11925 results for "cancer rna-seq"

in 34.15 milliseconds.

• scRNA-seq of bulk and sorted NK

  Here we performed single-cell RNA sequencing to characterize NK cell subsets. Sorted NK cell subsets representing discrete stages of NK cell differentiation as well as bulk NK cells were sequenced.

  Dataset EGAD50000000020

• MDACC Lymphoma & Myeloma The function of LAMP5 in multiple myeloma

  This dataset includes Fastq files from bulk RNA seq from myeloma cell lines (MM.1S and NCI-H929) expressing a DOX-inducible LAMP5 shRNA, S1 (CACTTCAAAGACGCAGTCAGT) or S5 (GCACACAGAATACAACCTCAT), or a scramble control treated with DOX during 48h.

  Dac EGAC50000000495

• DynaTag for efficient profiling of transcription factors in small samples and single cells

  The dataset included Dynatag data for the occupancy of transcription factors and single nuclei RNA-seq data. Corresponding metadata is provided for both experiments.

  Dataset EGAD50000001562

• RNA-Seq soft tissue sarcoma tumoroid biobank

  Dataset EGAD00001008467

• preinvasive LUAD

  Whole-exome sequencing coupled with RNA-seq of preinvasive (n=98) and invasive (n=99) lung adenocarcinoma samples.

  Dataset EGAD00001005479

• NASH RNA-seq data

  This dataset includes transcriptome sequencing of 17 paired NAFLD-HCC samples and adjacent normal tissues. All the experiments were performed on Illumina HiSeq 2000 platform with raw reads stored in fastq format.

  Dataset EGAD00001004326

• Single cell RNA seq of the developing human embryo brain

  The study aims at identifying the cell types and lineages of the developing human brain.

  Study EGAS00001004107

• PDAC organoid genomic heterogeneity

  Two primary tumor-derived PDAC organoids were subjected to SNP array, RNA-seq, and single-cell WGS.

  Dataset EGAD00001009741

• Single-cell RNA-sequencing reveals that glioblastoma recapitulates a normal neurodevetlopmental hierarchy

  We discovered a conserved neural tri- lineage cancer hierarchy centered around glial progenitor-like cells. We also found that this progenitor population contains the majority of the cancer’s cycling cells, and, using RNA velocity, is often the originator of the other cell types. Finally, we show that this hierarchal map can be used to identify therapeutic targets specific to progenitor cancer stem cells. Our analyses show that normal brain development reconciles glioblastoma development, suggests a possible origin for glioblastoma hierarchy, and helps to identify cancer stem cell-specific targets.

  Study EGAS00001004422

• Effects of 2DG, Galactose, or Oligomycin on the epigenome remodeling induce by T cells activation.

  T cell activation is known to require a metabolic shift towards glycolysis, triggered by TCR-engagement . To substantiate the role of glycolysis in transcriptional reprogramming during antigen-driven T cell activation, we utilized a well-established ex-vivo model to recapitulate the process of antigen stimulation without the requirement for additional antigen-presenting cells . We initially explored and validated the conditions for both metabolic and epigenetic reprogramming. Antigen-mediated CD4+ T cells activation initiates context-specific gene-expression programs that drive effector functions and cell fates through changes in the epigenetic landscape . To evaluate global changes in histone modifications, we isolated CD4+ T cells from peripheral blood (PB) of healthy control (HC) human donors and either maintained them in resting conditions or stimulated with anti-CD3/CD28 for 24h. Rapid changes in the CD4+ epigenome and transcriptome were observed within 24h as measured by RNA-sequencing (RNA-seq) and H3K27ac chromatin immunoprecipitation followed by DNA-sequencing (ChIP-seq).To explore the requirement for metabolic reprogramming in regulating transcriptional responses after initial TCR engagement, CD4+ T cells from PB of healthy donors were isolated and activated in either the presence or absence of oligomycin (inhibitor of ATP synthase blocking the production of ATP by OXPHOS), 2-deoxyglucose (2DG; competitively inhibiting production of glucose-6-phosphate from glucose), or replacement of glucose with galactose. Galactose is metabolized through glycolysis, utilizing the Leloir pathway which is energy neutral, forcing cells to use all the pyruvate production to sustain the TCA cycle for OXPHOS and ATP synthesis at the expense of lactate production. Employing ChIP-seq and RNA-seq, inhibition of OXPHOS-mediated ATP production by oligomycin had only a limited effect on H3K27-acetylation or activation-induced transcription during the first 24h of activation. In contrast, inhibition of glycolysis by 2DG treatment compromised both H3K27-acetylation and transcriptional changes. However, under conditions of galactose-metabolism where lactate production is abrogated, activated CD4+ T cells were still able to globally remodel H3K27 acetylation and reprogram the transcriptome.

  Study EGAS00001007115

• Perturb-seq dataset

  We performed a systematic, genome-wide investigation of enhancer regions in colorectal cancer (CRC). We identified 12,117 putative enhancer regions using H3K27ac and H3Kme1 ChIP-seq and ATAC-seq. We performed scRNA-seq in HT29 and SW480 (MSS CRC cell lines) using the Parse Biosciences WT-mega kit with CRISPRi/dCas9 inhibition of these regions (Perturb-seq). The Parse split-pipe pipeline was used to demultiplex the raw fastq files into the processed files (mtx files for genes and gRNA) for each cell line.

  Dataset EGAD50000000375

• RNA sequencing in primary inflammatory (TPP) macrophages following deletion of a disease-associated gene desert at chr21q22, disruption of ETS2, or treatment of ETS2-edited macrophages with a HIF1α stabiliser.

  This dataset comprises raw RNA sequencing data (FASTQs) from primary inflammatory (TPP) macrophages that were unedited (non-targeting control, NTC), edited to delete the disease-associated chr21q22 enhancer region (n=5), or edited to disrupt ETS2 with 1 of 2 independent gRNAs (n=9). We also performed RNA-sequencing in NTC or ETS2-edited TPP macrophages that were treated for 12 hours with vehicle (DMSO) or roxadustat (30 uM, n=3). Macrophages were detached using Accutase and lysed. RNA was extracted from cell lysates using an AllPrep DNA/RNA Mini Kit (Qiagen). Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NextSeq500. Raw data are provided as 50 bp paired-end Illumina reads.

  Dataset EGAD00001011338

• HiDEF-seq Single-Molecule Sequencing of Single-Strand Mismatches and Damage

  Our study sought to resolve, with single-molecule resolution, the mismatches and damage events that precede DNA mutations. Using a novel single-molecule, long-read sequencing method (HiDEF-seq) we detected base substitutions when present in either one or both DNA strands. We compared the fidelity for dsDNA mutations to that of the same samples profiled by NanoSeq duplex sequencing. We also detected cytosine deamination, a common type of DNA damage, with single-molecule resolution. We profiled 134 samples from diverse tissues, including from individuals with cancer predisposition syndromes. These samples revealed single-strand mismatch and damage signatures. Since double-strand DNA mutations are only the endpoint of the mutation process, our approach enables new studies of how mutations arise in a variety of contexts, especially in cancer and aging.The data available via dbGaP includes raw HiDEF-seq sequencing files (Pacific Biosciences subreads in BAM format), raw NanoSeq sequencing files (Illumina FASTQ format), and raw germline sequencing files (Illumina FASTQ format).The HiDEF-seq main publication contains a supplementary table with a list of accession IDs for each sample's files.

  Study phs003604

• High-Throughput RNA Isoform Sequencing using Programmable cDNA Concatenation

  MAS-ISO-seq is a novel technique for programmably concatenating cDNAs into single molecules for optimal long-read sequencing. In practice, this boosts throughput >15 fold to nearly 40 million cDNA reads per run on the PacBio Sequel IIe sequencer. We have validated this method via application to synthetic RNA isoforms and single-cell sequencing of tumor-infiltrating T cells. Results demonstrated a >30 fold boosted discovery of differentially spliced genes and robust cell clustering, as well as canonical PTPRC splicing patterns across T cell subpopulations and the concerted expression of the associated hnRNPLL splicing factor.

  Study phs003200

• Neuroblastoma patient Total RNA Seq data

  Tumor Total RNA Seq data of primary neuroblastomas. This is an update of the „Berlin Neuroblastoma Dataset” (EGAS00001004022). This data was used for the analysis of circular RNA expression and regulation in neuroblastoma.

  Dataset EGAD00001008124

• Tumor Profiler Melanoma Study

  The Tumor Profiler Study is an observational trial combining a prospective diagnostic approach to assess the relevance of in-depth tumor profiling to support clinical decision-making with an exploratory approach to improve the biological understanding of the disease. Technologies used are digital pathology, targeted NGS, single-cell RNA, single-cell DNA, bulk RNA, bulk proteotyping, single-cell CyTOF, imaging mass cytometry, pharmacoscopy, 4i Drug Response Profiling, and cell-free DNA. These technologies were applied to 240 tumor samples collected over 3 years across three cancer indications: metastatic melanoma, metastatic epithelial ovarian cancer, and acute myeloid leukemia (AML). Here, we publish the scRNA, scDNA, and bkRNA data of the melanoma cohort.

  Study EGAS50000000599

• RNA sequencing of follicular T cell lymphoma

  Study EGAS00001004646

• Proteogenomic analysis reveals RNA as a source for tumor-agnostic neoantigen identification (H021)

  Systemic pan-tumor analyses may reveal the significance of common features implicated in cancer immunogenicity and patient survival. Here, we provide a comprehensive multi-omics data set for 32 patients across 25 tumor types for proteogenomic-based discovery of neoantigens. By using an optimized computational approach, we discover a large number of tumor-specific and tumor-associated antigens. To create a pipeline for the identification of neoantigens in our cohort, we combine DNA and RNA sequencing with MS-based immunopeptidomics of tumor specimens, followed by the assessment of their immunogenicity and an in-depth validation process. We detect a broad variety of non-canonical HLA-binding peptides in the majority of patients demonstrating partially immunogenicity. Our validation process allows for the selection of 32 potential neoantigen candidates. The majority of neoantigen candidates originates from variants identified in the RNA data set, illustrating the relevance of RNA as a still understudied source of cancer antigens. This study underlines the importance of RNA-centered variant detection for the identification of shared biomarkers and potentially relevant neoantigen candidates.

  Study EGAS00001006706

• FOXM1 is a biomarker of resistance to PI3Kα inhibition in ER+ breast cancer that is detectable using metabolic imaging (RNA-seq data)

  PIK3CA, encoding the PI3Kα isoform, is the most frequently mutated oncogene in estrogen receptor-positive breast cancer. Isoform-selective PI3K inhibitors are used clinically but intrinsic and acquired resistance limits their utility. Improved selection of patients that will benefit from these drugs requires novel predictive biomarkers. We show here that persistent FOXM1 expression following drug treatment is a biomarker of resistance to PI3Kα inhibition in ER+ breast cancer. Since the transcription factor drives expression of lactate dehydrogenase (LDH) but not hexokinase 2 (HK-II), changes in FOXM1 expression can be detected using magnetic resonance imaging of LDH-catalyzed hyperpolarized 13C label exchange between pyruvate and lactate but not by PET measurements of HK-II-mediated trapping of the glucose analog 2-deoxy-2-[18F]fluorodeoxyglucose.

  Study EGAS00001004452

• Comprehensive Genomic Characterization of Acral Melanoma

  In this study, we performed paired tumor/normal long insert whole genome and exome sequencing and tumor RNA sequencing on primary or metastatic acral melanoma tumors collected from 34 patients. Patients were enrolled from either Vanderbilt University or the Memorial Sloan-Kettering Cancer Center. We report an integrated analysis of DNA and RNA sequencing data to describe genomic and transcriptomic characteristics of acral melanoma.

  Study phs001036

• Indonesian RNA-seq data

  Transcription data were collected to study patterns of functional variation across the broad geography of Indonesia. The region has extremely diverse populations, with very different demographic histories and multiple genetic ancestries. This dataset reports high-throughput RNA-sequencing data for individuals from three islands spanning this geographical region: Mentawai, Sumba and West Papua.

  Study EGAS00001003671

• Targeted gene fusion sequencing (Fus-seq) in mesothelioma

  This is a small pilot data set to test the feasibility of cDNA exomes across 1200 cancer cell line panel. cDNA exomes or Fus-seq is further explained in this studies Abstract.

  Dataset EGAD00001000361

• COVID_Methyl_scRNA

  DAC for the study of whole-genome enzymatic DNA methylation sequencing and single-cell RNA sequencing of nasal cells from COVID-19 patients. Nasal swabs were collected from COVID-19 patients during the acute phase of infection as well as 3 and 12-months post-infection. Cells isolated from nasal swabs were subjected to whole-genome enzymatic DNA methylation sequencing (n=33) and scRNA-seq (n=24). For n=12 former COVID-19 pateints, follow-up samples were collected at 3 and 12 months post-infection and subjected to scRNA-seq.

  Dac EGAC50000000197

• ZFHX4 is necessary for dopaminergic neuron differentiation and controls cell cycle by regulating LIN28A

  ZFHX4 as a transcription factor specifically induced during the in vitro differentiation of iPSC-derived mDANs. Depletion of ZFHX4 during neuronal differentiation led to a significant reduction in the number of mDANs while its overexpression did not lead to any changes in mDAN count. Identification of ZFHX4 target genes using CUT&Tag profiling and RNA-seq upon ZFHX4 knock-down (KD) revealed its involvement in cell cycle regulation during mDAN differentiation

  Dataset EGAD50000001605

• Stromal and dendritic cells from lymph nodes: single-cell RNA-seq

  Although cross-species transcriptional analysis has been generated for DCs, transcriptomic conservation between mouse and human FRCs at single-cell resolution has been unclear. To test whether GREM1+ FRCs might also play a role in DC homeostasis in humans, we performed scRNA-seq of CD45–PDPN+ stromal cells, as well as CD45+CD11c+ immune cells from healthy human LNs of three human donors. Data was generated using the 10x platform.

  Dataset EGAD00001008731

• Monosomy 7 delineates a primitive acute myeloid leukemia with adverse prognosis and responsiveness to epigenetic therapy

  The dataset comprises 27 single-cell multiome (ATAC + GEX) datasets generated from 13 patients with AML, collected across different stages of disease progression. In addition, matched long-read sequencing data from 5 samples were used to enable longitudinal analyses throughout the manuscript. Finally, bulk RNA-seq and ATAC-seq datasets from the cell line used in this study are also included.

  Dataset EGAD50000002359

• Childhood Cancer Data Initiative (CCDI): Texas Pediatric Patient Derived Xenograft 

  The DNA/RNA samples of patients for which PDX models were developed were from a population of children, adolescents, and young adults from South Texas. Consent was obtained for collection of malignant and non-malignant tissue samples for genetic analysis and for the development of models to study new ways to treat cancer. For additional details, please refer to these publications: PMID: 37915590; PMID: 37990009.

  Study phs003215

• Multi-Modal Single-Cell, Spatial, and Genomic Analyses of Human Non-Small Cell Lung Cancer Brain Metastases

  We performed single nuclei RNA-sequencing (snRNA-seq) with matched T cell receptor sequencing (TCR-seq), and pool matched low pass whole genome sequencing (WGS) of 12 treatment-naive non-small cell lung cancer (NSCLC) primary tumors (PTs) and 31 treatment-naive NSCLC brain metastases (BMs). In total, we recovered 277,206 cell transcriptomes in 43 samples. Single-nuclei suspension from frozen NSCLC metastases were generated using methods published in Slyper et al. (Nature Medicine, 2020, PMID:32405060) with modifications. The tissue was first cut in 20 µm sections using a cryostat and stored on dry ice until the next step. Then the tissue was put on wet ice and washed once with 5 ml PBS to remove OCT. After this step nuclei were extracted by vigorous pipetting in salt-tris buffer with Tween-20 (TST) followed by a high-volume wash in salt-tris buffer (ST). Nuclei were counted and 10,000-14,000 and were loaded using a Chromium controller (10X genomics) and Chromium Single Cell 5' Reagents (V1.1 and V2). Complementary DNA libraries were generated according to manufacturer's instructions, with the modification of one additional cycle of amplification. Matched single nuclei T cell receptor (snTCR) sequencing libraries were prepared from amplified cDNA libraries using either Chromium Single Cell V(D)J Enrichment Kit for human T cells Reagent Kit, v1.1, or single cell human TCR amplification kit. Final snTCR sequencing libraries were prepared using Single Index Kit T Set A for V1.1 libraries or Library construction kit and Dual Index Kit TT set A for V2 libraries. Sequencing libraries were quantified using Tapestation D5000 reagents and a 2200 TapeStation and pooled for sequencing. Pool matched low pass whole-genome sequencing (lp-WGS) was performed in addition to snRNA-seq to improve the identification of the malignant and non-malignant cell compartments. Nuclei from snRNA-seq sample preparations were collected by centrifugation (500g, 5 min), snap frozen after removing excess ST buffer, and stored at -200C until further processing. If insufficient nuclei (0C for 9 minutes. Adapters were not diluted, and the optional PCR (5 cycles) and cleanup were performed. After library cleanup with AMPure beads (Beckman Coulter, Brea, CA), libraries were quantified with Tapestation D5000 HS tapes (Agilent) and stored at -200C until sequencing.Using multiplexed immunofluorescence in an independent cohort of treatment-naïve pairs of primary tumors and brain metastases from the same patients with NSCLC, we validated genomic and tumor-microenvironmental findings and identified a cancer cell population characterized by neural features that strongly enriched in brain metastases. This comprehensive analysis provides insights into human NSCLC brain metastasis biology and serves as an important resource for additional discovery.

  Study phs003865

• Strand-specific mRNA-Seq assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  Strand-specific mRNA-Seq assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001227

• Fastq data for stranded mRNA-Seq assays for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency as part of the International Human Epigenome Consortium.

  Fastq data for stranded mRNA-Seq assays assay for reference epigenomes generated at Centre for Epigenome Mapping Technologies, Genome Sciences Center, B.C. Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001402

• ChIP-Seq (Input) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, as part of the International Human Epigenome Consortium.

  ChIP-Seq (Input) assays for reference epigenomes generated by Centre for Epigenome Mapping Technologies at Canada's Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, Canada as part of the International Human Epigenome Consortium.

  Dataset EGAD00001001235

• Comprehensive molecular phenotyping of ARID1A-deficient gastric cancer reveals pervasive epigenomic reprogramming and therapeutic opportunities

  This dataset includes paired tumor-blood whole exome sequencing data for 209 gastric cancer (GC) patients, along with whole transcriptome sequencing data for 125 GC samples. Whole exome sequencing was conducted using Agilent SureSelect Human All Exon V6 kits. For RNA sequencing, total RNA was isolated using the RNeasy Mini Kit, and libraries were prepared with the TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina). Aligned BAM files for both exome and RNAseq data are included in this dataset.

  Dataset EGAD50000000660

• Multiregion Whole Exome and Smart-Seq3 single cell RNA sequencing of Breast Tumors

  Multiple regions were cut out of each tumor extracted form breast cancer patients and two experiments were run: - Whole exome sequencing on each of the regions plus an adjacent normal tissue sample - Smart-Seq3 Single cell RNA sequencing on EPCAM+ CD45- sorted cells from different tumor regions

  Study EGAS00001006851

• SGCC GASCAD-II dataset

  The GASCAD-II dataset from the Singapore Gastric Cancer Consortium includes paired tumor-blood whole exome sequencing data for 209 gastric cancer (GC) patients, along with whole transcriptome sequencing data for 125 GC samples. Whole exome sequencing was conducted using Agilent SureSelect Human All Exon V6 kits. For RNA sequencing, total RNA was isolated using the RNeasy Mini Kit, and libraries were prepared with the TruSeq Stranded Total RNA with Ribo-Zero Gold protocol (Illumina). Aligned BAM files for both exome and RNAseq data are included in this dataset

  Dataset EGAD00001015433

• Comparison of 3 protocols for deriving pancreatic progenitors from hPSC with RNA-seq and ATAC-seq

  Several distinct differentiation protocols for deriving pancreatic progenitors (PP) from human pluripotent stem cells have been described but it remains to be shown how similar the PP are across protocols, and how well they resemble their in vivo counterparts. Here we evaluated three differentiation protocols; performed RNA and ATAC-seq on isolated PP derived with these, and compared them to fetal human pancreas populations. This enabled us to define a shared transcriptional and epigenomic signature of the PP, including several genes not previously implicated in pancreas development. Furthermore, we identified a significant and previously unappreciated cross-protocol variation of the PP through multi-omics analysis and demonstrate how such information can be applied to refine differentiation protocols for derivation of insulin-producing beta-like cells. Together, our study highlights the importance of a detailed characterization of defined cell populations derived from distinct differentiation protocols, and provides a valuable resource for exploring human pancreatic development.

  Study EGAS00001003513

• Identification of the Global miR-130a Targetome Reveals a Novel Role for TBL1XR1 in Hematopoietic Stem Cell Self-Renewal and t(8;21) AML

  In this study, we identified miR-130a as a regulator of HSC self-renewal and differentiation. To characterize gene expression changes following enforced expression of miR-130a OE, we performed RNA-seq in CD34+ cord blood (CB) cells transduced with control and miR-130a OE lentiviruses. To capture miRNA targets in an unbiased, transcriptome-wide manner, we perfomed enhanced CLIPseq procol in 2 replicates of CD34+ CB cells and Kasumi-1 cell line, which represent a model system for t(8;21) AML. We chose this cell line, as we found miR-130a to be highly expressed in this AML subtype where it is critical for maintaining the oncogenic molecular program mediated by AML1-ETO. Chimeric Ago2 eCLIPseq in CD34+ CB cells combined with Mass Spectrometry data analysis identified TBL1XR1 as a principal target of miR-130a. To elucidate gene expression changes associated with TBL1XR1 loss of function, we performed RNA-seq in CD34+CD38- CB cells transduced with control and shRNA targeted against TBL1XR1. To determine the functional significance of high miR-130a expression levels in Kasumi-1 cells on the molecular network controlled by AML1-ETO, we performed CUT&RUN assay and RNA-seq in Kasumi-1 cells following miR-130a knock-down (KD). Collectively, our findings reveal a unique role of miR-130a in regulating normal hematopoietic stem cell self-renewal and how elevated levels of miR-130a in t(8;21) AML contribute to the leukemogenesis of this AML subtype.

  Dataset EGAD00001008412

• RNA-seq in LCLs derived from constitutional MLH1 epimutation carriers and non-carrier relatives

  Transcriptome profiling in human lymphoblastoid cell lines derived from constitutional MLH1 epimutation carriers and non-carrier relatives

  Study EGAS50000000498

• Characterization of a novel MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line RNA-Seq

  A novel in-house-made pediatric MEF2D-BCL9 fusion positive acute lymphoblastic leukemia cell line was characterized

  Dataset EGAD00001009759

• Covacta RNAseq counts

  RNA-seq data from PAXgene extracted whole blood of patients enrolled in the COVACTA trial. This dataset includes read counts per gene. Read counts were generated for the Gencode v27 annotation using the summarize Overlaps method from bioC in mode “IntersectionStrict”

  Dataset EGAD00001011164

• Validated Single-cell RNA sequencing in early breast cancer

  Single-cell RNA and VDJ sequencing of early breast cancer

  Dataset EGAD00001006608

• Common Deleterious Germline Variants Shape the Urothelial Cancer Genome

  Our study used whole-exome, whole-genome, and RNA sequencing to analyze samples from primary tumors, locally recurrent or metastatic urothelial tumors collected over time, and matched normal urothelium. We described the molecular landscape of mutational signatures and structural variants in chemotherapy-resistant urothelial cancer.

  Study phs001087

• CRUK Accelerator: Non-small cell lung cancer whole exome and RNA sequencing

  Whole exome and RNASeq raw sequencing data for a cohort 24 patients with non-small cell lung cancer, 15 adenocarcinoma (8 female, 7 male) and 9 squamous cell carcinoma(5 female, 4 male). Median age at diagnosis was 69. Tumour tissue and PBMCs were used for whole exome sequencing and RNA sequencing. This data was generated as part of a study funded by a Cancer Research UK Centres Network Accelerator Award Grant (A21998).

  Dataset EGAD00001007934

• Small RNA sequencing of untreated and castration resistant prostate cancer

  Small RNA sequencing of 28 untreated prostate cancers, 12 castration resistant prostate cancers, and 3 benign prostatic hyperplasias.

  Dataset EGAD00001000611

• A Phase Ib/II Study of Regorafenib and Paclitaxel in Beyond First-line Advanced Esophagogastric Carcinoma (REPEAT)

  Regorafenib showed promising results in gastric cancer. We aimed to assess the tolerability of regorafenib and paclitaxel in advanced esophagogastric cancer (EGC) patients refractory to first-line treatment and explore potential biomarkers.. We performed enzyme-linked immunosorbent assay measurements of galectin-1, RNA sequencing, and shallow wholegenome sequencing of metastatic tumor biopsies for biomarker analyses.

  Study EGAS00001006054

• Molecular Characterization for Nasopharyngeal Carcinoma (NPC)

  Total RNA was isolated from 50 formalin-fixed paraffin-embedded nasopharyngeal cancer (NPC) specimens using the RecoverAll Total Nucleic Acid Isolation kit (Ambion). Tumor RNA libraries were prepared with 200ng RNA using the Illumina TruSeq Stranded Total RNA kit with Ribo-Zero Gold, and sequenced with >80 million 100 bp paired-end reads.

  Dataset EGAD00001009047

• Enzymatic Methyl-Seq Rectal Mucus

  Enzymatic methyl sequencing of rectal mucus samples from patients suspected to have colorectal cancer. This is 1 of 4 sequencing experiments on the same sample type.

  Study EGAS50000001314

• Data for noninvasive lung cancer subtyping study

  This dataset included cfMethyl-Seq data of 15 plasma cfDNA samples from 15 lung cancer patients and RRBS data of 58 lung tumor tissue samples from 58 lung cancer patients. The data were generated following the standard protocols.

  Dataset EGAD00001015344

• RaScALL: Rapid (Ra) screening (Sc) of RNA-seq data for prognostically significant genomic alterations in acute lymphoblastic leukaemia (ALL)

  RNA-sequencing (RNA-seq) efforts in acute lymphoblastic leukaemia (ALL) have identified numerous prognostically significant genomic alterations which can guide diagnostic risk stratification and treatment choices when detected early. However, a full RNA-seq Bioinformatics workflow is time-consuming and costly in a clinical setting where rapid detection and accurate reporting of clinically relevant alterations are essential. To accelerate the identification of ALL-specific alterations (including gene fusions, single nucleotide variants and focal gene deletions), we developed the rapid screening tool RaScALL, capable of identifying more than 100 prognostically significant lesions directly from raw sequencing reads. RaScALL uses the k-mer based targeted detection tool km and known ALL variant information to achieve a high degree of accuracy for reporting subtype defining genomic alterations compared to standard alignment-based pipelines. Gene fusions, including difficult to detect fusions involving EPOR and DUX4, were accurately identified in 98% (164 samples) of reported cases in a 180-patient Australian study cohort and 95% (n=63) of samples in a North American validation cohort. Pathogenic sequence variants were correctly identified in 75% of tested samples, including all cases involving subtype defining variants PAX5 p.P80R (n=12) and IKZF1 p.N159Y (n=4). Accurate detection of intragenic IKZF1 deletions resulting in aberrant transcript isoforms was also detectable with 98% accuracy. Importantly, the median analysis time for detection of all targeted alterations averaged 22 minutes per sample, significantly shorter than standard alignment-based approaches, ensuring accelerated risk-stratification and therapeutic triage.

  Dataset EGAD00001009087

• Notch Signaling and Efficacy PD-1/PD-L1 Blockade in Relapsed Small Cell Lung Cancer

  Small cell lung cancer (SCLC) is a highly aggressive neuroendocrine (NE) cancer that accounts for approximately 15% of all lung cancer, with an annual incidence of more than 34,000 in the United States alone. SCLC is characterized by loss of function of p53 and RB and high tumor mutational burden, which suggests that these tumors could be immunogenic and respond to immune checkpoint blockade (ICB). However, the benefit from ICB in an unselected SCLC population is modest. In this study, we evaluated the genomic features associated with clinical outcomes in relapsed SCLC to gain insight into the underlying mechanisms of ICB response. Exome, RNA and TCR sequencing data from a prospective clinical trial of relapsed SCLC treated with durvalumab and olaparib and RNA-sequencing data for second cohort of relapsed SCLC cohort treated with nivolumab are included.   

  Study phs002176

• Childhood Cancer Data Initiative (CCDI): OncoKids - NGS Panel for Pediatric Malignancies

  This study aimed to systematically collect clinical, registry and genomic data on pediatric cancer patients, and to contribute to the CCDI Pediatric Data Ecosystem. Clinical, treatment and outcome data on 1,039 pediatric cancer patients whose molecular profile was characterized on OncoKids gene panel at Children's Hospital Los Angeles was abstracted and harmonized for submission to the NCI’s Cancer Data Service. The OncoKids panel was designed to detect DNA mutations and amplification in almost 200 oncogenes and tumor suppressor genes, a limited number of pharmacogenomic targets and 1,700 disease-associated gene fusions at the RNA level. The panel encompasses the vast majority of FDA’s relevant pediatric molecular target list, as well as additional genes associated with ultra-rare pediatric tumors. The final data elements included DNA/RNA sequence data, OncoKids test results, clinical data on demographics, diagnosis, comorbidity and adverse events and treatment data.

  Study phs002518

• Ongoing_mutagenesis_RNAseq

  One of the key questions to be explored is whether the biological processes generating specific mutational signatures continue to operate in the human cancer cell lines or simply reflect past mutagenic activity which is no longer operative. To address this question, we have extracted mutational signatures from 1,000 cancer cell lines of diverse cancer types. Several cell lines with mutational signatures of interest were selected, subcloned over a defined period of time and their genomes sequenced. The increased load of the mutations representative of a specific mutational signature within the genome of a subclone when compared to its parental clone was informative of the on-going mutational processes. To further study the recent observation that some of the clones belonging to a same cell line acquired differencet numbers of mutations over a set period of time, their RNA will be subjected to RNA-sequencing to study their differences.

  Study EGAS00001002364

• Studying Glioblastoma in a Human Organoid Tumor Transplantation Model

  This study comprises two complementary investigations that leverage innovative human model systems and cutting-edge molecular profiling to dissect glioblastoma (GBM) heterogeneity and tumor-microenvironment interactions. The first study uses a novel Human Organoid Tumor Transplantation (HOTT) model, in which freshly dissociated GBM tumor cells from five patients were transplanted into human embryonic stem cell-derived cortical organoids. This system enables the interrogation of tumor and microenvironment interactions in a human-specific, developmentally relevant context. Using single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA-seq (snRNA-seq), the authors profiled over 216,000 cells, analyzing tumor heterogeneity across multiple media conditions. Ligand-receptor analysis (CellChat), immunofluorescence, and RNAScope were used to validate findings. The study revealed that the HOTT model faithfully recapitulates primary GBM cell types and microenvironmental components, and uncovered a novel bidirectional signaling axis mediated by PTPRZ1 that influences both tumor migration and cell fate in a context-dependent manner. PTPRZ1 is identified to be important for intercellular communication between tumor and microenvironmental cells, while PDGFRB, NOTCH3, HOPX, FAM107A, CLDN5, RGS5, FOXC1, SOX18 are key markers of the neurovascular progenitor that we identify to be a multipotent, restricted progenitor in GBM. Related datasets include the inclusion of immune cells in the HOTT system, termed “iHOTT”. The second study focuses on identifying and characterizing a rare but functionally potent neurovascular progenitor (NVP) population within GBM tumors. By generating a meta-atlas from seven publicly available GBM scRNA-seq datasets, the authors identified a unique tumor-derived cell population co-expressing neural progenitor and vascular markers. This population was validated in situ and in vivo through immunostaining and lineage tracing via DNA barcoding in the HOTT system. Functional knockdown of NVPs in a murine GBM model resulted in reduced cycling cells, altered tumor composition, and increased survival. Clonal analysis showed NVPs have dual potency to give rise to both neuronal and vascular-like tumor cells, contributing significantly to tumor cell diversity. Molecular technologies used across the studies include: Single-cell and single-nucleus RNA sequencing DNA barcoding and clonal lineage tracing (CellTag) Population information: Tumor samples were obtained directly from multiple GBM patients (all IDH1 wild-type, adult), including core and peripheral tumor regions. Human cortical organoids derived from human embryonic stem cells (hESCs) served as the microenvironment in the HOTT model. Principal findings include: HOTT recapitulates the heterogeneity and cell type fidelity of GBM, while enabling the study of tumor–microenvironment signaling. PTPRZ1 has opposing roles in tumor and microenvironment, influencing GBM cell migration and fate via non-catalytic mechanisms. A novel GBM neurovascular progenitor population (NVP) was identified, validated, and shown to contribute clonally to distinct tumor cell types. Elimination of NVPs in vivo reduces tumor aggressiveness and improves survival. Data to be available through dbGaP: Raw and processed single-cell and single-nucleus RNA-seq data (HOTT model and NVP studies) CellTag barcode-labeled scRNA-seq clonal lineage data Associated metadata including patient of origin, experimental condition, and sample annotations.

  Study phs003936

• Whole transcriptome profiling of liquid biopsies from tumour xenografted mouse models: validation cohort

  While cell-free DNA (cfDNA) in liquid biopsies is widely being used and investigated, free circulating RNA (extracellular RNA, exRNA) has the potential to improve therapy response monitoring and cancer detection due to its dynamic nature. A fundamental open question hampering the initiation of large-scale liquid biopsy collections for tumour exRNA analysis is that it remains unclear in which blood subcompartment tumour-derived exRNAs primarily reside. We set out to develop a host-xenograft deconvolution framework, exRNAxeno, with cDNA mapping strategies to either a combined human-mouse reference genome or both species genomes in parallel, that can be applied to exRNA sequencing data from liquid biopsies of human xenograft mouse models, enabling to distinguish (human) tumoural RNA from (murine) host RNA, and as such to specifically analyse tumour-derived exRNA. Subsequently, the preferred exRNAxeno combination pipeline was applied to total exRNA sequencing data from blood platelets and three plasma fractions from a breast cancer patient-derived and neuroblastoma cell line-derived xenograft mouse model. We show that tumoural exRNA concentrations are not determined by plasma platelet levels, while host exRNA concentrations increase with platelet content. Furthermore, a large variability in exRNA levels and gene content across individual mice is observed. In general, the tumoural gene detectability in plasma is correlated with the RNA expression levels in the tumour tissue or cancer cell line. Our results unravel new aspects of tumour-derived exRNA biology in xenograft mouse models.

  Study EGAS00001006582

• GM adipose tissue study

  The Greek Metabolic (GM) adipose study was carried out in 106 individuals living in Greece and consists of genotyping data (chip), RNA-Seq and ATAC-Seq (for a subset of individuals) data from paired biopsies of Subcutaneous and Visceral adipose tissue. eQTL mapping was performed to study gene regulation and findings compared to those from adipose tissue GTEX data. The focus of this project was to study an underexplored population living in different environmental conditions in order to reveal novel regulatory effects for genes that shape complex traits and disease risk. Our results highlight the utility of modest-sized studies in adding to our understanding of the molecular basis of complex traits and to the identification of mechanisms that drive disease in specific tissues.

  Study EGAS00001007126

• Characterization of Neoantigen-reactive T cells by Single-Cell Analysis

  Through CITE-seq and TCR-seq analysis of non-small cell lung cancer (NSCLC) tumor-infiltrating lymphocytes (TIL), we developed a neoantigen-reactive T-cell signature based on clonotype frequency and CD39 protein and CXCL13 mRNA expression. There are four datasets from four NSCLC cases. Each dataset includes (1) Transcriptome of tumor infiltrating lymphocytes (TIL), (2) Cell surface protein expression on TIL by Feature barcoding, (3) T-cell receptor analysis of TIL, and (4) Reference file for feature-barcoding antibodies.

  Study phs002792

• Gene Expression Signatures Characterized by Longitudinal Stability and Inter-Individual Variability Delineate Baseline Phenotypic Groups with Distinct Responses to Immune Stimulation

  RNA sequencing (RNAseq) of peripheral blood lymphocytes was used to develop a means to assess immune function in a way that can be used in discovery science and applied to patients individually in clinical settings. The premise is that profiles of RNA present in immune cells is reflective of the combined influence of genetic and environmental variation on immune potential of individuals and that this potential can be tapped to understand human immunity in a variety of biological contexts. CD4+ cells were isolated from fresh whole blood via positive magnetic bead selection and cell lysates were prepared using Qiazol (QIAGEN) and stored at -80ºC for 3 to 8 months. RNA was extracted in batches for cDNA library preparation and RNA-Seq. For this study, we developed standard operating procedures for handling human blood samples and determined: a) the best way to enrich for CD4+ T cells from whole blood and yield high quality RNA, b) the sensitivity of this RNA profiling strategy, and c) the reproducibility of generated immune profiles from healthy subjects. We then developed bioinformatics processes to establish immune response signatures and immune response phenotypes within cohorts of individuals.

  Study phs001512

• Human glioblastoma single cell RNA-seq from two patient, sampled at different positions within as well as outside tumor

  We performed deep single-cell RNA sequencing of two rare glioblastoma cases where tissue could be sampled from tumor core to macroscopically normal cortex. We processed two to three replicates per sample with the 10X Genomics V3.1 kits. Deep sequencing was performed to about 100,000 reads per cell on the Illumina NovaSeq 6000 platform, resulting in a total of 37 BAM files.

  Dataset EGAD50000001500

• RNA-seq after drug perturbation of primary lymphoma samples

  3'-end low-depth RNA sequencing data from 108 patients with chronic lymphocytic leukemia and 8 patients with lymphoma. Each primary patient sample was treated in vitro with DMSO as a control and with up to ten small-molecule inhibitors (ibrutinib, duvelisib, everolimus, trametinib, nutlin-3a, I-BET762, MK2206, selinexor, compound 26, and a combination of ibrutinib and compound 26). Sequencing was performed on the Illumina HiSeq4000. The dataset contains FASTQ files.

  Dataset EGAD50000002166

• Single-cell RNA sequencing of Small Intestinal Neuroendocrine Tumors (SI-NET)

  Single-cell RNA sequencing (scRNA-seq) was performed on cells isolated from intestinal mucosa and small intestinal neuroendocrine tumors (SI-NETs) to compare their transcriptomic profiles. Tumor and adjacent normal tissues were collected from two SI-NET patients, enzymatically dissociated, and processed into single-cell suspensions. Single-cell libraries were generated using the Chromium Single Cell 3′ Reagent Kit v3 and sequenced on an Illumina platform to produce FASTQ files for downstream analysis.

  Dataset EGAD50000002265

• WGS,RNA data of patients with multiple myeloma (MM) refractory to immunomodulatory agents (IMiDs) and proteasome inhibitors (PIs)

  Paired WGS and RNA-Seq data of patients with multiple myeloma (MM) refractory to immunomodulatory agents (IMiDs) and proteasome inhibitors (PIs). We performed whole genome and transcriptome sequencing of 39 heavily pretreated RRMM patients with at least double refractoriness revealing complex structural changes and a high mutational load.

  Dataset EGAD00001006189

• RNA-Seq of GM adipose tissue samples

  This dataset contains 210 fastq files (RNA sequencing was performed in two centers) from 105 individuals (106 files in subcutaneous tissue and 104 files in visceral tissue). Of the 210 fastq files, 129 files are in PEx100 mode (appeared in a single fastq file) and 81 files are in PEx49bp mode (appeared in two separate fastq files). Sequencing was done on the Illumina HiSeq2000 platform.

  Dataset EGAD00001010253

• Genome and transcriptome sequencing of cancer of unknown primary tumours

  Genome and transcriptome sequencing of cancer of unknown primary tumours was used to determine yield of clinical biomarkers for a molecular guided trial or for resolving cancer type of origin. This study includes profiling of germline DNA and tumour DNA by whole genome sequencing of tissue and cfDNA biopsies, as well as targeted genome sequencing using two panels, including Comprehensive cancer panel (CCP) and TruSight Oncology 500 (TSO500). This study also includes profiling of tumour RNA by whole transcriptome sequencing.

  Study EGAS50000000452

• Atezolizumab monotherapy following dCRT indicated a promising cCR rate in patients with unresectable locally advanced esophageal squamous cell carcinoma (EPOC1802)

  The objective is to analyze tumor and normal cell exome sequencing of esophageal cancer patients participating in the Tenergy trial before treatment and RNA sequencing specimens of tumor biopsy specimens at three points before treatment, after radiation chemotherapy, and after atezolizumab administration, in order to search for biomarkers to predict treatment response. Exome sequencing of pretreatment tumor tissue (27 specimens) and normal tissue (27 specimens) from esophageal cancer patients participating in the Tenergy trial, and RNA sequencing of tumor biopsy specimens at three time points before treatment (28 specimens), after radiation chemotherapy (25 specimens) and after atezolizumab administration (25 specimens).

  Study JGAS000708

• Evaluation of Local Response of Prostate Cancer to Irradiation Using Multiparametric MRI and MR-Guided Biopsies

  The purpose of this study was to determine the rate of local recurrence in patients with intermediate and high risk prostate cancer treated with radiotherapy. In this study, multiparametric MRI was first performed, and biopsy tissue was acquired from cancerous regions detected on MRI. Blood samples were also taken. DNA and RNA were extracted from tissue taken at baseline. DNA was used for whole exome sequencing (WES). RNA was used for gene expression microarray. Each patient then received radiation therapy with androgen deprivation therapy.

  Study phs001821

• CMF_RNA_sequencing

  RNA sequencing will be undertaken to reconstruct rearrangements at level of transcription to determine pathogenomic genomic events in chondromyxoid fibroma

  Study EGAS00001000470

• Identification and Characterization of Skin-Resident Memory T cells in Patients with Melanoma-Associated Vitiligo

  Metastatic melanoma patients who develop melanoma-associated vitiligo, an autoimmune cutaneous side effect after receiving immunotherapy, have better overall survival than those who do not develop vitiligo. The objective of this study is to determine the tumor-specific memory T cell responses in the skin, tumor and blood of melanoma patients with vitiligo. Matched melanoma tumor, distant vitiligo-affected skin, and blood were collected and sorted for T cells to perform paralleled single-cell RNA sequencing (scRNA-seq) and single-cell TCR sequencing (scTCR-seq) on the day of tissue collection. The transcriptional analysis identified three resident memory T (TRM) cell subsets which were shared between tumors and vitiligo-affected skin. scRNA-seq identified CD8+ T-cell clonotypes in tumors that co-existed as TRM in skin and as effector memory T (TEM) cells in blood. This study revealed that long-term melanoma survivors maintained memory T cell responses as broadly-distributed TRM and TEM compartments. 

  Study phs002309

• The Dynamic Immune Behavior of Primary and Metastatic Ovarian Carcinoma

  Single-cell RNA-seq data of prospectively collected normal ovarian tissue sample from 1 healthy individual and tumor tissue samples with or without chemotherapy from 19 HGSOC patients.

  Dataset EGAD50000000057

• scRNAseq sequencing reads and count matrices of murine splenocytes from diffuse large B-cell lymphoma

  Single-cell RNA-seq of 91 murine splenocytes from Bcl6tg/+ and Cd70-/-; Bcl6tg/+ diffuse large B-cell lymphoma mouse models and Cd70-/- and wild-type controls.

  Dataset EGAD00001012104

• Human normal brain single-cell

  We profiled two human fetal brainstem specimens at 17 and 19 post-conception weeks by single-cell RNA-seq using 10X Chromium Single Cell 3'. The BAM files are provided.

  Dataset EGAD00001005128

• Genomic Analysis of Medullary Thyroid Carcinoma

  Sequence data from two medullary thyroid carcinoma patients: WGS datasets generated from tumors and matched normal tissues and RNA-Seq from tumors are included.

  Dataset EGAD00001001618

• Transcriptomic profiles of neuroblastoma PDXs and primary tumors

  This dataset contains bam files for RNA-seq experiments for 6 neuroblastoma PDXs (Patient Derived Xenograft) and 3 pairs of neuroblastoma tumors at diagnosis and at relapse.

  Dataset EGAD00001003393

• Integrative genomic study of CML patients

  This dataset contains WES and RNA-Seq fastq files for 65 CML patient samples at various stages of disease progression.

  Dataset EGAD00001004179

• Whole-genome sequencing reveals genomic signatures associated with the inflammatory microenvironments in Chinese NSCLC patients

  We integrate genomic (whole-genome sequencing, WGS) and transcriptome (polyA-enriched RNA-Seq) sequencing from 90 NSCLC cases and comprehensively identified the distinct genomic features of Chinese NSCLC patients.

  Dataset EGAD00001004071

• macIDR validation data

  RNA-seq of 24 M-CSF differentiated human peripheral monocyte-derived macrophages (MDMs) activated with short exposure (3hours) to LPS, or long exposure (24 hours) to LPS, LPS with IFNγ, IFNγ, IL-4, IL-10, and dexamethasone.

  Dataset EGAD00001004584

• Count table for OAK (GO28915)

  This dataset contains counts for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008628

• CPM table for OAK (GO28915)

  This dataset contains counts per million for 699 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from OAK (GO28915).

  Dataset EGAD00001008629

• Count table for POPLAR (GO28753)

  This dataset contains counts for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008630

• CPM table for POPLAR (GO28953)

  This dataset contains counts per million for 192 tumor samples profiled by RNA-seq for the entire transcriptome for samples originating from POPLAR (GO28753).

  Dataset EGAD00001008631

• Experimental PfSPZ Vaccine in Adults Without Malaria

  The study was performed to evaluate whole-blood transcriptomic profiles via RNA-seq before, during, and after immunization with the PfSPZ Vaccine in malaria-naïve, healthy adults enrolled in VRC 312 (NCT01441167). VRC 312 was the second study of the PfSPZ Vaccine and the first study to evaluate intravenous (IV) administration of this vaccine. The study was an open-label evaluation of the safety, tolerability, immunogenicity, and protective efficacy of the vaccine at successively higher administered by the IV route. The highest dosages were evaluated for protection against a malaria challenge after 4 to 6 vaccinations. The primary objectives of the study were related to the safety and tolerability of the vaccine at the 4 different dosage levels when administered IV; the secondary objectives were related to PfSPZ vaccine-mediated protection against Plasmodium falciparum (Pf) challenge at the 3 higher dosage levels, and the exploratory objectives were related to the immunogenicity of the PfSPZ Vaccine and defining an immune correlate of protection. To further determine potential molecular correlates of immunogenicity and/or protection, RNA-seq was performed on whole blood collected from subjects in all dose groups at time points before, during, and after immunization.

  Study phs002422

• Cholesterol and Pharmacogenetics (CAP) Study

  The Cholesterol and Pharmacogenetics Study was a 6-week open label, non-randomized study of 40mg/day simvastatin treatment in 335 black and 609 white (944 total) men and women. Plasma lipids and lipoproteins were measured on two occasions prior to treatment and at 4 and 6 weeks of treatment. The study was designed to test for genetic associations with baseline measurements and changes in response to simvastatin treatment. Whole genome genotyping was performed on 592 white CAP study participants in two stages. In Stage 1, 304 were genotyped for 314,621 SNPs to tag for common genomic variation. In Stage 2, 290 participants were genotyped, including 280 who were genotyped for 620,901 SNPs. Two samples were excluded due to gender discrepancies. More recently, CAP self-reported black participants were genotyped on Illumina Omni2.5Exome chips. PolyA-selected strand-specific RNA-seq libraries were generated in several batches from lymphoblastoid cell lines (LCLs) derived from 268 white and 165 black CAP participants. The LCLs were exposed to sham buffer (control) or 2 uM activated simvastatin for 24 hours, producing a total of 866 100/101 bp paired end RNA-seq libraries sequenced on Illumina HiSeq 2000 machines.

  Study phs000481

• HTAN Pilot Project: Single-Cell Transcriptomics Toolbox for Fresh and Frozen Human Tumors (Lung, Breast, Ovarian, Melanoma, Neuroblastoma, Sarcoma, Glioblastoma, Glioma, and Leukemia)

  Single cell transcriptomics is a powerful tool to map the complex tumor microenvironment, providing unprecedented resolution into cell types, cell states, cell interactions, and tumor heterogeneity. Depending on their tissue site and whether processing begins from a fresh or frozen sample, different tumors require different optimizations in order to obtain high quality single cell transcriptomic data. In this study, we profiled a range of tumor types, varying in cell-of-origin, solid and non-solid forms, patient ages, and transitions. The tumors also further varied in their tissue site and in their sample collection method. To enable profiling of such diverse samples, we developed a systematic toolbox for single cell RNA-Seq and single nucleus RNA-Seq of fresh and frozen clinical tumor samples. We validated this toolbox for 216,490 cells and nuclei extracted from 39 samples across 23 tumors (some tumors were split into multiple samples). The 23 tumors represented eight unique tumor types. This toolbox comprises both experimental and computational protocols as well as guidelines for comparing and selecting protocols for the biological problem of interest.

  Study phs001983

• SDR-seq_06_BCL

  Multiomic targeted scDNA-scRNA-seq (SDR-seq) of primary B-cell non-Hodgkin lymphomas. Aim is to link genomci variants to gene expression in single cells. Profiled two follicular lymphoma (FL) primary patient samples and one germinal center subtype diffuse large B-cell lymphoma (GCB) primary patient sample.

  Study EGAS50000000374

• Peripheral clonal expansion of T cells (scTCR-seq)

  Single-cell TCR-seq of tumor-infiltrating lymphocytes from 14 cancer patients before treatment, taken from tumor, normal adjacent tissue, and peripheral blood. Dataset consists of paired-end FASTQ files, including replicate libraries and runs.

  Dataset EGAD00001005465

• Analytical study of protein function and RNA expression involved in predicting treatment efficacy and adverse event development in lung cancer radiotherapy.

  The purpose of this study is to elucidate the functions of DNA repair proteins and RNA expression that are involved in the therapeutic efficacy and adverse events of radiotherapy for lung cancer at our hospital. In particular, this is an exploratory study to identify proteins and RNAs involved in the expression of proteins that are likely to be involved in the prediction of radiotherapy response and adverse events.

  Study JGAS000545

• RNA sequencing of Non-Small Cell Lung Cancer and adjacent normal tissue

  RNA sequencing was performed on 108 NSCLC tumor samples and their paired adjacent normal tissues (n=21) to identify associations with clinical and immune characteristics.

  Study EGAS50000000246

• BulkRNAseq - Notch Signaling Maintains a Progenitor-Like Subclass of Hepatocellular Carcinoma

  To identify the Notch signaling components expressed in both the human cancer cells and mouse stromal cells that typically comprise PDX tumors, we performed bulk RNA sequencing. Our results demonstrate that a JAG1-NOTCH2 signaling axis within the human cancer cell population drives the Notch dependency in the super-responder models, with NOTCH2 serving as the functionally relevant receptor.

  Study EGAS50000000515

• Cell Type-Specific and Disease-Associated eQTL in the Human Lung

  This study was conducted to investigate the genetic control of gene expression in a cell-type and context-specific manner in the human lung. We performed single-cell RNA-sequencing (scRNA-seq) of lung tissue from 66 Interstitial Lung Disease (ILD) cases and 48 unaffected donors. Employing a pseudo-bulk approach, we mapped expression quantitative trait loci (eQTL) across 38 cell types. The scRNA-seq data presented here include previously published (PMID 34262047) and unpublished samples. ILD tissue samples were obtained from lungs removed at the time of lung transplantation at either Vanderbilt University Medical Center (VUMC) or the Norton Thoracic Institute (NTI). Control tissue samples were obtained from lungs declined for organ donation either at the Donor Network of Arizona (DNA) or VUMC. The self-reported ethnicities of donors were 66.7% European, 9.6% African American, 17.5% not available (N/A), and 6.1% other. The smoking history includes 46.5% ever smoker, 29.8% never smoker, 23.7% N/A. For genotyping, flash-frozen tissue in DNA/RNA shield was homogenized via a bullet blender. Genomic DNA was extracted using Zymo Quick DNA/RNA microprep plus kit. Library preparation and low-pass Whole Genome Sequencing (WGS) were carried out at TGen or by Gencove Inc. At TGen, libraries were prepared using PCR-free Watchmaker kits (Watchmaker Genomics) with 200 ng input. Genomes were sequenced on NovaSeq at low coverage (typically 0.4–1x). The resulting sequence data were processed and imputed using Gencove's imputation platform.

  Study phs003521

• Risk Factors for Asymptomatic Diverticulosis

  Data for this analysis came from a prospective study of colonic diverticulosis at the University of North Carolina Hospital in Chapel Hill, North Carolina (NIH R01DK094738). This is a case-control genetic and transcriptomic study to identify the genetic and cellular determinants underlying colonic diverticulosis and the relationship with other gastrointestinal disorders. The study inclusion and exclusion are described below. DNA and RNA sequencing were performed on colonic tissue from 404 patients with (N=172) and without (N=232) diverticulosis. We assessed variation in the transcriptome associated with diverticulosis and integrated this variation with human intestine single-cell RNA-seq data. We integrated our expression quantitative trait loci with GWAS using Mendelian Randomization. A polygenic risk score analysis examined associations between severity of diverticulosis and other gastrointestinal disorders. We identified 38 genes with differential expression and 17 genes with varied transcript usage linked to diverticulosis. Our results suggest tissue remodeling as a primary mechanism for diverticula formation. The presence of diverticulosis was linked to stromal and epithelial cells in the colon including endothelial cells, myofibroblasts, fibroblasts, goblet, tuft, enterocytes, neurons, and glia. MR highlighted five genes including CCN3, CRISPLD2, ENTPD7, PHGR1, and TNFSF13. In diverticulosis cases, ENTPD7 upregulation was confirmed. A greater burden of diverticula was positively correlated with genetic predisposition to diverticulitis. The data related to the study including total RNA-Seq, SNP array and imputed genotypes will be available through dbGaP.

  Study phs003556

• Space Associated Stem Cell Hallmarks of Aging in Astronauts

  This study examined the effects of the stress of space, specifically low earth orbit, on hematopoietic stem and progenitor cells (HSPCs) that maintain lifelong hematopoiesis and immune responses. Enriched CD34+ HSPCs were derived from 7 astronauts before, during and after 10 and 21-day ISS missions on the International Space Station. The samples were used as input to whole transcriptome sequencing by bulk RNA-Seq performed at The Scripps Research Institute Next Generation Sequencing Core on Illumina NextSeq 2000 sequencer and single cell RNA-Seq performed at The Salk Institute for Biological Studies on Illumina NovaSeq X Plus sequencer. Subsequent expression, RNA editing, and retrotransposon analyses were performed to assess HSPC and immune subpopulation survival dynamics. Overall, these analyses revealed space-associated stem cell hallmarks of aging (SASHA), including spaceflight dependent alterations in HSPC survival and self-renewal, ADAR1, telomere maintenance, mobilization and cell cycle gene expression, combined with space-induced clonal hematopoietic mutations, APOBEC3C activation and retrotransposon deregulation to warrant countermeasure development to enable long-duration spaceflight. Post-spaceflight analysis revealed increased C-to-T and clonal hematopoiesis-associated mutations, repetitive element and base deaminase deregulation, decreased telomere maintenance gene expression, and decreased self-renewal capacity compared to ground controls. These results demonstrate the space-associated aging effects in HSPCs after month-long exposure to LEO, providing insights into utilizing the LEO environment to model space-accelerated aging and other age-related malignancies.

  Study phs004267

• RNA-seq on patient-derived, stage II, CRC cell lines

  The gut microbiome is a key player in the immunomodulatory and pro-tumorigenic microenvironment in colorectal cancer (CRC). It is well established that Fusobacterium’s virulence factors are responsible for its pro-tumorigenic properties, however the role of its metabolic cross-talk with the tumor remains unexplored. Here we use in vitro, in vivo, and in silico methods to describe a novel microbe-host interaction keystone: formate. Omics data reveals molecular signatures, linking a metabolically driven CRC phenotype with Fusobacteria. We observed a metabolic shift towards increased F. nucleatum formate secretion in gut-on-chip model co-cultures with patient-derived CRC cells, along with an accelerated cancer glutamine metabolism. We show that high formate levels trigger AhR signaling, increase cancer stemness and cellular invasion. Finally, we observed an expansion of Th17 cells accompanying F. nucleatum-induced tumorigenesis. Moving beyond observational studies, we applied new experimental approaches for gaining ecosystem-level mechanistic understanding of F. nucleatum’s role in cancer pathogenesis.

  Study EGAS00001005948

• Kidney_tumour_DNA

  This is a bulk DNA and RNA sequencing study of human renal tumours

  Study EGAS00001002486

• Transcriptomic analysis of the NA-PHER2 clinical trial

  We performed whole transcriptome RNA sequencing on serial tumour biopsies collected at baseline, Day 14, and after completion of all neoadjuvant therapy from the NA-PHER2 trial. Patients received neoadjuvant treatment with the combined regimen of trastuzumab, pertuzumab, palbociclib with or without addition of fulvestrant. Transcriptomic profiles were generated from 143 samples (Baseline n = 53, Day 14 n = 49, Surgery n = 41) corresponding to 53 of the 58 patients enrolled in NA-PHER2 trial (91.4%). RNA sequencing was performed on total RNA samples derived from formalin-fixed, paraffin-embedded (FFPE) tissue sections. RNA-Seq libraries were produced using NEBNext® Ultra™ II Directional RNA Library Prep Kit. The capture was then performed on cDNA libraries with the Twist Human Core Exome Enrichment System according to supplier recommendations (Twist Bioscience). The obtained eluted-enriched DNA samples was then sequenced on an Illumina NovaSeq as paired-end 100bp reads. FASTQ files are provided.

  Dataset EGAD50000000363

• RNAseq samples of patients with anti-PD-1 resistant HNSCC from a non-randomized, open-label phase 1b clinical trial

  Immune checkpoint blockade (ICB) is an effective treatment for a subset of patients with head and neck squamous cell carcinoma (HNSCC); however, the majority remain refractory. In a nonrandomized, open-label Phase 1b clinical trial, participants with recurrent and/or metastatic (R/M) HNSCC who had progressed on ICB were treated with low-dose 5-azacytidine (5-aza) daily for either 5 or 10 days, in combination with durvalumab and tremelimumab. The primary objective was to determine the biologically effective dose of 5-aza. In this study, RNA sequencing (RNA-seq) was performed on baseline and on-treatment samples from eight participants, and transcriptomic changes were analyzed to assess the impact of low-dose 5-aza treatment.

  Study EGAS50000000728

• PCa-LINES

  PCa-LINES: Ribo-minus RNA-seq of 4 patient samples and 2 PCa cell lines ---- Detection of fusion transcripts and their genomic breakpoints from RNA sequencing data Youri Hoogstrate, Malgorzata A. Komor, René Böttcher, Job van Riet, Harmen J. G. van de Werken, Stef van Lieshout, Ralf Hoffmann, Evert van den Broek, Anne S. Bolijn, Natasja Dits, Daoud Sie, David van der Meer, Floor Pepers, Chris H. Bangma, Geert J. L. H. van Leenders, Marcel Smid, Pim French, John W.M. Martens, Wilbert van Workum, Peter J. van der Spek, Bart Janssen, Eric Caldenhoven, Christian Rausch, Mark de Jong, Andrew P. Stubbs, Gerrit A. Meijer, Remond J.A. Fijneman, Guido Jenster bioRxiv 2021.05.17.441778; doi: https://doi.org/10.1101/2021.05.17.441778 https://www.biorxiv.org/content/10.1101/2021.05.17.441778v1

  Study EGAS00001004613

• An integrated molecular study of 20 hepatoblastoma pairs using whole genome sequencing and RNA sequencing

  Hepatoblastoma is an uncommon malignant liver cancer occurring in infants and children. The mutant background of hepatoblastoma has not been fully demonstrated. The aim of this study is to genomically depict the mutational landscape of hepatoblastoma through an integrative analysis of whole genome sequencing and RNA sequencing of 20 hepatoblastomas from Chinese individuals.

  Study EGAS00001002772

• RNA sequencing on colonic biopsies from inflammatory bowel disease patients treated with vehicle control, MEK inhibitor, or infliximab

  This dataset consists of RNA sequencing data (FASTQs) from intestinal mucosal biopsies from 9 IBD patients. All patients endoscopically active disease and were not receiving immunosuppressive or biologic therapies. All biopsies (6 per donor) were collected from a single inflamed site. Biopsies were cultured for 18 hours at an air-liquid interface in media containing either DMSO (vehicle control), PD-0325901 (0.5uM) or infliximab (10ug/ml; MSD) - two biopsies per condition. Sequencing was performed on a NovaSeq 6000 (100bp, PE reads). After 18 hours, biopsies were harvested and snap frozen. After lysis, RNA was extracted using an AllPrep DNA/RNA Mini Kit (Qiagen). Sequencing libraries were prepared from 10ng RNA using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara) following the manufacturer’s instructions. The quality and molarity of all libraries was assessed using a BioAnalyzer 2100 and the libraries were sequenced on a NovaSeq 6000 (100bp, PE reads).

  Dataset EGAD00001011333

• Whole Exome and RNA sequencing of synchronous female bilateral breast cancers

  Study EGAS00001006910

• T-ALL RNA-Seq raw data files

  Bone marrow or peripheral blood samples were collected of adult patients at first diagnosis of T-precursor acute lymphoblastic leukemia. RNA was isolated from mononuclear cells and subjected to mRNA library prep using Poly-A selection and sequencing on a NovaSeq 6000 system. Obtained gene expression profiles and gene fusion calls were used to allocate samples to molecular disease subtypes.

  Study EGAS50000000213

• Paired-end RNA-Seq Dataset of 72 Brain Organoid Samples: Sequencing and Gene Expression Analysis

  72 fastq sequencing files of 72 brain-organoid paired-end sequenced samples (R1/R2). RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit for Illumina following the manufacturer’s instructions (New England Biolabs, USA). mRNAs were first enriched with Oligo(dT) beads. The samples were sequenced using a 2x150 Pair-End configuration (ver. 1.5) on an Illumina NovaSeq 6000 The raw sequence reads were aligned to the human reference genome GRCh38 using the STAR aligner (Dobin et al., 2013). Gene expression levels were quantified using the FeatureCounts tool (Liao et al., 2014) (file: "All_Counts_final.xlsx") For more information, see "Study Description"

  Dataset EGAD50000000935

• Comparison between b2m KO and US2 expressing iPSC lines

  This dataset contains bulk RNA-seq transcriptomic profiles from a human induced pluripotent stem cell (hiPSC) line and three engineered derivatives: B2M knockout, EGFP overexpression, and US2 overexpression, alongside the parental line. Total RNA integrity was assessed using the Experion RNA StdSens 1K Analysis Kit on the Bio-Rad Experion Automated Electrophoresis System prior to library preparation and sequencing. Libraries were sequenced on an Illumina NovaSeq 6000 generating ~20 million reads per sample. Raw read quality was assessed with FastQC, reads were aligned to the human reference genome hg38 (Ensembl release 109) using STAR, and alignment/library QC metrics (e.g., orientation, composition, coverage) were evaluated with Picard.

  Dataset EGAD50000002321