH1-inactivated ILC cancer cells promote immune escape by lack of retention and activation of ITGAE-expressing resident memory CD8+ T lymphocytes (TRM). Hence, our study uncovers reciprocal interactions between CDH1-inactivated cancer cells, iCAF and CD8+ TRM, revealing why and how TILs have a poor prognosis in ILC patients, a mechanism extrapolated to other CDH1-mutated cancer types.

  Study EGAS50000000761

• The effects of bioinformatics preprocessing on cell-free DNA analysis

  The dataset contain 20 lung cancer and 20 healthy control cfDNA samples from plasma sequenced using 150bp PE sequencing.

  Dataset EGAD50000000213

• Childhood cerebellar tumors mirror conserved fetal transcriptional programs

  We used single-cell transcriptomics to study >60,000 cells from the developing murine cerebellum, and show that different molecular subgroups of childhood cerebellar tumors mirror the transcription of cells from distinct, temporally restricted cerebellar lineages.

  Dataset EGAD00001004318

• A compendium of mutational signatures due to environmental exposures

  Analysis of mutational signatures caused by exposure to known mutagens in human induced pluripotent stem (iPS) cells. A reference human iPS cell-line will be exposed to 100 chemicals known or proposed to be mutagenic. Following exposure to mutagen, cells will undergo a period of recovery before sub clones are generated and sequenced. The progenitor "parental" IPS cell-line will be used to generate reference sequence data, in order to determine the mutational signatures acquired as a result of exposure to different mutagens.

  Dataset EGAD00001005351

• Transcriptome analysis of human muscle/myofibers carrying the human nemaline myopathy type 6-associated KBTBD13-R408C variant.

  This dataset contains mRNA-seq results from eleven samples from human donors, each sample being composed of 5-10 rebulked fiber type-specific myofibers. This sample set includes; 1) Three FT-I and three FT-IIa rebulked samples from control individuals 2) Three FT-I and two FT-IIa rebulked samples from NEM6 patients with a KBTBD13R408C variant (NP_001094832.1: p.Arg408Cys)

  Dataset EGAD50000002408

• Sequencing data from the study "Somatic rearrangements causing oncogenic ectodomain deletions of FGFR1 in squamous cell lung cancer"

  This dataset consists of 71 whole-genome samples and 47 RNA-seq samples. All WGS samples are provided in .bam format and RNA-seq samples are provided as .fq.gz (paired-end). Next-generation sequencing data on whole genomes were processed by aligning sequencing reads to a reference genome (NCBI build 37/hg19) using bwa-mem (0.7.13-r1126).

  Dataset EGAD50000001978

• Human Single-Oocyte Transcriptome - Control and Cannabis Treated

  RNAseq data of human single oocytes exposed to THC and its metabolites, (mean concentration measured in the follicular fluid, THC1, n=95, 25 ng/mL Δ9-THC, 5 ng/mL 11-OH-THC, 50 ng/mL 11-COOH-THC) or a supraphysiologic, THC2, n=93, 100 ng/mL Δ9-THC, 50 ng/mL 11-OH-THC, 200 ng/mL 11-COOH-THC).

  Dataset EGAD50000001534

• RNA-seq dataset

  RNA-seq data from CD20+ sorted cells obtained from peripheral blood and lymph node Follicular Lymphoma patients. These samples were unstimulated after thawing and additionally, peripheral blood samples were stimulated during 7 days in culture as described in Dobaño-López C et al. Stranded RNA-seq libraries were performed using the TruSeq library kit (Illumina, San Diego, CA, USA). Libraries were sequenced on a NextSeq 2000 (Illumina) in a 2x50bp length.

  Dataset EGAD50000000347

• Stage-specific gene and transcript dynamics in human male germ cells

  To study global transcriptional dynamics during human spermatogenesis we sequenced total RNA of human testicular biopsies with 5 specific histological phenotypes: Sertoli cell-only (SCO, n=3), spermatogenic arrests at the spermatogonial (SPG, n=4), spermatocyte (SPC, n=3), and spermatid (SPD, n=3) level, as well as normal spermatogenesis (Normal, n=3).

  Dataset EGAD00001008652

• Single-cell whole-genome sequencing of matched primary GBM tumours and patient-derived organoids

  Single-cell whole-genome sequencing of primary GBM tumours and matched patient-derived organoids. Obtained using the 10X Genomics single-cell CNV solution. Samples from two spatially distinct regions of five tumours from three patients (three primary, two recurrent).

  Dataset EGAD00001007937

• Genome and transcriptome sequence data from an unspecified tissue chordoma patient

  Genome and transcriptome sequence data from an unspecified tissue chordoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001008013

• Whole Genome Sequencing of Head and Neck Angiosarcoma

  This dataset contains 55 Whole Genome Sequencing of the study titled Spatial transcriptomics reveal topological immune landscapes of Asian head and neck angiosarcoma.

  Dataset EGAD00001010140

• Prostate cancer m6A epitranscriptome

  Using meRIP-sequencing, we profiled N-6 methyladenosine (m6A) in a cohort of 148 primary prostate cancer samples as part of the Canadian Prostate Cancer Genome Network project (CPC-GENE). Paired-end sequencing of 150 bp reads were mapped to GRCh38.p13 using annotations from gencode.v34.chr_patch_hapl_scaff.annotation.gtf. Peaks were called using MeTPeak, joint peaks were identified and IP reads were quantitated, normalized and adjusted using Input reads to obtain estimates of m6A abundance.

  Dataset EGAD00001009869

• Genome and transcriptome sequence data from a breast cancer patient

  Genome and transcriptome sequence data from a breast cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010315

• Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient

  Genome and transcriptome sequence data from a pancreatic adenocarcinoma patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001010318

• ATAC-seq and RNA-seq datasets of CD14+ monocytes from healthy donors

  This dataset consists of functional genomic data from 6 healthy donors taken from CD14+ monocytes upon different immune stimulations. It contains 150 paired end fastq files consisting of 30 total RNA-seq samples across 4 runs and 30 ATAC-seq samples. The samples were sequenced on Illumina HiSeq4000 platform.

  Dataset EGAD00001011113

• Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient

  Genome and transcriptome sequence data from a malignant peripheral nerve sheath tumor patient,generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001015583

• Single-cell analysis of matched FFPE and frozen tissue samples reveals comparable resolution of intratumoural heterogeneity

  Testing the differences between FFPE and fresh frozen derived single cell results.

  Dataset EGAD00001015781

• Genome and transcriptome sequence data from a pancreatic cancer patient

  Genome and transcriptome sequence data from a pancreatic cancer patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001005762

• Genome and transcriptome sequence data from a metastatic pancreatic neuroendocrine patient

  Genome and transcriptome sequence data from a metastatic pancreatic neuroendocrine patient, generated as part of the BC Cancer Agency's Personalized OncoGenomics (POG) study

  Dataset EGAD00001005763

• DAC for study Screening for abnormal CGI methylation in primary colorectal tumours

  Dac EGAC00001000069

• Data Access Committee for German Consortium for Translational Cancer Research (DKTK)

  Dac EGAC00001000217

• Data Access Committee for COLO829 Somatic reference standard for cancer genome sequencing

  Dac EGAC00001000408

• ATACseq

  ATACseq data for this study.

  Study EGAS00001007166

• SNParray

  SNP array study for UTUC

  Study EGAS00001004979

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• Exome - Uveal Melanomas MPI

  Whole exome sequencing on 4 uveal melanoma samples and corresponding germline samples. Libraries were prepared using the Nextera Rapid Capture Expanded Exome kit. Paired-end libraries (2 x 75 bp) were sequenced on HiSeq 4000 instrument (Illumina).

  Dataset EGAD50000001137

• DAC-2023-07-05-Ritz (DAC-007)

  Full description of the dataset and all necessary information on metadata may be found under (https://zenodo.org/records/11237107): DAC-2023-07-05-Ritz (DAC-007), raw data in EGA, metadata in Zenodo (https://zenodo.org/records/11237107)

  Dataset EGAD50000001147

• Whole Genome - Uveal Melanoma

  Whole genome sequencing on 1 uveal melanoma and corresponding germline sample. Libraries were prepared using the Kapa HyperPrep kit (Roche, 07962363001). Paired-end libraries (2 x 150 bp) were sequenced on a NovaSeq 6000 instrument (Illumina).

  Dataset EGAD50000000764

• Nanopore sequencing of filaggrin in 22 patients

  This dataset contains data from nanopore amplicon sequencing of FLG exon 3 in 22 patients and Nanopore adaptive sampling sequencing of the EDC region in two patients.

  Dataset EGAD50000000236

• Transcriptomic profiling of prostate cancer metastasis xenograft models

  RNA-seq profiling of 2 prostate cancer xenograft mouse models, each at the intact state (n=3), castrated state (n=4) and castrated + AR replacement (n=3).

  Dataset EGAD00001006551

• m6A profiling in Lung Adenocarcinoma

  Applying a refined m6A RNA immunoprecipitation method, we profiled the m6A epitranscriptome on 10 non-neoplastic lung (NL) tissues and 53 lung adenocarcinoma tumors.

  Dataset EGAD00001008026

• CASCADE tumour transcriptome data

  RNA-Seq data from 20 fresh-frozen postmortem samples from three patients who participated in the CASCADE rapid autopsy program and died of metastatic castration resistant prostate cancer.

  Dataset EGAD00001009492

• Mechanism of action and resistance to Trastuzumab Deruxtecan in patients with metastatic breast cancer: the DAISY trial

  198 exome sequencing samples

  Dataset EGAD00001009853

• 200PT : SNV vcf files

  200PT : SNV vcf files. SNV calls generated using SomaticSniper and PhyloWGS, from the CPCGene 200PT Subclonality study

  Dataset EGAD00001004072

• Comprehensive genetic analysis of chronic active Epstein-Barr virus infection

  Comprehensive genetic analyses including whole-exome sequencing, targeted sequencing, and whole-genome sequencing were performed to reveal the molecular pathogenesis of chronic active Epstein-Barr virus infection.

  Dataset EGAD00001004299

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326